Skip to content

Port to python3 7 #2

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Open
GabLoyer wants to merge 2 commits into
base: master
Choose a base branch
from
Open

Port to python3 7 #2

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
2 commits
Select commit Hold shift + click to select a range
3c5faf4
Port project to python 3.7
Jan 17, 2021
52cd35b
Update Gurobi version.
Feb 7, 2021
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
5 changes: 5 additions & 0 deletions .gitignore
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,3 +1,8 @@
# Bank data #
######################
No_Redondance_DESC/
No_Redondance_VIEW3D/

# OS generated files #
######################
.DS_Store
Expand Down
6 changes: 3 additions & 3 deletions README.txt
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,10 +1,10 @@
RNAMoIP 1.1
RNAMoIP 1.2

This software runs in command line and is written in python2.7
This software runs in command line and is written in python3.7
with the GUROBI5.1 python API.

DEPENDANCIES:
1) Gurobi (implemented with Gurobi 4.6 free academic licence)
1) Gurobi (implemented with Gurobi 9.1.0 free academic licence)
http://gurobi.com/
To make sure that installation work, from a terminal,
you should be able to type:
Expand Down
92 changes: 46 additions & 46 deletions Src/RNAMoIP.py
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -135,7 +135,6 @@ def getPositionsInsertion(motif, rna):
else:
found = found.start()


position = [[(found + 1, found + len(motif[0]))]]
if(len(motif) == 1): #if we can match, and there is only one sequence,
if found + len(motif[0]) < len(rna):
Expand Down Expand Up @@ -174,7 +173,7 @@ def createMotifsDict(rna, pathDesc):
A special key: MAX hold as value the biggest number of sequence in a motif that can be inserted
"""
if not os.path.isdir(pathDesc):
print 'there is an error with the path to the DESC folder : %s' % pathDesc
print('there is an error with the path to the DESC folder : %s' % pathDesc)
sys.exit()
dict = {}
#We go through every .desc file
Expand Down Expand Up @@ -203,7 +202,7 @@ def createMotifsDict(rna, pathDesc):
dict["max"] = dict["max"] if dict["max"] > len(positions) else len(positions)

if(len(dict) < 2):
print "No motif could be inserted.\n"
print("No motif could be inserted.\n")
sys.exit()

return dict
Expand Down Expand Up @@ -331,7 +330,7 @@ def constraint_extremities_only_overlap(m, cpts_dict, vars_dict, max_cpts, BASES
weights = [1.0 for y in range(len(arround))] + [0.75 for y in range(len(over))] + [-0.25 for y in range(len(bp_arround))]
lin_expr = LinExpr(weights, arround + over + bp_arround)
lin_expr.addConstant(float(len(bp_arround))*0.25)
m.addConstr(1.0001, GRB.GREATER_EQUAL, lin_expr, "only_one_%d" % (z+1))
m.addLConstr(1.0001, GRB.GREATER_EQUAL, lin_expr, "only_one_%d" % (z+1))
return None

def constraint_component_followed(m, cpts_dict, vars_dict, max_cpts):
Expand All @@ -340,7 +339,7 @@ def constraint_component_followed(m, cpts_dict, vars_dict, max_cpts):
for (x,k,l) in cpts_dict["CPTS%dOf%d" % (j+1, i+1)]:
next_cpts = [vars_dict["C-%s-%d-%d-%d" % (x2,k2,l2,j+2)] for (x2,k2,l2) in cpts_dict['CPTS%dOf%d' % (j+2, i+1)] if
x == x2 and k2 > l + 5]
m.addConstr(vars_dict["C-%s-%d-%d-%d" % (x,k,l,j+1)], GRB.LESS_EQUAL, LinExpr([1.0 for z in range(len(next_cpts))], next_cpts),
m.addLConstr(vars_dict["C-%s-%d-%d-%d" % (x,k,l,j+1)], GRB.LESS_EQUAL, LinExpr([1.0 for z in range(len(next_cpts))], next_cpts),
"Followed%dOf%d-%s-%d-%d" % (j+1, i+1, x, k, l))
return None

Expand All @@ -350,7 +349,7 @@ def constraint_component_preceded(m, cpts_dict, vars_dict, max_cpts):
for (x,k,l) in cpts_dict["CPTS%dOf%d" % (j+2, i+1)]:
prev_cpts = [vars_dict["C-%s-%d-%d-%d" % (x2,k2,l2,j+1)] for (x2,k2,l2) in cpts_dict['CPTS%dOf%d' % (j+1, i+1)] if
x == x2 and l2 < k - 5]
m.addConstr(vars_dict["C-%s-%d-%d-%d" % (x,k,l,j+2)], GRB.LESS_EQUAL, LinExpr([1.0 for z in range(len(prev_cpts))], prev_cpts),
m.addLConstr(vars_dict["C-%s-%d-%d-%d" % (x,k,l,j+2)], GRB.LESS_EQUAL, LinExpr([1.0 for z in range(len(prev_cpts))], prev_cpts),
"Preceded%dOf%d-%s-%d-%d" % (j+2, i+1, x, k, l))
return None

Expand All @@ -362,12 +361,12 @@ def constraint_motifs_entirely_inserted(m, cpts_dict,motifs_names_dict, vars_dic
for j in range(1,i+1):
next_cpts.extend([vars_dict["C-%s-%d-%d-%d" % (x,k,l,j+1)] for (x,k,l) in cpts_dict["CPTS%dOf%d" % (j+1, i+1)] if x == mot])
weights = [ i for z in range(len(first))] + [-1.0 for z in range(len(next_cpts))]
m.addConstr(LinExpr(weights, first + next_cpts), GRB.EQUAL, 0, "AllSeq-%s" % mot)
m.addLConstr(LinExpr(weights, first + next_cpts), GRB.EQUAL, 0, "AllSeq-%s" % mot)
return None

def constraint_max_basepairs_removal(m, BASES, max_bp_removal, vars_dict):
bps = [vars_dict["D-%d-%d" % (i, j)] for (i, j) in BASES]
m.addConstr(LinExpr([1.0 for z in range(len(bps))], bps), GRB.LESS_EQUAL, len(BASES) * max_bp_removal, "max_nb_bp_removed")
m.addLConstr(LinExpr([1.0 for z in range(len(bps))], bps), GRB.LESS_EQUAL, len(BASES) * max_bp_removal, "max_nb_bp_removed")
return None

def constraint_components_surrounded(m, cpts_dict, motifs_names_dict, vars_dict, BASES, max_cpts):
Expand All @@ -381,25 +380,25 @@ def constraint_components_surrounded(m, cpts_dict, motifs_names_dict, vars_dict,
weights = [-1.0 for z in range(len(bps_arround))] + [1.0 for z in range(len(cpts_arround))]
lin_expr = LinExpr(weights, bps_arround + cpts_arround)
lin_expr.addConstant(len(bps_arround))
m.addConstr(lin_expr, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-1" % (x,k,l)], "cpt_surrounded-%s-%d-%d-1" %(x,k,l))
m.addLConstr(lin_expr, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-1" % (x,k,l)], "cpt_surrounded-%s-%d-%d-1" %(x,k,l))
else:
m.addConstr(0, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-1" % (x,k,l)], "cpt_surrounded-%s-%d-%d-1" %(x,k,l))
m.addLConstr(0, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-1" % (x,k,l)], "cpt_surrounded-%s-%d-%d-1" %(x,k,l))
else:
bps_arround = [vars_dict["D-%d-%d" % (u,v)] for (u,v) in BASES if k >= u >= k-1 or l <= u <= l+1 or k >= v >= k-1 or l <= v <= l + 1 ]
if len(bps_arround) > 0:
weights = [-1.0 for z in range(len(bps_arround))]
lin_expr = LinExpr(weights, bps_arround)
lin_expr.addConstant(len(bps_arround))
m.addConstr(lin_expr, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-%d" % (x,k,l, i+1)], "cpt_surrounded-%s-%d-%d-%d" %(x,k,l,i+1))
m.addLConstr(lin_expr, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-%d" % (x,k,l, i+1)], "cpt_surrounded-%s-%d-%d-%d" %(x,k,l,i+1))
else:
m.addConstr(0, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-%d" % (x,k,l, i+1)], "cpt_surrounded-%s-%d-%d-%d" %(x,k,l,i+1))
m.addLConstr(0, GRB.GREATER_EQUAL, vars_dict["C-%s-%d-%d-%d" % (x,k,l, i+1)], "cpt_surrounded-%s-%d-%d-%d" %(x,k,l,i+1))
return None

def constraint_most_one_motif_more_3_cpts(m, cpts_dict, vars_dict, max_cpts):
motifs_list = []
for i in range(2,max_cpts):
motifs_list.extend([vars_dict["C-%s-%d-%d-1" % (x,k,l)] for (x,k,l) in cpts_dict["CPTS1Of%d" % (i+1)]])
m.addConstr(LinExpr([1.0 for z in range(len(motifs_list))], motifs_list), GRB.LESS_EQUAL, 1, "1MotOf3Seqs")
m.addLConstr(LinExpr([1.0 for z in range(len(motifs_list))], motifs_list), GRB.LESS_EQUAL, 1, "1MotOf3Seqs")
return None

def constraint_interior_loops_arround_well_balanced(m, BASES, cpts_dict, vars_dict, motifs_names_dict, rna_len):
Expand All @@ -410,8 +409,8 @@ def constraint_interior_loops_arround_well_balanced(m, BASES, cpts_dict, vars_di
first = [vars_dict["C-%s-%d-%d-1" % (x,k,l)] for (x,k,l) in cpts_dict['CPTS1Of2'] if mot == x and (l < u or k > v)]
second = [vars_dict["C-%s-%d-%d-2" % (x,k,l)] for (x,k,l) in cpts_dict['CPTS2Of2'] if mot == x and (l < u or k > v)]
weights = [1.0 for z in range(len(first))] + [-1.0 for z in range(len(second))]
m.addConstr(LinExpr([-rna_len], [vars_dict["D-%d-%d" % (u,v)]]), GRB.LESS_EQUAL, LinExpr(weights, first + second), "2_cpts_consistend_left-%d-%d" % (u,v))
m.addConstr(LinExpr([rna_len], [vars_dict["D-%d-%d" % (u,v)]]), GRB.GREATER_EQUAL, LinExpr(weights, first + second), "2_cpts_consistend_left-%d-%d" % (u,v))
m.addLConstr(LinExpr([-rna_len], [vars_dict["D-%d-%d" % (u,v)]]), GRB.LESS_EQUAL, LinExpr(weights, first + second), "2_cpts_consistend_left-%d-%d" % (u,v))
m.addLConstr(LinExpr([rna_len], [vars_dict["D-%d-%d" % (u,v)]]), GRB.GREATER_EQUAL, LinExpr(weights, first + second), "2_cpts_consistend_left-%d-%d" % (u,v))
return None

def constraint_3_way(m, cpts_dict, vars_dict, BASES, motifs_names_dict, rna_len):
Expand All @@ -427,8 +426,8 @@ def constraint_3_way(m, cpts_dict, vars_dict, BASES, motifs_names_dict, rna_len)
tot_part.extend(first_part)
tot_part.extend(second_part)
tot_part.extend(third_part)
m.addConstr(LinExpr(coeffs, tot_part), GRB.LESS_EQUAL, LinExpr( [rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "+3_way_between_D-%d-%d" % (k,l))
m.addConstr(LinExpr(coeffs, tot_part), GRB.GREATER_EQUAL, LinExpr( [-rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "-3_way_between_D-%d-%d" % (k,l))
m.addLConstr(LinExpr(coeffs, tot_part), GRB.LESS_EQUAL, LinExpr( [rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "+3_way_between_D-%d-%d" % (k,l))
m.addLConstr(LinExpr(coeffs, tot_part), GRB.GREATER_EQUAL, LinExpr( [-rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "-3_way_between_D-%d-%d" % (k,l))

def constraint_4_way(m, cpts_dict, vars_dict, BASES, motifs_names_dict, rna_len):
for (k,l) in BASES:
Expand All @@ -443,8 +442,8 @@ def constraint_4_way(m, cpts_dict, vars_dict, BASES, motifs_names_dict, rna_len)
tot_part.extend(second_part)
tot_part.extend(third_part)
tot_part.extend(fourth_part)
m.addConstr(LinExpr(coeffs, tot_part), GRB.LESS_EQUAL, LinExpr( [rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "+4_way_between_D-%d-%d" % (k,l))
m.addConstr(LinExpr(coeffs, tot_part), GRB.GREATER_EQUAL, LinExpr( [-rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "-4_way_between_D-%d-%d" % (k,l))
m.addLConstr(LinExpr(coeffs, tot_part), GRB.LESS_EQUAL, LinExpr( [rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "+4_way_between_D-%d-%d" % (k,l))
m.addLConstr(LinExpr(coeffs, tot_part), GRB.GREATER_EQUAL, LinExpr( [-rna_len] ,[vars_dict["D-%d-%d" % (k,l)]]), "-4_way_between_D-%d-%d" % (k,l))

def constraint_no_lonely_bp(m, vars_dict, BASES, rna_len):
#First border cases
Expand All @@ -458,7 +457,7 @@ def constraint_no_lonely_bp(m, vars_dict, BASES, rna_len):
lin_expr.addConstant(len(before_after))
else:
lin_expr.addConstant(len(before_after) + 1)
m.addConstr(1, GRB.LESS_EQUAL, lin_expr, "stack_bp_%d" % i)
m.addLConstr(1, GRB.LESS_EQUAL, lin_expr, "stack_bp_%d" % i)
#i == rna_len
i = rna_len
before_after = [vars_dict['D-%d-%d' % (u,v)] for (u,v) in BASES if u == i - 1 or v == i - 1]
Expand All @@ -479,17 +478,17 @@ def constraint_no_lonely_bp(m, vars_dict, BASES, rna_len):
lin_expr.addConstant(len(before_after))
else:
lin_expr.addConstant(len(before_after) + 1)
m.addConstr(1, GRB.LESS_EQUAL, lin_expr, "stack_bp_%d" % i)
m.addLConstr(1, GRB.LESS_EQUAL, lin_expr, "stack_bp_%d" % i)

def constraint_cover_more_bp(model, cpts_dict, vars_dict, BASES, motifs_names_dict ):
def constraint_cover_more_bp(model, cpts_dict, vars_dict, BASES, motifs_names_dict):
for mot in motifs_names_dict['MOTIFS2']:
for (x,k,l) in ( (x2,k2,l2) for (x2,k2,l2) in cpts_dict['CPTS1Of2'] if x2 == mot):
for (y,m,n) in ( (x2,k2,l2) for (x2,k2,l2) in cpts_dict['CPTS2Of2'] if x2 == mot and k2 > l + 3):
coverage = list(range(k,l+1)) + list(range(m,n+1))
bases_inside = [(u,v) for (u,v) in BASES if u in coverage and v in coverage]
bases = [(u,v) for (u,v) in BASES if u in coverage or v in coverage and (u,v) not in bases_inside]
if len(coverage)-1 <= 2*len(bases_inside)+len(bases):
model.addConstr(LinExpr([1,1], [vars_dict['C-%s-%d-%d-1' % (mot, k,l)], vars_dict['C-%s-%d-%d-2' % (mot, m, n)]]), GRB.LESS_EQUAL, 1)
model.addLConstr(LinExpr([1,1], [vars_dict['C-%s-%d-%d-1' % (mot, k,l)], vars_dict['C-%s-%d-%d-2' % (mot, m, n)]]), GRB.LESS_EQUAL, 1)

def gurobi_create_model(motifs_dict, secStructPos, rna, max_bp_removal):
"""
Expand Down Expand Up @@ -571,8 +570,8 @@ def gurobi_find_all_optimal_solutions(motifs_dict, sec_struct_pos, rna, max_bp_r
m.optimize()

if m.Status != GRB.Status.OPTIMAL:
print '-------------------------'
print ' NO SOLUTIONS!'
print('-------------------------')
print(' NO SOLUTIONS!')
sys.exit(0)

min_val = m.ObjVal
Expand All @@ -597,12 +596,12 @@ def gurobi_find_all_optimal_solutions(motifs_dict, sec_struct_pos, rna, max_bp_r
tot_sols = in_sol + not_in_sol
lin_expr = LinExpr(weights, tot_sols)
list_of_lin_expr.append(lin_expr)
m.addConstr(lin_expr, GRB.GREATER_EQUAL, -len(in_sol) + 1)
m.addLConstr(lin_expr, GRB.GREATER_EQUAL, -len(in_sol) + 1)
m.update()
print '\n#########################\n'
print('\n#########################\n')
m.optimize()
if not m.Objval or m.ObjVal > min_val + 0.5:
print "\nAll Optimal Solutions have been found\nNext best score: %s\n" % m.Objval
print("\nAll Optimal Solutions have been found\nNext best score: %s\n" % m.Objval )
break

return m, model_list_of_dicts, list_sols, list_of_lin_expr, min_val
Expand Down Expand Up @@ -684,20 +683,20 @@ def help(rna_seq='',
required_arg='',
max_nb_sols=''):
if rna_seq:
print 'The RNA sequence should only contain the characters "ACGU"\n'
print('The RNA sequence should only contain the characters "ACGU"\n')
if sec_struct:
print """The secondary structure should only contain the characters "(.)"
and be a well balanced parenthese equation\n"""
print("""The secondary structure should only contain the characters "(.)"
and be a well balanced parenthese equation\n""")
if max_bp_removal:
print "The max number of base pairs should be between 0 and 1\n"
print("The max number of base pairs should be between 0 and 1\n")
if max_components:
print "The number of components should be greater than 3\n"
print("The number of components should be greater than 3\n")
if required_arg:
print "A required argument is missing\n"
print("A required argument is missing\n")
if max_nb_sols:
print "The maximal number of solutions should be bigger than 0\n"
print("The maximal number of solutions should be bigger than 0\n")

print """ RNAMoIP v1.1
print(""" RNAMoIP v1.2
ARGUMENTS
REQUIRED:
-s The rna Sequence
Expand All @@ -717,7 +716,7 @@ def help(rna_seq='',
gurobi.sh RNAMoIP.py -s 'GGGCGGCCUUCGGGCUAGACGGUGGGAGAGGCUUCGGCUGGUCCACCCGUGACGCUC' -ss '((((((((....))))..((((..(((..(((....)))..)))..))))...))))' -d 'No_Redondance_DESC' > my_output.txt

gurobi.sh RNAMoIP.py -s 'GGGCGGCCUUCGGGCUAGACGGUGGGAGAGGCUUCGGCUGGUCCACCCGUGACGCUC' -ss "/path/to/sec/struct/list.tt" -d 'No_Redondance_DESC' -r 0.4 -m_sols 5 > my_output.txt
"""
""")

if __name__ == '__main__':
rna_seq = ''
Expand All @@ -742,7 +741,7 @@ def help(rna_seq='',
elif option == '-m_sols':
max_nb_sols = validate_max_nb_sols(opts[i+1])
elif option in ('-h','-help'):
print help()
print(help())
sys.exit(0)
if not all((rna_seq,
l_sec_struct_positions,
Expand Down Expand Up @@ -770,14 +769,15 @@ def help(rna_seq='',
for list_sols,val,sec_struct in all_sols:
if val > min_val:
break
print "Solution for the secondary structure:"
print "\t%s" % sec_struct
print("Solution for the secondary structure:")
print("\t%s" % sec_struct)
for i in range(len(list_sols)):
print
print 'Optimal solution nb: ',i + 1
print 'Corrected secondary structure:'
print "\t%s" % remove_deleted(sec_struct,list_sols[i])
print()
print('Optimal solution nb: ',i + 1)
print('Corrected secondary structure:')
print("\t%s" % remove_deleted(sec_struct,list_sols[i]))
for name in list_sols[i]:
print '\t', name
print('\t', name)

print("\nThe optimal solutions has as value:\n\t%s" % min_val,)

print "\nThe optimal solutions has as value:\n\t%s" % min_val,