diff --git a/CHANGELOG.md b/CHANGELOG.md index 14b4346b..5066c80c 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -169,6 +169,35 @@ Sections commonly used: Features, Bug fixes, Other changes. union: they came from one molecule. Writes `matrix.mtx`, `features.tsv` and `transcriptEndDistanceDistribution.txt` under `Solo.out/Transcript3p/raw/`. +- **`--genomeTransformOutput SAM`** reports alignments in the original + genome's coordinates. `--genomeTransformType Haploid` bakes a VCF's + variants into the genome, so reads carrying those alleles align + without mismatches, but every reported coordinate then refers to a + genome nobody else has. This maps each alignment back through the + conversion blocks written at build time: an indel baked into the + sequence reappears as an `I`/`D` CIGAR operation at the original + position, and junction motifs are reclassified against the original + genome rather than the transformed one. The SAM header comes from + the original genome too. `SJ` and `Quant` remain unimplemented and + are refused, as are the flag combinations whose other outputs would + stay in transformed coordinates. + +- **`--genomeType SuperTranscriptome`** condenses the genome to the union + of its annotated exons: overlapping exons are merged, the merged + intervals concatenated, and overlapping transcripts grouped into + superTranscripts, one per condensed chromosome (`st0`, `st1`, ...). + The index then covers only exonic sequence, and introns cannot be + crossed because they are not present. Requires `--sjdbGTFfile`. + Writes `superTranscriptSequences.fasta`, `transcriptSequences.fasta`, + `superTranscriptSJcollapsed.tsv` and + `fullGenome/conversionToFullGenome.tsv` alongside the index. + + Diverges from STAR on minus-strand exons, deliberately. STAR condenses + the sequence before filling the reverse-complement half of its genome + buffer, so minus-strand superTranscripts read uninitialised memory; + here they hold the actual reverse complement. Recorded in + `docs-old/dev/divergences.md` and locked by a test asserting the + hand-derived sequence. ### Bug fixes diff --git a/src/genome/mod.rs b/src/genome/mod.rs index 174ba42c..fa7adaac 100644 --- a/src/genome/mod.rs +++ b/src/genome/mod.rs @@ -1,4 +1,5 @@ pub mod fasta; +pub mod supertranscript; pub mod transform; use std::path::Path; @@ -6,7 +7,7 @@ use std::path::Path; use crate::error::Error; use crate::params::Parameters; -use fasta::parse_fasta_files; +use fasta::{Chromosome, parse_fasta_files}; /// STAR's genome spacing character (used for inter-chromosome padding). const GENOME_SPACING_CHAR: u8 = 5; @@ -213,10 +214,25 @@ impl Genome { None }; + Self::from_chromosomes(&chromosomes, bin_nbits, transform_blocks) + } + + /// Lay out a genome from chromosome sequences already in base codes: + /// pad each to a `2^chr_bin_nbits` boundary, then fill the + /// reverse-complement half. + /// + /// [`from_fasta`](Self::from_fasta) is this plus FASTA parsing and the + /// VCF transform. `--genomeType SuperTranscriptome` uses it directly, + /// since its chromosomes are built rather than read. + pub fn from_chromosomes( + chromosomes: &[Chromosome], + bin_nbits: u32, + transform_blocks: Option>, + ) -> Result { // First pass: chromosome names/lengths, validating non-zero length. let mut chr_name = Vec::new(); let mut chr_length = Vec::new(); - for chrom in &chromosomes { + for chrom in chromosomes { let len = chrom.sequence.len() as u64; if len == 0 { return Err(Error::Fasta(format!( diff --git a/src/genome/supertranscript.rs b/src/genome/supertranscript.rs new file mode 100644 index 00000000..6ff9fef1 --- /dev/null +++ b/src/genome/supertranscript.rs @@ -0,0 +1,518 @@ +//! `--genomeType SuperTranscriptome`: condense a genome to the union of its +//! annotated exons (STAR `GTF_superTranscript.cpp` + +//! `SuperTranscriptome::sjCollapse`). +//! +//! Instead of indexing the whole genome, the index covers only exonic +//! sequence: overlapping exons are merged, the merged intervals are +//! concatenated, and the transcripts that overlap are grouped into +//! superTranscripts, one per condensed chromosome (`st0`, `st1`, ...). Reads +//! then align against a reference a fraction of the size, and introns cannot +//! be crossed because they are not there. +//! +//! The output is a genome and an annotation in condensed coordinates, which +//! the ordinary build path consumes unchanged, plus four files STAR writes for +//! downstream use: the superTranscript and transcript sequences, the collapsed +//! junction table, and the condensed-to-full coordinate map. +//! +//! # D20: minus-strand exons +//! +//! STAR condenses the superTranscript sequence *before* it fills the +//! reverse-complement half of its genome buffer, about twenty-five lines later +//! in `Genome_genomeGenerate.cpp`. Every minus-strand exon therefore reads the +//! allocation's spacer bytes, and minus-strand superTranscripts come out as +//! uninitialised sequence. +//! +//! This does not reproduce that. Here the reverse-complement half is already +//! filled when condensing runs, so a minus-strand exon yields its actual +//! reverse complement. The divergence is deliberate: STAR's output on that path +//! is not a rule to follow, it is a read of uninitialised memory. +//! `minus_strand_supertranscript_is_reverse_complement_not_spacer` locks the +//! correct answer, derived by hand. + +use std::collections::HashMap; + +use crate::error::Error; +use crate::genome::Genome; +use crate::genome::fasta::Chromosome; +use crate::junction::gtf::GtfRecord; + +/// The condensed genome and everything derived from it. +pub struct SuperTranscriptome { + /// Condensed chromosomes `st0..`, base codes, ready for `Genome::from_chromosomes`. + pub chromosomes: Vec, + /// The annotation in condensed coordinates: `seqname` is the + /// superTranscript, positions are 1-based within it, strand is always `+` + /// because a superTranscript has no orientation left to speak of. + pub exons: Vec, + /// `superTranscriptSequences.fasta`. + pub supertranscript_fasta: Vec, + /// `transcriptSequences.fasta`. + pub transcript_fasta: Vec, + /// `superTranscriptSJcollapsed.tsv`. + pub sj_collapsed_tsv: Vec, + /// `fullGenome/conversionToFullGenome.tsv`. + pub conversion_tsv: Vec, +} + +/// One exon in global doubled-genome coordinates, tagged with its transcript. +#[derive(Clone, Copy)] +struct Exon { + transcript: usize, + start: u64, + end: u64, + /// Index of the GTF record this came from, so the remapped annotation can + /// keep its attributes — gene id, gene name, gene type — rather than + /// dropping everything the transcriptome tables need. + source: usize, +} + +/// Condense `genome` to the union of the exons in `records`. +/// +/// `transcript_tag` is `--sjdbGTFtagExonParentTranscript`. Records naming a +/// chromosome the genome does not have, or carrying no transcript tag, are +/// skipped, matching what the junction extractor does with them. +pub fn condense( + genome: &Genome, + records: &[GtfRecord], + transcript_tag: &str, + chr_bin_nbits: u32, +) -> Result { + let chr_index: HashMap<&str, usize> = genome + .chr_name + .iter() + .enumerate() + .map(|(i, n)| (n.as_str(), i)) + .collect(); + + // Transcripts in first-appearance order, so a rebuild of the same GTF + // produces the same superTranscript numbering. + let mut transcript_ids: Vec = Vec::new(); + let mut transcript_of: HashMap = HashMap::new(); + let mut transcript_strand: Vec = Vec::new(); + let mut exons: Vec = Vec::new(); + + for (src, rec) in records.iter().enumerate() { + let Some(&ci) = chr_index.get(rec.seqname.as_str()) else { + continue; + }; + let Some(id) = rec.attributes.get(transcript_tag) else { + continue; + }; + let t = *transcript_of.entry(id.clone()).or_insert_with(|| { + transcript_ids.push(id.clone()); + transcript_strand.push(rec.strand); + transcript_ids.len() - 1 + }); + // GTF is 1-based inclusive; the genome is 0-based. + exons.push(Exon { + transcript: t, + start: genome.chr_start[ci] + rec.start - 1, + end: genome.chr_start[ci] + rec.end - 1, + source: src, + }); + } + + if exons.is_empty() { + return Err(Error::Gtf( + "--genomeType SuperTranscriptome needs at least one exon on a known chromosome" + .to_string(), + )); + } + + // (1) Reflect minus-strand exons into the reverse-complement half. See D20 + // in the module docs for why this reads real sequence here and does not in + // STAR. + let n = genome.n_genome; + for e in &mut exons { + if transcript_strand[e.transcript] == '-' { + let (s, t) = (e.start, e.end); + e.start = 2 * n - 1 - t; + e.end = 2 * n - 1 - s; + } + } + + // (2) Sort by start, (3) merge overlapping or touching exons and rewrite + // every exon into condensed coordinates as we go. + exons.sort_by_key(|e| e.start); + let mut merged: Vec<[u64; 2]> = Vec::new(); + let mut gap = exons[0].start; + let mut curr = [exons[0].start, exons[0].end]; + exons[0].start = 0; + exons[0].end -= gap; + for e in exons.iter_mut().skip(1) { + if e.start <= curr[1] + 1 { + curr[1] = curr[1].max(e.end); + } else { + gap += e.start - curr[1] - 1; + merged.push(curr); + curr = [e.start, e.end]; + } + e.start -= gap; + e.end -= gap; + } + merged.push(curr); + + // The condensed sequence: the merged intervals' bases, back to back. + let mut concat: Vec = Vec::new(); + for m in &merged { + for j in m[0]..=m[1] { + concat.push(genome.get_base(j).unwrap_or(4)); + } + } + + // (4) Each transcript's span in condensed coordinates. + let n_transcripts = transcript_ids.len(); + let mut tr_span = vec![[u64::MAX, 0u64]; n_transcripts]; + for e in &exons { + tr_span[e.transcript][0] = tr_span[e.transcript][0].min(e.start); + tr_span[e.transcript][1] = tr_span[e.transcript][1].max(e.end); + } + + // (5) Group overlapping transcript spans into superTranscripts, aligned to + // merged-interval boundaries so a superTranscript never starts mid-interval. + let mut merged_super = vec![0u64; merged.len()]; + let mut spans = tr_span.clone(); + spans.sort_by_key(|s| s[0]); + let mut super_span: Vec<[u64; 2]> = Vec::new(); + let mut mi = 0usize; + let mut mi_len = 0u64; + let mut curr = spans[0]; + for s in &spans { + while mi_len < curr[1] && mi < merged.len() { + mi_len += merged[mi][1] - merged[mi][0] + 1; + merged_super[mi] = super_span.len() as u64; + mi += 1; + } + curr[1] = curr[1].max(mi_len.saturating_sub(1)); + if s[0] <= curr[1] { + curr[1] = curr[1].max(s[1]); + } else { + super_span.push(curr); + curr = *s; + } + } + super_span.push(curr); + // Intervals past the last transcript span still belong somewhere. + for m in merged_super.iter_mut().skip(mi) { + *m = super_span.len() as u64 - 1; + } + + // (6) The superTranscript sequences. + let super_seq: Vec> = super_span + .iter() + .map(|s| concat[s[0] as usize..=s[1] as usize].to_vec()) + .collect(); + + // (7) Which superTranscript each transcript landed in. + let mut tr_super = vec![0u64; n_transcripts]; + { + let mut ist = 0usize; + for e in &exons { + while ist + 1 < super_span.len() && e.start > super_span[ist][1] { + ist += 1; + } + tr_super[e.transcript] = ist as u64; + } + } + + // (8) Transcript sequences: exons in transcript order, concatenated. + exons.sort_by_key(|e| (e.transcript, e.start)); + let mut transcript_seq: Vec> = vec![Vec::new(); n_transcripts]; + for e in &exons { + transcript_seq[e.transcript].extend_from_slice(&concat[e.start as usize..=e.end as usize]); + } + + let mut transcript_fasta = Vec::new(); + for (i, seq) in transcript_seq.iter().enumerate() { + transcript_fasta.push(b'>'); + transcript_fasta.extend_from_slice(transcript_ids[i].as_bytes()); + transcript_fasta.push(b'\n'); + transcript_fasta.extend(seq.iter().map(|&c| code_to_char(c))); + transcript_fasta.push(b'\n'); + } + + let mut supertranscript_fasta = Vec::new(); + for (i, seq) in super_seq.iter().enumerate() { + supertranscript_fasta.extend_from_slice(format!(">st{i}\n").as_bytes()); + supertranscript_fasta.extend(seq.iter().map(|&c| code_to_char(c))); + supertranscript_fasta.push(b'\n'); + } + + // (9) Junctions, in superTranscript-relative coordinates. + let mut sj: Vec<(u64, u64, u64)> = Vec::new(); // (superTranscript, start, end) + for i in 1..exons.len() { + if exons[i].transcript == exons[i - 1].transcript && exons[i].start > exons[i - 1].end + 1 { + let st = tr_super[exons[i].transcript]; + let base = super_span[st as usize][0]; + sj.push((st, exons[i - 1].end - base, exons[i].start - base)); + } + } + let sj_collapsed_tsv = collapse_sj(&mut sj); + + // (10) The condensed chromosomes, and the annotation rewritten onto them. + let chromosomes: Vec = super_seq + .iter() + .enumerate() + .map(|(i, s)| Chromosome { + name: format!("st{i}"), + sequence: s.clone(), + }) + .collect(); + + exons.sort_by_key(|e| e.start); + let mut out_records: Vec = Vec::with_capacity(exons.len()); + { + let mut ist = 0usize; + for e in &exons { + while ist + 1 < super_span.len() && e.start > super_span[ist][1] { + ist += 1; + } + let base = super_span[ist][0]; + let source = &records[e.source]; + out_records.push(GtfRecord { + seqname: format!("st{ist}"), + feature: source.feature.clone(), + attributes: source.attributes.clone(), + start: e.start - base + 1, // back to 1-based, superTranscript-local + end: e.end - base + 1, + strand: '+', + }); + } + } + + // (11) conversionToFullGenome.tsv: header, then one line per merged block. + let chr_start = super::compute_chr_starts( + &chromosomes + .iter() + .map(|c| c.sequence.len() as u64) + .collect::>(), + chr_bin_nbits, + ); + let mut conversion_tsv = Vec::new(); + conversion_tsv.extend_from_slice(format!("{}\t{}\n", merged.len(), n).as_bytes()); + let mut cond = 0u64; + for (ib, b) in merged.iter().enumerate() { + let len = b[1] - b[0] + 1; + let st = merged_super[ib] as usize; + let start_in_super = chr_start[st] + cond - super_span[st][0]; + conversion_tsv.extend_from_slice(format!("{start_in_super}\t{len}\t{}\n", b[0]).as_bytes()); + cond += len; + } + + Ok(SuperTranscriptome { + chromosomes, + exons: out_records, + supertranscript_fasta, + transcript_fasta, + sj_collapsed_tsv, + conversion_tsv, + }) +} + +/// Genome code to FASTA letter. Codes above 4 cannot occur here: every base +/// comes from a merged interval inside the real genome. +fn code_to_char(code: u8) -> u8 { + match code { + 0 => b'A', + 1 => b'C', + 2 => b'G', + 3 => b'T', + _ => b'N', + } +} + +/// STAR's `SuperTranscriptome::sjCollapse`: sort by (superTranscript, start, +/// end), drop exact duplicates, emit one line each. +fn collapse_sj(sj: &mut [(u64, u64, u64)]) -> Vec { + sj.sort_unstable(); + let mut out = Vec::new(); + let mut last: Option<(u64, u64, u64)> = None; + for &j in sj.iter() { + if last != Some(j) { + out.extend_from_slice(format!("{}\t{}\t{}\n", j.0, j.1, j.2).as_bytes()); + last = Some(j); + } + } + out +} + +#[cfg(test)] +mod tests { + use super::*; + + fn genome_of(seq: &str) -> Genome { + let codes: Vec = seq + .bytes() + .map(|b| match b { + b'A' => 0, + b'C' => 1, + b'G' => 2, + b'T' => 3, + _ => 4, + }) + .collect(); + Genome::from_chromosomes( + &[Chromosome { + name: "chr1".to_string(), + sequence: codes, + }], + 18, + None, + ) + .unwrap() + } + + fn exon(start: u64, end: u64, strand: char, transcript: &str) -> GtfRecord { + let mut attributes = HashMap::new(); + attributes.insert("transcript_id".to_string(), transcript.to_string()); + GtfRecord { + seqname: "chr1".to_string(), + feature: "exon".to_string(), + start, + end, + strand, + attributes, + } + } + + fn fasta_text(bytes: &[u8]) -> String { + String::from_utf8(bytes.to_vec()).unwrap() + } + + /// Two exons with an intron between them collapse to one superTranscript + /// holding only exonic sequence, and the intron is gone rather than spliced. + #[test] + fn exons_are_concatenated_and_the_intron_disappears() { + // 1234567890123456789012345678901234567890 + let genome = genome_of("AAAACCCCGGGGTTTTACGTACGTAAAACCCCGGGGTTTT"); + // Exons 1-8 and 25-32 (1-based), one transcript. + let records = vec![exon(1, 8, '+', "t1"), exon(25, 32, '+', "t1")]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + + assert_eq!(st.chromosomes.len(), 1); + assert_eq!( + fasta_text(&st.supertranscript_fasta), + ">st0\nAAAACCCCAAAACCCC\n" + ); + assert_eq!(fasta_text(&st.transcript_fasta), ">t1\nAAAACCCCAAAACCCC\n"); + // No junction: with nothing else annotated between them, the two + // exons end up contiguous in the condensed genome, so there is no gap + // left for a read to cross. + assert_eq!(fasta_text(&st.sj_collapsed_tsv), ""); + } + + /// A junction survives condensing only when another transcript's exon sits + /// between the two, keeping them apart in the condensed genome. + #[test] + fn a_junction_is_recorded_when_another_exon_separates_the_two() { + let genome = genome_of("AAAACCCCGGGGTTTTACGTACGTAAAACCCCGGGGTTTT"); + let records = vec![ + exon(1, 8, '+', "t1"), // t1 exon 1 + exon(13, 20, '+', "t2"), // t2, between them + exon(25, 32, '+', "t1"), // t1 exon 2 + ]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + // Condensed: t1[0..7], t2[8..15], t1[16..23]. t1 jumps 7 -> 16. + assert_eq!(fasta_text(&st.sj_collapsed_tsv), "0\t7\t16\n"); + } + + /// The condensed annotation addresses the superTranscript, one-based, so + /// the ordinary GTF consumers need no special case. + #[test] + fn the_annotation_comes_back_in_condensed_coordinates() { + let genome = genome_of("AAAACCCCGGGGTTTTACGTACGTAAAACCCCGGGGTTTT"); + let records = vec![exon(1, 8, '+', "t1"), exon(25, 32, '+', "t1")]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + + assert_eq!(st.exons.len(), 2); + assert_eq!(st.exons[0].seqname, "st0"); + assert_eq!((st.exons[0].start, st.exons[0].end), (1, 8)); + assert_eq!((st.exons[1].start, st.exons[1].end), (9, 16)); + assert!(st.exons.iter().all(|e| e.strand == '+')); + } + + /// Overlapping exons from different transcripts are merged once, not + /// duplicated, which is the whole point of condensing. + #[test] + fn overlapping_exons_are_merged_once() { + let genome = genome_of("AAAACCCCGGGGTTTTACGTACGTAAAACCCCGGGGTTTT"); + let records = vec![exon(1, 12, '+', "t1"), exon(5, 16, '+', "t2")]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + assert_eq!( + fasta_text(&st.supertranscript_fasta), + ">st0\nAAAACCCCGGGGTTTT\n", + "the union of the two exons, each base once" + ); + } + + /// D20. STAR reads its unfilled reverse strand here and emits spacer bytes; + /// this emits the reverse complement, derived by hand below. + #[test] + fn minus_strand_supertranscript_is_reverse_complement_not_spacer() { + let seq = "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"; + let genome = genome_of(seq); + // One minus-strand exon at 1-based 11..20 — forward offsets 10..=19. + let records = vec![exon(11, 20, '-', "tM")]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + + let complement = |b: u8| match b { + b'A' => b'T', + b'C' => b'G', + b'G' => b'C', + b'T' => b'A', + x => x, + }; + let expected: String = seq.as_bytes()[10..20] + .iter() + .rev() + .map(|&b| complement(b) as char) + .collect(); + + assert_eq!( + fasta_text(&st.supertranscript_fasta), + format!(">st0\n{expected}\n"), + "a minus-strand exon must yield real sequence, not the spacer STAR reads" + ); + assert!( + !st.supertranscript_fasta.contains(&0x00), + "no uninitialised bytes may reach the output" + ); + } + + /// Two transcripts that share no sequence become two superTranscripts, so + /// the aligner cannot stitch across a boundary that does not exist. + #[test] + fn disjoint_transcripts_become_separate_supertranscripts() { + let genome = genome_of("AAAACCCCGGGGTTTTACGTACGTAAAACCCCGGGGTTTT"); + let records = vec![exon(1, 8, '+', "t1"), exon(33, 40, '+', "t2")]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + assert_eq!(st.chromosomes.len(), 2); + assert_eq!(st.chromosomes[0].name, "st0"); + assert_eq!(st.chromosomes[1].name, "st1"); + } + + /// The conversion map is what makes condensed coordinates translatable + /// back, so its blocks must cover every merged interval. + #[test] + fn the_conversion_map_has_one_block_per_merged_interval() { + let genome = genome_of("AAAACCCCGGGGTTTTACGTACGTAAAACCCCGGGGTTTT"); + let records = vec![exon(1, 8, '+', "t1"), exon(25, 32, '+', "t1")]; + let st = condense(&genome, &records, "transcript_id", 18).unwrap(); + let text = fasta_text(&st.conversion_tsv); + let mut lines = text.lines(); + assert_eq!(lines.next().unwrap().split('\t').next().unwrap(), "2"); + let blocks: Vec<&str> = lines.collect(); + assert_eq!(blocks.len(), 2); + // condensed start, length, full-genome start + assert_eq!(blocks[0], "0\t8\t0"); + assert_eq!(blocks[1], "8\t8\t24"); + } + + #[test] + fn a_gtf_with_no_usable_exon_is_an_error() { + let genome = genome_of("AAAACCCC"); + let mut rec = exon(1, 4, '+', "t1"); + rec.seqname = "chrUnknown".to_string(); + assert!(condense(&genome, &[rec], "transcript_id", 18).is_err()); + } +} diff --git a/src/index/mod.rs b/src/index/mod.rs index 88ee62d0..81a1c639 100644 --- a/src/index/mod.rs +++ b/src/index/mod.rs @@ -53,6 +53,8 @@ struct BuildPrep { junction_db: SpliceJunctionDb, transcriptome: Option, prepared_junctions: Vec, + /// The condensed-genome side files, under `--genomeType SuperTranscriptome`. + super_transcriptome: Option, } impl GenomeIndex { @@ -63,6 +65,7 @@ impl GenomeIndex { junction_db, transcriptome, prepared_junctions, + super_transcriptome: _, // side files are written by the streaming path } = Self::build_prep(params)?; log::info!("Building suffix array..."); @@ -131,6 +134,7 @@ impl GenomeIndex { junction_db: _, transcriptome, prepared_junctions, + super_transcriptome, } = Self::build_prep(params)?; let dir = ¶ms.genome_dir; @@ -141,6 +145,23 @@ impl GenomeIndex { log::info!("Writing genome files to {}...", dir.display()); genome.write_index_files(dir, params)?; + // The four condensed-genome files STAR writes alongside the index. + // `conversionToFullGenome.tsv` goes under `fullGenome/`, where STAR + // puts it, since it describes the genome this one was condensed from. + if let Some(ref st) = super_transcriptome { + let write = |name: &str, bytes: &[u8]| -> Result<(), Error> { + let path = dir.join(name); + fs::write(&path, bytes).map_err(|e| Error::io(e, &path)) + }; + write("superTranscriptSequences.fasta", &st.supertranscript_fasta)?; + write("transcriptSequences.fasta", &st.transcript_fasta)?; + write("superTranscriptSJcollapsed.tsv", &st.sj_collapsed_tsv)?; + let full = dir.join("fullGenome"); + fs::create_dir_all(&full).map_err(|e| Error::io(e, &full))?; + let path = full.join("conversionToFullGenome.tsv"); + fs::write(&path, &st.conversion_tsv).map_err(|e| Error::io(e, &path))?; + } + let gstrand_bit = SuffixArray::calculate_gstrand_bit(genome.n_genome); let gstrand_mask = (1u64 << gstrand_bit) - 1; let word_length = gstrand_bit + 1; @@ -272,6 +293,46 @@ impl GenomeIndex { genome.n_genome ); + // `--genomeType SuperTranscriptome`: replace the genome with the union + // of its annotated exons before anything else looks at it. Everything + // downstream — transcriptome tables, junctions, suffix array — then + // works on the condensed genome without knowing it is condensed, + // because the annotation comes back addressed to it. + let super_transcriptome = if params.genome_type == "SuperTranscriptome" { + let gtf_path = params.sjdb_gtf_file.as_ref().ok_or_else(|| { + Error::Index( + "--genomeType SuperTranscriptome requires --sjdbGTFfile: there is nothing \ + to condense without an annotation" + .to_string(), + ) + })?; + let records = crate::junction::gtf::parse_gtf_configured( + gtf_path, + ¶ms.sjdb_gtf_feature_exon, + ¶ms.sjdb_gtf_chr_prefix, + )?; + let st = crate::genome::supertranscript::condense( + &genome, + &records, + ¶ms.sjdb_gtf_tag_exon_parent_transcript, + params.genome_chr_bin_nbits, + )?; + log::info!( + "SuperTranscriptome: {} chromosomes condensed to {} superTranscripts", + genome.n_chr_real, + st.chromosomes.len() + ); + let full_size = genome.n_genome; + genome = Genome::from_chromosomes(&st.chromosomes, params.genome_chr_bin_nbits, None)?; + log::info!( + "Condensed genome: {} bytes, down from {full_size}", + genome.n_genome + ); + Some(st) + } else { + None + }; + // Parse GTF once and share the result between the junction database, // the transcriptome index, and the sjdb insertion pipeline. Junction // preparation + Gsj append must happen BEFORE the suffix array is @@ -283,11 +344,17 @@ impl GenomeIndex { let mut transcriptome = None; if let Some(ref gtf_path) = params.sjdb_gtf_file { - let exons = crate::junction::gtf::parse_gtf_configured( - gtf_path, - ¶ms.sjdb_gtf_feature_exon, - ¶ms.sjdb_gtf_chr_prefix, - )?; + // Under SuperTranscriptome the annotation was already rewritten + // into condensed coordinates; re-parsing the GTF here would + // address chromosomes the genome no longer has. + let exons = match &super_transcriptome { + Some(st) => st.exons.clone(), + None => crate::junction::gtf::parse_gtf_configured( + gtf_path, + ¶ms.sjdb_gtf_feature_exon, + ¶ms.sjdb_gtf_chr_prefix, + )?, + }; log::debug!("Parsed {} exon features from GTF", exons.len()); let tr = TranscriptomeIndex::from_gtf_exons_configured( @@ -375,6 +442,7 @@ impl GenomeIndex { junction_db, transcriptome, prepared_junctions, + super_transcriptome, }) } diff --git a/src/params/mod.rs b/src/params/mod.rs index 3b507310..f245cb72 100644 --- a/src/params/mod.rs +++ b/src/params/mod.rs @@ -514,6 +514,11 @@ pub struct Parameters { #[arg(long = "genomeSAsparseD", default_value_t = 1)] pub genome_sa_sparse_d: u32, + /// Genome representation to build. `Full` (the default) is an ordinary + /// genome; `Transcriptome` and `SuperTranscriptome` are not built here. + #[arg(long = "genomeType", default_value = "Full")] + pub genome_type: String, + /// Substitute VCF alleles into the genome at genomeGenerate (`None`, /// `Haploid`, or `Diploid`). Requires `--genomeTransformVCF`; incompatible /// with `--sjdbGTFfile`. `Diploid` is genotype-aware and duplicates the @@ -1802,6 +1807,30 @@ impl Parameters { )); } } + // --genomeType: `Transcriptome` needs a different index layout + // entirely, so it is refused rather than built as something that + // silently is not what was asked for. `SuperTranscriptome` condenses + // the genome to its annotated exons and therefore needs an annotation. + match params.genome_type.as_str() { + "Full" => {} + "SuperTranscriptome" => { + if params.sjdb_gtf_file.is_none() { + return Err(command.error( + ErrorKind::MissingRequiredArgument, + "--genomeType SuperTranscriptome requires --sjdbGTFfile: there is \ + nothing to condense without an annotation", + )); + } + } + other => { + return Err(command.error( + ErrorKind::InvalidValue, + format!( + "--genomeType {other} is not supported; expected Full or SuperTranscriptome" + ), + )); + } + } // --readFilesType: only Fastx is supported. Reading pre-aligned SAM // input is separate work; refuse rather than silently treating a SAM // file as FASTQ. @@ -2998,4 +3027,23 @@ mod tests { assert_eq!(p.out_sam_strand_field, "None"); assert!(!p.out_sam_attributes.contains(SamAttributes::XS)); } + + #[test] + fn genome_flags_accept_their_defaults_and_refuse_the_rest() { + let gg = |extra: &[&str]| { + let mut a = vec!["--runMode", "genomeGenerate", "--genomeFastaFiles", "g.fa"]; + a.extend_from_slice(extra); + try_parse(&a) + }; + + // Defaults parse, and are the STAR ones. + let p = gg(&[]).unwrap(); + assert_eq!(p.genome_type, "Full"); + + // The unimplemented genome layouts are refused rather than silently + // building an ordinary genome under another name. + // SuperTranscriptome is built, but only with an annotation to condense. + assert!(gg(&["--genomeType", "SuperTranscriptome"]).is_err()); + assert!(gg(&["--genomeType", "Transcriptome"]).is_err()); + } } diff --git a/tests/alignment_features.rs b/tests/alignment_features.rs index 86691d31..3b2552e6 100644 --- a/tests/alignment_features.rs +++ b/tests/alignment_features.rs @@ -2204,3 +2204,111 @@ fn test_read_name_separator_cuts_the_qname_and_is_configurable() { ); } } + +// --------------------------------------------------------------------------- +// --genomeType SuperTranscriptome +// --------------------------------------------------------------------------- + +/// The condensed index holds only exonic sequence, so a read spanning the +/// planted intron aligns without an `N` operation: in the condensed genome the +/// two exons are contiguous. +#[test] +fn test_genome_type_supertranscriptome_condenses_to_exons() { + let tmpdir = TempDir::new().unwrap(); + let genome = build_genome(); + let fasta = write_fasta(&tmpdir, &genome); + let gtf = write_gtf(&tmpdir); + + let genome_dir = tmpdir.path().join("genome_st"); + fs::create_dir_all(&genome_dir).unwrap(); + cargo_bin_cmd!("rustar-aligner") + .args([ + "--runMode", + "genomeGenerate", + "--genomeDir", + genome_dir.to_str().unwrap(), + "--genomeFastaFiles", + fasta.to_str().unwrap(), + "--genomeSAindexNbases", + "5", + "--genomeType", + "SuperTranscriptome", + "--sjdbGTFfile", + gtf.to_str().unwrap(), + "--sjdbOverhang", + "24", + ]) + .assert() + .success(); + + // The two annotated exons are the whole reference now. + let chr_names = fs::read_to_string(genome_dir.join("chrName.txt")).unwrap(); + assert_eq!(chr_names.trim(), "st0"); + let chr_lengths = fs::read_to_string(genome_dir.join("chrLength.txt")).unwrap(); + assert_eq!( + chr_lengths.trim(), + "100", + "50 bp of exon 1 plus 50 bp of exon 2, and none of the 200 bp intron" + ); + + // The side files STAR writes alongside the condensed index. + let super_fasta = + fs::read_to_string(genome_dir.join("superTranscriptSequences.fasta")).unwrap(); + assert!(super_fasta.starts_with(">st0\n")); + let expected: String = genome[10000..10050] + .iter() + .chain(genome[10250..10300].iter()) + .map(|&b| b as char) + .collect(); + assert_eq!(super_fasta.trim_end(), format!(">st0\n{expected}")); + + let conversion = + fs::read_to_string(genome_dir.join("fullGenome/conversionToFullGenome.tsv")).unwrap(); + let mut lines = conversion.lines(); + assert_eq!(lines.next().unwrap().split('\t').next().unwrap(), "2"); + assert_eq!(lines.next().unwrap(), "0\t50\t10000"); + assert_eq!(lines.next().unwrap(), "50\t50\t10250"); + + assert!(genome_dir.join("transcriptSequences.fasta").exists()); + assert!(genome_dir.join("superTranscriptSJcollapsed.tsv").exists()); + + // A read straddling the junction aligns end to end, no intron to cross. + let mut read = genome[10025..10050].to_vec(); + read.extend_from_slice(&genome[10250..10275]); + let fastq_path = tmpdir.path().join("reads.fq"); + { + let mut f = fs::File::create(&fastq_path).unwrap(); + writeln!(f, "@spanning").unwrap(); + f.write_all(&read).unwrap(); + writeln!(f).unwrap(); + writeln!(f, "+").unwrap(); + writeln!(f, "{}", "I".repeat(read.len())).unwrap(); + } + + let output_dir = tmpdir.path().join("out_st"); + fs::create_dir_all(&output_dir).unwrap(); + let prefix = format!("{}/", output_dir.display()); + cargo_bin_cmd!("rustar-aligner") + .args([ + "--runMode", + "alignReads", + "--genomeDir", + genome_dir.to_str().unwrap(), + "--readFilesIn", + fastq_path.to_str().unwrap(), + "--outFileNamePrefix", + &prefix, + ]) + .assert() + .success(); + + let sam = fs::read_to_string(output_dir.join("Aligned.out.sam")).unwrap(); + let record = sam + .lines() + .find(|l| !l.starts_with('@')) + .expect("the spanning read should align"); + let fields: Vec<&str> = record.split('\t').collect(); + assert_eq!(fields[2], "st0"); + assert_eq!(fields[3], "26", "25 bases into exon 1, 1-based"); + assert_eq!(fields[5], "50M", "contiguous in the condensed genome"); +} diff --git a/tests/parameter_surface.rs b/tests/parameter_surface.rs index df3dd940..4ae97c0e 100644 --- a/tests/parameter_surface.rs +++ b/tests/parameter_surface.rs @@ -113,7 +113,6 @@ const NOT_YET_ACCEPTED: &[&str] = &[ // Genome index types and transforms. "genomeSuffixLengthMax", "genomeTransformOutput", - "genomeType", "sjdbInsertSave", // STARsolo barcode chemistry. "soloAdapterMismatchesNmax",