Pyproject integration

.github/workflows/publish-to-pypi.yml

@@ -0,0 +1,103 @@
+name: Publish Python distribution to PyPI
+
+on:
+  release:
+    types: [published]
+
+permissions:
+  contents: read
+
+jobs:
+  build:
+    name: Build distribution
+    runs-on: ubuntu-latest
+    defaults:
+      run:
+        shell: bash -el {0}
+    steps:
+    - uses: actions/checkout@v6
+      with:
+        persist-credentials: false
+    - uses: conda-incubator/setup-miniconda@v3
+      with:
+          activate-environment: crispr-da
+          environment-file: environment.yml
+          auto-activate-base: false
+          conda-remove-defaults: "true"
+    - name: Test installed tools
+      run: |
+        conda info
+        conda env list
+        cmake --version
+        make --version
+        which python3
+    - name: Install pypa/build
+      run: python3 -m pip install build
+    - name: Build a binary wheel and a source tarball
+      run: python3 -m build
+    - name: Store the distribution packages
+      uses: actions/upload-artifact@v5
+      with:
+        name: release-dists
+        path: dist/
+    - name: Install locally using distribution files
+      run: python3 -m pip install dist/*.whl
+    - name: Build dependancies
+      run: crispr_da config -d
+    - name: Get tool version
+      run: |
+        crispr_da -h
+        crispr_da --version
+
+  publish-to-pypi:
+    name: Publish Python distribution to PyPI
+    needs:
+    - build
+    runs-on: ubuntu-latest
+    environment:
+      name: pypi
+      url: https://pypi.org/p/crispr-da
+    permissions:
+      id-token: write  # IMPORTANT: mandatory for trusted publishing
+    steps:
+    - name: Download all the dists
+      uses: actions/download-artifact@v6
+      with:
+        name: release-dists
+        path: dist/
+    - name: Publish distribution to PyPI
+      uses: pypa/gh-action-pypi-publish@release/v1
+
+  install-from-pypi:
+    name: Install Python distribution from PyPI
+    needs:
+      - publish-to-pypi
+    runs-on: ubuntu-latest
+    defaults:
+      run:
+        shell: bash -el {0}
+    steps:
+    - uses: actions/checkout@v6
+      with:
+        persist-credentials: false
+    - uses: conda-incubator/setup-miniconda@v3
+      with:
+          activate-environment: crispr-da
+          environment-file: environment.yml
+          auto-activate-base: false
+          conda-remove-defaults: "true"
+    - name: Test installed tools
+      run: |
+        conda info
+        conda env list
+        cmake --version
+        make --version
+        which python3
+    - name: Install from PyPI
+      run: pip install crispr-da
+    - name: Build dependancies
+      run: crispr_da config -d
+    - name: Get tool version
+      run: |
+        crispr_da -h
+        crispr_da --version

.github/workflows/publish-to-testpypi.yml

@@ -0,0 +1,110 @@
+name: Publish Python distribution to TestPyPI
+
+on: push
+
+jobs:
+  build:
+    name: Build distribution
+    runs-on: ubuntu-latest
+    defaults:
+      run:
+        shell: bash -el {0}
+    steps:
+    - uses: actions/checkout@v6
+      with:
+        persist-credentials: false
+    - uses: conda-incubator/setup-miniconda@v3
+      with:
+          activate-environment: crispr-da
+          environment-file: environment.yml
+          auto-activate-base: false
+          conda-remove-defaults: "true"
+    - name: Test installed tools
+      run: |
+        conda info
+        conda env list
+        cmake --version
+        make --version
+        which python3
+    - name: Get pip cache dir
+      id: pip-cache
+      run: |
+        echo "dir=$(pip cache dir)" >> $GITHUB_OUTPUT
+    - name: Restore pip cache
+      uses: actions/cache@v4
+      with:
+        path: ${{ steps.pip-cache.outputs.dir }}
+        key: ${{ runner.os }}-pip-${{ hashFiles('pyproject.toml') }}
+    - name: Install pypa/build
+      run: python3 -m pip install build
+    - name: Build a binary wheel and a source tarball
+      run: python3 -m build
+    - name: Store the distribution packages
+      uses: actions/upload-artifact@v5
+      with:
+        name: prerelease-dists
+        path: dist/
+    - name: Install locally using distribution files
+      run: python3 -m pip install dist/*.whl
+    - name: Build dependancies
+      run: crispr_da config -d
+    - name: Get tool version
+      run: |
+        crispr_da -h
+        crispr_da --version
+
+  publish-to-testpypi:
+    name: Publish Python distribution to TestPyPI
+    if: startsWith(github.ref, 'refs/tags')
+    needs:
+    - build
+    runs-on: ubuntu-latest
+    environment:
+      name: testpypi
+      url: https://test.pypi.org/p/crispr-da
+    permissions:
+      id-token: write  # IMPORTANT: mandatory for trusted publishing
+    steps:
+    - name: Download all the dists
+      uses: actions/download-artifact@v6
+      with:
+        name: prerelease-dists
+        path: dist/
+    - name: Publish distribution to TestPyPI
+      uses: pypa/gh-action-pypi-publish@release/v1
+      with:
+        repository-url: https://test.pypi.org/legacy/
+
+  install-from-testpypi:
+    name: Install Python distribution from TestPyPI
+    needs:
+      - publish-to-testpypi
+    runs-on: ubuntu-latest
+    defaults:
+      run:
+        shell: bash -el {0}
+    steps:
+    - uses: actions/checkout@v6
+      with:
+        persist-credentials: false
+    - uses: conda-incubator/setup-miniconda@v3
+      with:
+          activate-environment: crispr-da
+          environment-file: environment.yml
+          auto-activate-base: false
+          conda-remove-defaults: "true"
+    - name: Test installed tools
+      run: |
+        conda info
+        conda env list
+        cmake --version
+        make --version
+        which python3
+    - name: Install from TestPyPI
+      run: pip install -i https://test.pypi.org/simple/ --extra-index-url https://pypi.org/simple crispr-da
+    - name: Build dependancies
+      run: crispr_da config -d
+    - name: Get tool version
+      run: |
+        crispr_da -h
+        crispr_da --version

LICENCE

@@ -1,4 +1,4 @@
-3-Clause BSD License
+BSD 3-Clause "New" or "Revised" License
 
 Copyright (c) 2025-, Carl Schmitz, Jake Bradford, Dimitri Perrin
 

README.md

@@ -1,81 +1,110 @@
 # CRISPR-DA
-CRISPR-Cas9 sgRNA design across many genomes
+Adapting CRISPR gRNA design for detection assays.
 
-## Installation
+## Preamble
 
-1. Clone the repository from GitHub
+>CRISPR-Cas systems offer a viable alternative to traditional detection and diagnosis methods. However, their effectiveness relies heavily on the selection of appropriate guide RNA sequences. Existing gRNA design tools were primarily developed for gene editing and are not always directly applicable to CRISPR-based detection assays. In particular, alignment-based methods are still used to estimate gRNA specificity, even though they can miss a substantial portion of off-target sites. In this work, we introduce CRISPR-DA, a CRISPR gRNA design tool for detection assays. We show that it provides a better assessment of gRNA specificity than BLAST, which detected only 33.27 % and 0.43 % of cross-species off-targets in two datasets. Additionally, CRISPR-DA ran two and six times faster than BLAST on these datasets, respectively. Our method incorporates advances from gene-editing guide RNA design tools, including uncertainty-informed guide RNA design, to improve the selection of guides with high on-target activity. CRISPR-DA is available at https://github.com/bmds-lab/CRISPR-DA.
 
-   ```
-   git clone https://github.com/bmds-lab/CRISPR-DA
-   ```
-
-2. Install using pip
+## Licence
+BSD 3-Clause "New" or "Revised" License
 
-   ```
-   cd CRISPR-DA
-   python3.8 -m pip install -e .
-   ```
-
-3. Run an example
+See `LICENCE` and https://opensource.org/license/BSD-3-Clause for more details.
 
-    ```
-    cd examples
-    python3.8 design_for_covid_spike_protein.py
-    ```
+## Dependencies
 
-## Utilities
+### Option 1. Using Anaconda (Recommended)
+1. Download the `environment.yml` file from GitHub.
 
-### CRISPR-DA CLI
+2. Download and install [Anaconda](https://www.anaconda.com/download).
 
-#### Usage
+3. Setup conda enviroment.
+   ```
+   conda env create -f <path/to/downloaded/environment.yml>
+   ```
+
+### Option 2. Install dependencies manually
+1. Download and install the following (The software/program version provided were using during testing but there "should" be no problem using newer version).
+-  [Python](https://www.python.org/)>=3.12
+-  [CMake](https://cmake.org/)>=4.1.2
+-  [Boost](https://www.boost.org/)>=1.82
+-  [Make](https://www.gnu.org/software/make/)>=4.2.1
+NOTE: You can replace Make with whichever build system you like (E.g. [Ninja](https://ninja-build.org/)).
+
+## Installation
 
+### From [PyPi](https://pypi.org/project/crispr-da/) using pip (Recommended)
+1. Install using pip.
+   ```
+   pip install crispr-da
    ```
-$ CRISPR_DA --help
-usage: CRISPR_DA [-h] -g GENEID -a ACCESSIONS [ACCESSIONS ...] [-o OUTPUT]
 
-CRISPR-DA: for designing CRISPR-Cas9 sgRNA when many genomes are to be considered.
+2. Run `config` to install required binaries and initialise configuration file.
+   ```
+   crispr_da config
+   ```
 
-optional arguments:
-  -h, --help            show this help message and exit
-  -g GENEID, --geneid GENEID
-                        The NCBI gene ID to extract potential CRISPR target sites from
-  -a ACCESSIONS [ACCESSIONS ...], --accessions ACCESSIONS [ACCESSIONS ...]
-                        A list of NCBI accessions to score CRISPR sites against
-  -o OUTPUT, --output OUTPUT
-                        Output files prefix (e.g. `/home/user/results/covid` would become `/home/user/results/covid-guides.csv`, etc.). Default is
-                        `--geneid`.
-```
+### From source
+1. Clone the repository from GitHub.
+   ```
+   git clone https://github.com/bmds-lab/CRISPR-DA
+   ```
 
-#### Example
+2. Build distribution files.
+   ```
+   python3 -m build
+   ```
+   NOTE: It may be useful to ensure the latest version of PyPA's build is install. Simply run `python3 -m pip install --upgrade build`.
 
+3. Install CRISPR-DA using distribution files and pip.
    ```
-   $ CRISPR_DA -g 43740568 -a GCA_000820495.2 GCA_000838265.1 -o spike
+   python3 -m pip install ./dist/*.whl
    ```
 
-Output file `spike-guides.md` (minimised for this readme):
+4. Run `config` to install required binaries and initialise configuration file.
+   ```
+   crispr_da config
+   ```
 
+## CRISPR-DA CLI
 
-| seq                     |   start |   end | ssline_1                   | ssStructure                | strand   |   acceptedByMm10db |   passedG20 |   acceptedBySgRnaScorer |   consensusCount |   ssEnergy |   passedAvoidLeadingT | passedSecondaryStructure   |   AT |   sgrnascorer2score |   passedATPercent |   passedTTTT |
-|:------------------------|--------:|------:|:---------------------------|:---------------------------|:---------|-------------------:|------------:|------------------------:|-----------------:|-----------:|----------------------:|:---------------------------|-----:|--------------------:|------------------:|-------------:|
-| TACACTAATTCTTTCACACGTGG |      81 |   104 | GACACUAAUUCUUUCACAGUGCUUUU | ..((((..(((......(((().... | +        |                  0 |           1 |                       1 |                2 |      -19.2 |                     0 | !                          |   65 |           1.00437   |                 1 |            1 |
-| CTCAGTTTTACATTCAACTCAGG |     134 |   157 | GUCAGUUUUACAUUCAACGUGCUUUU | ..((.((((........(((.).... | +        |                  0 |           0 |                       0 |                0 |      -19.2 |                     1 | 0                          |   65 |          -0.537641  |                 1 |            0 |
+### Usage
 
+   ```
+   $ crispr_da -h
+   usage: crispr_da [-h] [-v] {config,analyse} ...
 
+   CRISPR-DA: gRNA design for detection assays.
 
-Output file `spike-scores.md` (minimised for this readme):
+   options:
+   -h, --help        show this help message and exit
+   -v, --version     Print CRISPR-DA version
 
+   subcommands:
+   {config,analyse}
+      config          Run config
+      analyse         Run analysis
+   ```
 
-| accession       | TACACTAATTCTTTCACACG   | CTGGGACCAATGGTACTAAG   | GAGAAGTCTAACATAATAAG   | GAAGTCAGACAAATCGCTCC   |
-|:----------------|:-----------------------|:-----------------------|:-----------------------|:-----------------------|
-| GCA_000820495.2 | (100.0, 100.0)         | (100.0, 100.0)         | (100.0, 100.0)         | (100.0, 100.0)         |
-| GCA_000838265.1 | (100.0, 100.0)         | (100.0, 100.0)         | (100.0, 100.0)         | (100.0, 100.0)         |
+### Example
 
+   ```
+   $ crispr_da analyse --target_gene_id 43740568 --evaluation_accessions GCA_000820495.2 GCA_000838265.1
+   ```
 
-## Dependencies
+Expected output format (minimised for this readme):
 
-- Python 3.7 +
+| accession       | TACACTAATTCTTTCACACGTGG |  ...  | CTTTCTTTTCCAATGTTACTTGG |
+|:----------------|:------------------------|:------|:------------------------|
+| GCA_000820495.2 | (100.0, 100.0)          |  ...  | (100.0, 100.0)          |
+| GCA_000838265.1 | (100.0, 100.0)          |  ...  | (100.0, 100.0)          |
 
-- [Pandas](https://pypi.org/project/pandas/)
+## CRISPR-DA Python Library
 
-- [NCBI Dataset PyLib](https://pypi.org/project/ncbi-datasets-pylib/)
+### Usage
+CRISPR-DA can also be access using Python.
+```
+from crispr_da import run_analysis
+```
 
+### Example
+An minimal example has been included in the `examples/design_for_covid_spike_protein.py`