Skip to content

Command Line Usage

Jeffrey Barrick edited this page Aug 14, 2021 · 4 revisions

OSTIR can be executed via the included command-line script ostir.

usage: ostir [-h] -i str/filepath [-o filepath] [-v] [-s int] [-e int] [-a str] [-p] [-q] [-j int] [-t [string|csv|fasta]]

Open Source Transcription Initiation Rates

optional arguments:
  -h, --help            show this help message and exit
  -i str/filepath, --input str/filepath
                        Input filename (FASTA/CSV) or DNA/RNA sequence. For CSV input files, there must be a 'seq' or 'sequence'
                        column. Other columns will override any options provided at the command line if they are present:
                        'name/id', 'start', 'end', 'anti-Shine-Dalgarno'.
  -o filepath, --output filepath
                        Output file path. If not provided, results will output to the console.
  -v, --verbose         Prints verbose output.
  -s int, --start int   Most 5' position to consider a start codon beginning.
  -e int, --end int     Most 3' position to consider a start codon beginning
  -a str, --anti-Shine-Dalgarno str
                        anti-Shine-Dalgarno sequence: the 9 bases located at the 3' end of 16S rRNA. May be provided as DNA or
                        RNA. Defaults to that of E. coli (ACCTCCTTA).
  -p, --print-sequence  Include the input mRNA sequence in output CSV files
  -q, --print-anti-Shine-Dalgarno
                        Include the anti-Shine-Dalgarno sequence in output CSV files
  -j int, --threads int
                        Number of threads for multiprocessing
  -t [string|csv|fasta], --type [string|csv|fasta]
                        Input type (overrides autodetection)

Example of Command Line Input/Output

Example command for specifying the mRNA sequence to search on the command line:

ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT 

Output of this command:

_________________________________________________
     start_codon  start_position      expression RBS_distance_bp        dG_total    dG_rRNA:mRNA         dG_mRNA      dG_spacing      dG_standby  dG_start_codon
             ATG               7          3.4040              -2         15.1346         -1.9810         -1.1000         17.2096          0.0000         -1.1940
             ATG              21        643.9384               4          2.0289         -5.2810         -8.5000          0.0039          0.0000         -1.1940
             ATG              54          0.0558               1         25.4101         -4.3810        -13.8000         17.1851          0.0000         -1.1940
             ATG              72        227.5882               4          4.6289         -0.6810         -6.5000          0.0039          0.0000         -1.1940
_________________________________________________

See Output Column Descriptions below for an explanation of the output.

Example of CSV Input/Output

Example CSV input file (file: input.csv):

id seq anti-Shine-Dalgarno
first_sequence TTCTAGActttaatttaacgtaaataaggaagtcattATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGA ACCTCCTTA
second_sequence TTCTAGActttaatttaacgtaaataaggaagtcattATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGA
TTCTAGActttaatttaacgtaaataaggaagtcattATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGA CCCCCCCCC

This example demonstrates that if a column corresponding to a parameter is missing or blank for one input sequence, then the default value for that parameter will be substituted for the missing value. Additional examples of CSV and FASTA input files can be found in the tests directory of the code repository.

Example command that specifies CSV input and output files, assigns TCTGAAGAC as the default anti-Shine-Dalgarno sequence, includes the anti-Shine-Dalgarno sequence as a column in the output, and uses four threads for parallelization:

ostir -j 4 -a TCTGAAGAC -q -i input.csv -o output.csv

Example CSV output (file: output.csv):

name anti-Shine-Dalgarno start_codon start_position expression RBS_distance_bp dG_total dG_rRNA:mRNA dG_mRNA dG_spacing dG_standby dG_start_codon
first_sequence ACCTCCTTA ATG 38 643.9384 4 2.0289 -8.381 -11.6 0.0039 0.0 -1.194
first_sequence ACCTCCTTA ATG 71 0.0558 1 25.4101 -4.381 -13.8 17.1851 0.0 -1.194
first_sequence ACCTCCTTA ATG 89 227.5882 4 4.6289 -0.681 -6.5 0.0039 0.0 -1.194
second_sequence TCTGAAGAC ATG 38 34.6638 7 9.3332 -1.881 -11.6 0.8082 0.0 -1.194
second_sequence TCTGAAGAC ATG 71 40.1662 6 8.9649 -3.981 -13.8 0.3399 0.0 -1.194
second_sequence TCTGAAGAC ATG 89 460.8985 6 2.8649 -3.381 -6.5 0.3399 -0.6 -1.194
sequence_3 CCCCCCCCC ATG 38 44.2111 5 8.725 -1.681 -11.6 0.0 0.0 -1.194
sequence_3 CCCCCCCCC ATG 71 0.0017 22 34.1706 -1.681 -13.8 23.2456 0.0 -1.194

Output Column Descriptions

  • name: Name of input sequence.
  • anti-Shine-Dalgarno: Anti-Shine-Dalgarno sequence.
  • start_codon: Start codon for predicted translation initiation rate.
  • start_position: Nucleotide position of first start codon base in input sequence. (1-indexed).
  • expression: Predicted translation initiation rate at this start codon.
  • RBS_distance_bp: Number of nucleotides between the predicted ribosome-binding site (RBS) and the start codon.
  • dG_total: Total change in free energy (ΔG) for translation initiation at this RBS.
  • dG_rRNA:mRNA: Free energy term for ribosome binding to the mRNA.
  • dG_mRNA: Free energy term for unfolding mRNA secondary structures that overlap the RBS and start codon region.
  • dG_spacing: Free energy term that accounts for the effect of spacing (the number of nucleotides) between an RBS and start codon.
  • dG_standby: Free energy term for unfolding mRNA secondary structures that occlude the standby site (the four bases upstream of the RBS).
  • dG_start_codon: Free energy term for initiator tRNA binding to the start codon.

For more information about this terminology and a description of the energy terms see the Background Page.

Clone this wiki locally