diff --git a/.github/workflows/ci.yaml b/.github/workflows/ci.yaml index b1f5bca..12ce718 100644 --- a/.github/workflows/ci.yaml +++ b/.github/workflows/ci.yaml @@ -5,5 +5,24 @@ on: - pull_request jobs: - ci: - uses: nextstrain/.github/.github/workflows/pathogen-repo-ci.yaml@master + pathogen-ci: + strategy: + matrix: + runtime: [docker, conda] + permissions: + id-token: write + uses: nextstrain/.github/.github/workflows/pathogen-repo-build.yaml@master + secrets: inherit + with: + runtime: ${{ matrix.runtime }} + run: | + nextstrain build \ + phylogenetic \ + --configfile profiles/ci/profiles_config.yaml + artifact-name: output-${{ matrix.runtime }} + artifact-paths: | + phylogenetic/auspice/ + phylogenetic/results/ + phylogenetic/benchmarks/ + phylogenetic/logs/ + phylogenetic/.snakemake/log/ \ No newline at end of file diff --git a/.gitignore b/.gitignore index b653f7d..1793bfc 100644 --- a/.gitignore +++ b/.gitignore @@ -9,7 +9,9 @@ build/ environment* # Snakemake state dir -/.snakemake +.snakemake/ +benchmarks/ +logs/ # Local config overrides /config_local.yaml diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md new file mode 100644 index 0000000..2ff4409 --- /dev/null +++ b/CONTRIBUTING.md @@ -0,0 +1,7 @@ +# Developer guide + +## CI + +Tests are run through GitHub Actions when triggered by events as defined by [.github/workflows/ci.yaml][] + +[.github/workflows/ci.yaml]: ./.github/workflows/ci.yaml diff --git a/README.md b/README.md index 568bb03..ee1a6e6 100644 --- a/README.md +++ b/README.md @@ -1,88 +1,12 @@ -# nextstrain.org/zika +# Nextstrain repository for Zika virus -This is the [Nextstrain](https://nextstrain.org) build for Zika, visible at -[nextstrain.org/zika](https://nextstrain.org/zika). +This repository contains two workflows for the analysis of Zika virus data: -The build encompasses fetching data, preparing it for analysis, doing quality -control, performing analyses, and saving the results in a format suitable for -visualization (with [auspice][]). This involves running components of -Nextstrain such as [fauna][] and [augur][]. +- [`ingest/`](./ingest) - Download data from GenBank, clean and curate it and upload it to S3 +- [`phylogenetic/`](./phylogenetic) - Make phylogenetic trees for nextstrain.org -All Zika-specific steps and functionality for the Nextstrain pipeline should be -housed in this repository. +Each folder contains a README.md with more information. -_This build requires Augur v6._ +## Documentation -[![Build Status](https://github.com/nextstrain/zika/actions/workflows/ci.yaml/badge.svg?branch=main)](https://github.com/nextstrain/zika/actions/workflows/ci.yaml) - -## Usage - -If you're unfamiliar with Nextstrain builds, you may want to follow our -[quickstart guide][] first and then come back here. - -There are two main ways to run & visualise the output from this build: - -The first, and easiest, way to run this pathogen build is using the [Nextstrain -command-line tool][nextstrain-cli]: -``` -nextstrain build . -nextstrain view auspice/ -``` - -See the [nextstrain-cli README][] for how to install the `nextstrain` command. - -The second is to install augur & auspice using conda, following [these instructions](https://nextstrain.org/docs/getting-started/local-installation#install-augur--auspice-with-conda-recommended). -The build may then be run via: -``` -snakemake -auspice --datasetDir auspice/ -``` - -Build output goes into the directories `data/`, `results/` and `auspice/`. - -## Configuration - -Configuration takes place entirely with the `Snakefile`. This can be read top-to-bottom, each rule -specifies its file inputs and output and also its parameters. There is little redirection and each -rule should be able to be reasoned with on its own. - - -## Input data - -This build starts by downloading sequences from -https://data.nextstrain.org/files/zika/sequences.fasta.xz -and metadata from -https://data.nextstrain.org/files/zika/metadata.tsv.gz. -These are publicly provisioned data by the Nextstrain team by pulling sequences -from NCBI GenBank via ViPR and performing -[additional bespoke curation](https://github.com/nextstrain/fauna/blob/master/builds/ZIKA.md). - -Data from GenBank follows Open Data principles, such that we can make input data -and intermediate files available for further analysis. Open Data is data that -can be freely used, re-used and redistributed by anyone - subject only, at most, -to the requirement to attribute and sharealike. - -We gratefully acknowledge the authors, originating and submitting laboratories -of the genetic sequences and metadata for sharing their work in open databases. -Please note that although data generators have generously shared data in an open -fashion, that does not mean there should be free license to publish on this -data. Data generators should be cited where possible and collaborations should -be sought in some circumstances. Please try to avoid scooping someone else's -work. Reach out if uncertain. Authors, paper references (where available) and -links to GenBank entries are provided in the metadata file. - -A faster build process can be run working from example data by copying over -sequences and metadata from `example_data/` to `data/` via: -``` -mkdir -p data/ -cp -v example_data/* data/ -``` - -[Nextstrain]: https://nextstrain.org -[fauna]: https://github.com/nextstrain/fauna -[augur]: https://github.com/nextstrain/augur -[auspice]: https://github.com/nextstrain/auspice -[snakemake cli]: https://snakemake.readthedocs.io/en/stable/executable.html#all-options -[nextstrain-cli]: https://github.com/nextstrain/cli -[nextstrain-cli README]: https://github.com/nextstrain/cli/blob/master/README.md -[quickstart guide]: https://nextstrain.org/docs/getting-started/quickstart +- [Contributor documentation](./CONTRIBUTING.md) diff --git a/Snakefile b/Snakefile deleted file mode 100644 index 3562078..0000000 --- a/Snakefile +++ /dev/null @@ -1,236 +0,0 @@ -rule all: - input: - auspice_json = "auspice/zika.json", - -rule files: - params: - input_fasta = "data/zika.fasta", - dropped_strains = "config/dropped_strains.txt", - reference = "config/zika_reference.gb", - colors = "config/colors.tsv", - auspice_config = "config/auspice_config.json", - description = "config/description.md" - -files = rules.files.params - -rule download: - """Downloading sequences and metadata from data.nextstrain.org""" - output: - sequences = "data/sequences.fasta.zst", - metadata = "data/metadata.tsv.zst" - params: - sequences_url = "https://data.nextstrain.org/files/zika/sequences.fasta.zst", - metadata_url = "https://data.nextstrain.org/files/zika/metadata.tsv.zst" - shell: - """ - curl -fsSL --compressed {params.sequences_url:q} --output {output.sequences} - curl -fsSL --compressed {params.metadata_url:q} --output {output.metadata} - """ - -rule decompress: - """Decompressing sequences and metadata""" - input: - sequences = "data/sequences.fasta.zst", - metadata = "data/metadata.tsv.zst" - output: - sequences = "data/sequences.fasta", - metadata = "data/metadata.tsv" - shell: - """ - zstd -d -c {input.sequences} > {output.sequences} - zstd -d -c {input.metadata} > {output.metadata} - """ - -rule filter: - """ - Filtering to - - {params.sequences_per_group} sequence(s) per {params.group_by!s} - - from {params.min_date} onwards - - excluding strains in {input.exclude} - - minimum genome length of {params.min_length} (50% of Zika virus genome) - """ - input: - sequences = "data/sequences.fasta", - metadata = "data/metadata.tsv", - exclude = files.dropped_strains - output: - sequences = "results/filtered.fasta" - params: - group_by = "country year month", - sequences_per_group = 40, - min_date = 2012, - min_length = 5385 - shell: - """ - augur filter \ - --sequences {input.sequences} \ - --metadata {input.metadata} \ - --exclude {input.exclude} \ - --output {output.sequences} \ - --group-by {params.group_by} \ - --sequences-per-group {params.sequences_per_group} \ - --min-date {params.min_date} \ - --min-length {params.min_length} - """ - -rule align: - """ - Aligning sequences to {input.reference} - - filling gaps with N - """ - input: - sequences = "results/filtered.fasta", - reference = files.reference - output: - alignment = "results/aligned.fasta" - shell: - """ - augur align \ - --sequences {input.sequences} \ - --reference-sequence {input.reference} \ - --output {output.alignment} \ - --fill-gaps \ - --remove-reference - """ - -rule tree: - """Building tree""" - input: - alignment = "results/aligned.fasta" - output: - tree = "results/tree_raw.nwk" - shell: - """ - augur tree \ - --alignment {input.alignment} \ - --output {output.tree} - """ - -rule refine: - """ - Refining tree - - estimate timetree - - use {params.coalescent} coalescent timescale - - estimate {params.date_inference} node dates - - filter tips more than {params.clock_filter_iqd} IQDs from clock expectation - """ - input: - tree = "results/tree_raw.nwk", - alignment = "results/aligned.fasta", - metadata = "data/metadata.tsv" - output: - tree = "results/tree.nwk", - node_data = "results/branch_lengths.json" - params: - coalescent = "opt", - date_inference = "marginal", - clock_filter_iqd = 4 - shell: - """ - augur refine \ - --tree {input.tree} \ - --alignment {input.alignment} \ - --metadata {input.metadata} \ - --output-tree {output.tree} \ - --output-node-data {output.node_data} \ - --timetree \ - --coalescent {params.coalescent} \ - --date-confidence \ - --date-inference {params.date_inference} \ - --clock-filter-iqd {params.clock_filter_iqd} - """ - -rule ancestral: - """Reconstructing ancestral sequences and mutations""" - input: - tree = "results/tree.nwk", - alignment = "results/aligned.fasta" - output: - node_data = "results/nt_muts.json" - params: - inference = "joint" - shell: - """ - augur ancestral \ - --tree {input.tree} \ - --alignment {input.alignment} \ - --output-node-data {output.node_data} \ - --inference {params.inference} - """ - -rule translate: - """Translating amino acid sequences""" - input: - tree = "results/tree.nwk", - node_data = "results/nt_muts.json", - reference = files.reference - output: - node_data = "results/aa_muts.json" - shell: - """ - augur translate \ - --tree {input.tree} \ - --ancestral-sequences {input.node_data} \ - --reference-sequence {input.reference} \ - --output {output.node_data} \ - """ - -rule traits: - """ - Inferring ancestral traits for {params.columns!s} - - increase uncertainty of reconstruction by {params.sampling_bias_correction} to partially account for sampling bias - """ - input: - tree = "results/tree.nwk", - metadata = "data/metadata.tsv" - output: - node_data = "results/traits.json", - params: - columns = "region country", - sampling_bias_correction = 3 - shell: - """ - augur traits \ - --tree {input.tree} \ - --metadata {input.metadata} \ - --output {output.node_data} \ - --columns {params.columns} \ - --confidence \ - --sampling-bias-correction {params.sampling_bias_correction} - """ - -rule export: - """Exporting data files for for auspice""" - input: - tree = "results/tree.nwk", - metadata = "data/metadata.tsv", - branch_lengths = "results/branch_lengths.json", - traits = "results/traits.json", - nt_muts = "results/nt_muts.json", - aa_muts = "results/aa_muts.json", - colors = files.colors, - auspice_config = files.auspice_config, - description = files.description - output: - auspice_json = rules.all.input.auspice_json - shell: - """ - augur export v2 \ - --tree {input.tree} \ - --metadata {input.metadata} \ - --node-data {input.branch_lengths} {input.traits} {input.nt_muts} {input.aa_muts} \ - --colors {input.colors} \ - --auspice-config {input.auspice_config} \ - --description {input.description} \ - --include-root-sequence \ - --output {output.auspice_json} - """ - -rule clean: - """Removing directories: {params}""" - params: - "data ", - "results ", - "auspice" - shell: - "rm -rfv {params}" diff --git a/config/dropped_strains.txt b/config/dropped_strains.txt deleted file mode 100644 index 22b5878..0000000 --- a/config/dropped_strains.txt +++ /dev/null @@ -1,86 +0,0 @@ -PF13/251013_18 # reference included in config/zika_reference.gb -AFMC_U # too basal -AFMC_S # too basal -Boracay/16423 # too basal -JMB_185 # too basal -PHL/2012/CPC_0740 # too basal -VIE/Bra/2016 # too basal -Dominican_Republic/2016/PD2 # duplicate of other strain in dataset -GD01 # duplicate of other strain in dataset -GDZ16001 # duplicate of other strain in dataset -VEN/UF_2/2016 # duplicate of other strain in dataset -ZZ_1 # duplicate of other strain in dataset -VR10599/Pavia/2016 # export with unknown origin -34997/Pavia/2016 # export with unknown origin -COL/FLR_00001/2015 # duplicate of COL/FLR/2015 -COL/FLR_00002/2015 # duplicate of COL/FLR/2015 -COL/FLR_00003/2015 # duplicate of COL/FLR/2015 -COL/FLR_00004/2015 # duplicate of COL/FLR/2015 -COL/FLR_00005/2015 # duplicate of COL/FLR/2015 -COL/FLR_00006/2015 # duplicate of COL/FLR/2015 -COL/FLR_00007/2015 # duplicate of COL/FLR/2015 -COL/FLR_00008/2015 # duplicate of COL/FLR/2015 -COL/FLR_00009/2015 # duplicate of COL/FLR/2015 -COL/FLR_00010/2015 # duplicate of COL/FLR/2015 -COL/FLR_00011/2015 # duplicate of COL/FLR/2015 -COL/FLR_00012/2015 # duplicate of COL/FLR/2015 -COL/FLR_00013/2015 # duplicate of COL/FLR/2015 -COL/FLR_00014/2015 # duplicate of COL/FLR/2015 -COL/FLR_00015/2015 # duplicate of COL/FLR/2015 -COL/FLR_00016/2015 # duplicate of COL/FLR/2015 -COL/FLR_00017/2015 # duplicate of COL/FLR/2015 -COL/FLR_00018/2015 # duplicate of COL/FLR/2015 -COL/FLR_00019/2015 # duplicate of COL/FLR/2015 -COL/FLR_00020/2015 # duplicate of COL/FLR/2015 -COL/FLR_00021/2015 # duplicate of COL/FLR/2015 -COL/FLR_00022/2015 # duplicate of COL/FLR/2015 -COL/FLR_00023/2015 # duplicate of COL/FLR/2015 -COL/FLR_00024/2015 # duplicate of COL/FLR/2015 -COL/FLR_00025/2015 # duplicate of COL/FLR/2015 -COL/FLR_00026/2015 # duplicate of COL/FLR/2015 -COL/FLR_00034/2015 # duplicate of COL/FLR/2015 -COL/FLR_00035/2015 # duplicate of COL/FLR/2015 -COL/FLR_00036/2015 # duplicate of COL/FLR/2015 -COL/FLR_00038/2015 # duplicate of COL/FLR/2015 -COL/FLR_00040/2015 # duplicate of COL/FLR/2015 -COL/FLR_00041/2015 # duplicate of COL/FLR/2015 -COL/FLR_00042/2015 # duplicate of COL/FLR/2015 -COL/PRV_00027/2015 # misdated -COL/PRV_00028/2015 # misdated -COL/PAN_00029/2015 # misdated -COL/PAN_00030/2015 # misdated -BRA/2016/FC_DQ12D1 # large indel -Brazil/2016/ZBRX8 # large indel -Brazil/2016/ZBRX11 # large indel -CX17 # large indel -MEX/2016/mex27 # large indel -MEX/2016/mex50 # large indel -SLV/2016/ElSalvador_1055 # large indel -USVI/20/2016 # large indel -USVI/21/2016 # large indel -USVI/23/2016 # large indel -USVI/27/2016 # large indel -USVI/30/2016 # large indel -USVI/32/2016 # large indel -Thailand/1605aTw # excess divergence -VE_Ganxian # excess divergence -ZK_YN001 # excess divergence -Haiti/0029/2014 # contamination present -Haiti/0033/2014 # contamination present -Haiti/0036/2014 # contamination present -Haiti/0054/2014 # contamination present -Haiti/0074/2014 # contamination present -Haiti/0097/2014 # contamination present -mosquito/Haiti/1682/2016 # contamination present -ZF36_36S # contamination present -MR766 # lab strain -Aedes_sp/MEX_I_44/2016 # duplicate of Aedes_aegypti/MEX/MEX_I_44/2016 -Puerto_Rico/2015/PRVABC59 # duplicate of PRVABC59 -V15555 # highly diverged -DK # lab strain -DK23 # lab strain -rGZ02a/2018 # highly diverged -rGZ02p/2018 # highly diverged -V211784 # highly diverged -LMM/AG5643 -Faranah/18 diff --git a/example_data/metadata.tsv b/example_data/metadata.tsv deleted file mode 100644 index 9c30f2e..0000000 --- a/example_data/metadata.tsv +++ /dev/null @@ -1,35 +0,0 @@ -strain virus accession date region country division city db segment authors url title journal paper_url -PAN/CDC_259359_V1_V3/2015 zika KX156774 2015-12-18 North America Panama Panama Panama genbank genome Shabman et al https://www.ncbi.nlm.nih.gov/nuccore/KX156774 Direct Submission Submitted (29-APR-2016) J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA https://www.ncbi.nlm.nih.gov/pubmed/ -COL/FLR_00024/2015 zika MF574569 2015-12-XX South America Colombia Colombia Colombia genbank genome Pickett et al https://www.ncbi.nlm.nih.gov/nuccore/MF574569 Direct Submission Submitted (28-JUL-2017) J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA https://www.ncbi.nlm.nih.gov/pubmed/ -PRVABC59 zika KU501215 2015-12-XX North America Puerto Rico Puerto Rico Puerto Rico genbank genome Lanciotti et al https://www.ncbi.nlm.nih.gov/nuccore/KU501215 Phylogeny of Zika Virus in Western Hemisphere, 2015 Emerging Infect. Dis. 22 (5), 933-935 (2016) https://www.ncbi.nlm.nih.gov/pubmed/27088323 -COL/FLR_00008/2015 zika MF574562 2015-12-XX South America Colombia Colombia Colombia genbank genome Pickett et al https://www.ncbi.nlm.nih.gov/nuccore/MF574562 Direct Submission Submitted (28-JUL-2017) J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA https://www.ncbi.nlm.nih.gov/pubmed/ -Colombia/2016/ZC204Se zika KY317939 2016-01-06 South America Colombia Colombia Colombia genbank genome Quick et al https://www.ncbi.nlm.nih.gov/nuccore/KY317939 Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples Nat Protoc 12 (6), 1261-1276 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538739 -ZKC2/2016 zika KX253996 2016-02-16 Oceania American Samoa American Samoa American Samoa genbank genome Wu et al https://www.ncbi.nlm.nih.gov/nuccore/KX253996 Direct Submission Submitted (18-MAY-2016) Center for Diseases Control and Prevention of Guangdong Province; National Institute of Viral Disease Control and Prevention, China https://www.ncbi.nlm.nih.gov/pubmed/ -VEN/UF_1/2016 zika KX702400 2016-03-25 South America Venezuela Venezuela Venezuela genbank genome Blohm et al https://www.ncbi.nlm.nih.gov/nuccore/KX702400 Complete Genome Sequences of Identical Zika virus Isolates in a Nursing Mother and Her Infant Genome Announc 5 (17), e00231-17 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28450510 -DOM/2016/BB_0059 zika KY785425 2016-04-04 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al https://www.ncbi.nlm.nih.gov/nuccore/KY785425 Zika virus evolution and spread in the Americas Nature 546 (7658), 411-415 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538734 -BRA/2016/FC_6706 zika KY785433 2016-04-08 South America Brazil Brazil Brazil genbank genome Metsky et al https://www.ncbi.nlm.nih.gov/nuccore/KY785433 Zika virus evolution and spread in the Americas Nature 546 (7658), 411-415 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538734 -DOM/2016/BB_0183 zika KY785420 2016-04-18 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al https://www.ncbi.nlm.nih.gov/nuccore/KY785420 Zika virus evolution and spread in the Americas Nature 546 (7658), 411-415 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538734 -EcEs062_16 zika KX879603 2016-04-XX South America Ecuador Ecuador Ecuador genbank genome Marquez et al https://www.ncbi.nlm.nih.gov/nuccore/KX879603 First Complete Genome Sequences of Zika Virus Isolated from Febrile Patient Sera in Ecuador Genome Announc 5 (8), e01673-16 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28232448 -HND/2016/HU_ME59 zika KY785418 2016-05-13 North America Honduras Honduras Honduras genbank genome Metsky et al https://www.ncbi.nlm.nih.gov/nuccore/KY785418 Zika virus evolution and spread in the Americas Nature 546 (7658), 411-415 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538734 -DOM/2016/MA_WGS16_011 zika KY785484 2016-06-06 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al https://www.ncbi.nlm.nih.gov/nuccore/KY785484 Zika virus evolution and spread in the Americas Nature 546 (7658), 411-415 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538734 -DOM/2016/BB_0433 zika KY785441 2016-06-13 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al https://www.ncbi.nlm.nih.gov/nuccore/KY785441 Zika virus evolution and spread in the Americas Nature 546 (7658), 411-415 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538734 -USA/2016/FL022 zika KY075935 2016-07-22 North America Usa Usa Usa genbank genome Grubaugh et al https://www.ncbi.nlm.nih.gov/nuccore/KY075935 Genomic epidemiology reveals multiple introductions of Zika virus into the United States Nature (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/28538723 -SG_027 zika KY241697 2016-08-27 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al https://www.ncbi.nlm.nih.gov/nuccore/KY241697 Outbreak of Zika virus infection in Singapore: an epidemiological, entomological, virological, and clinical analysis Lancet Infect Dis (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/ -SG_074 zika KY241744 2016-08-28 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al https://www.ncbi.nlm.nih.gov/nuccore/KY241744 Outbreak of Zika virus infection in Singapore: an epidemiological, entomological, virological, and clinical analysis Lancet Infect Dis (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/ -SG_056 zika KY241726 2016-08-28 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al https://www.ncbi.nlm.nih.gov/nuccore/KY241726 Outbreak of Zika virus infection in Singapore: an epidemiological, entomological, virological, and clinical analysis Lancet Infect Dis (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/ -USA/2016/FLUR022 zika KY325473 2016-08-31 North America Usa Usa Usa genbank genome Grubaugh et al https://www.ncbi.nlm.nih.gov/nuccore/KY325473 Genomic epidemiology reveals multiple introductions of Zika virus into the United States Nature (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/28538723 -Aedes_aegypti/USA/2016/FL05 zika KY075937 2016-09-09 North America Usa Usa Usa genbank genome Grubaugh et al https://www.ncbi.nlm.nih.gov/nuccore/KY075937 Genomic epidemiology reveals multiple introductions of Zika virus into the United States Nature (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/28538723 -SG_018 zika KY241688 2016-09-13 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al https://www.ncbi.nlm.nih.gov/nuccore/KY241688 Outbreak of Zika virus infection in Singapore: an epidemiological, entomological, virological, and clinical analysis Lancet Infect Dis (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/ -USA/2016/FLWB042 zika KY325478 2016-09-26 North America Usa Usa Usa genbank genome Grubaugh et al https://www.ncbi.nlm.nih.gov/nuccore/KY325478 Genomic epidemiology reveals multiple introductions of Zika virus into the United States Nature (2017) In press https://www.ncbi.nlm.nih.gov/pubmed/28538723 -COL/PRV_00028/2015 zika MF574578 2016-12-XX South America Colombia Colombia Colombia genbank genome Pickett et al https://www.ncbi.nlm.nih.gov/nuccore/MF574578 Direct Submission Submitted (30-JUL-2017) J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA https://www.ncbi.nlm.nih.gov/pubmed/ -Thailand/1610acTw zika MF692778 2016-10-XX Southeast Asia Thailand Thailand Thailand genbank genome Lin et al https://www.ncbi.nlm.nih.gov/nuccore/MF692778 Imported Zika virus strains, Taiwan, 2016 Unpublished https://www.ncbi.nlm.nih.gov/pubmed/ -1_0087_PF zika KX447509 2013-12-XX Oceania French Polynesia French Polynesia French Polynesia genbank genome Pettersson et al https://www.ncbi.nlm.nih.gov/nuccore/KX447509 How Did Zika Virus Emerge in the Pacific Islands and Latin America? MBio 7 (5), e01239-16 (2016) https://www.ncbi.nlm.nih.gov/pubmed/27729507 -1_0199_PF zika KX447519 2013-11-XX Oceania French Polynesia French Polynesia French Polynesia genbank genome Pettersson et al https://www.ncbi.nlm.nih.gov/nuccore/KX447519 How Did Zika Virus Emerge in the Pacific Islands and Latin America? MBio 7 (5), e01239-16 (2016) https://www.ncbi.nlm.nih.gov/pubmed/27729507 -1_0181_PF zika KX447512 2013-12-XX Oceania French Polynesia French Polynesia French Polynesia genbank genome Pettersson et al https://www.ncbi.nlm.nih.gov/nuccore/KX447512 How Did Zika Virus Emerge in the Pacific Islands and Latin America? MBio 7 (5), e01239-16 (2016) https://www.ncbi.nlm.nih.gov/pubmed/27729507 -Brazil/2015/ZBRC301 zika KY558995 2015-05-13 South America Brazil Brazil Brazil genbank genome Faria et al https://www.ncbi.nlm.nih.gov/nuccore/KY558995 Epidemic establishment and cryptic transmission of Zika virus in Brazil and the Americas Unpublished https://www.ncbi.nlm.nih.gov/pubmed/ -Brazil/2015/ZBRA105 zika KY558989 2015-02-23 South America Brazil Brazil Brazil genbank genome Faria et al https://www.ncbi.nlm.nih.gov/nuccore/KY558989 Establishment and cryptic transmission of Zika virus in Brazil and the Americas Nature 546 (7658), 406-410 (2017) https://www.ncbi.nlm.nih.gov/pubmed/28538727 -Brazil/2016/ZBRC16 zika KY558991 2016-01-19 South America Brazil Brazil Brazil genbank genome Faria et al https://www.ncbi.nlm.nih.gov/nuccore/KY558991 Epidemic establishment and cryptic transmission of Zika virus in Brazil and the Americas Unpublished https://www.ncbi.nlm.nih.gov/pubmed/ -V8375 zika KU501217 2015-11-01 North America Guatemala Guatemala Guatemala genbank genome Lanciotti et al https://www.ncbi.nlm.nih.gov/nuccore/KU501217 Phylogeny of Zika Virus in Western Hemisphere, 2015 Emerging Infect. Dis. 22 (5), 933-935 (2016) https://www.ncbi.nlm.nih.gov/pubmed/27088323 -Nica1_16 zika KX421195 2016-01-19 North America Nicaragua Nicaragua Nicaragua genbank genome Tabata et al https://www.ncbi.nlm.nih.gov/nuccore/KX421195 Zika Virus Targets Different Primary Human Placental Cells, Suggesting Two Routes for Vertical Transmission Cell Host Microbe 20 (2), 155-166 (2016) https://www.ncbi.nlm.nih.gov/pubmed/27443522 -Brazil/2015/ZBRC303 zika KY558997 2015-05-14 South America Brazil Brazil Brazil genbank genome Faria et al https://www.ncbi.nlm.nih.gov/nuccore/KY558997 Epidemic establishment and cryptic transmission of Zika virus in Brazil and the Americas Unpublished https://www.ncbi.nlm.nih.gov/pubmed/ -SMGC_1 zika KX266255 2016-02-14 Oceania American Samoa American Samoa American Samoa genbank genome Bi et al https://www.ncbi.nlm.nih.gov/nuccore/KX266255 Genetic and Biological Characterization for Zika Viruses Imported through Shenzhen Port Chin. Sci. Bull. 61 (22), 2463-2474 (2016) https://www.ncbi.nlm.nih.gov/pubmed/ diff --git a/ingest/README.md b/ingest/README.md new file mode 100644 index 0000000..3d8c451 --- /dev/null +++ b/ingest/README.md @@ -0,0 +1,96 @@ +# nextstrain.org/zika/ingest + +This is the ingest pipeline for zika virus sequences. + +## Software requirements + +Follow the [standard installation instructions](https://docs.nextstrain.org/en/latest/install.html) for Nextstrain's suite of software tools. + +## Usage + +> NOTE: All command examples assume you are within the `ingest` directory. +> If running commands from the outer `zika` directory, please replace the `.` with `ingest` + +Fetch sequences with + +```sh +nextstrain build . data/sequences.ndjson +``` + +Run the complete ingest pipeline with + +```sh +nextstrain build . +``` + +This will produce two files (within the `ingest` directory): + +- `results/metadata.tsv` +- `results/sequences.fasta` + +Run the complete ingest pipeline and upload results to AWS S3 with + +```sh +nextstrain build . --configfiles config/config.yaml config/optional.yaml +``` + +### Adding new sequences not from GenBank + +#### Static Files + +Do the following to include sequences from static FASTA files. + +1. Convert the FASTA files to NDJSON files with: + + ```sh + ./ingest/bin/fasta-to-ndjson \ + --fasta {path-to-fasta-file} \ + --fields {fasta-header-field-names} \ + --separator {field-separator-in-header} \ + --exclude {fields-to-exclude-in-output} \ + > ingest/data/{file-name}.ndjson + ``` + +2. Add the following to the `.gitignore` to allow the file to be included in the repo: + + ```gitignore + !ingest/data/{file-name}.ndjson + ``` + +3. Add the `file-name` (without the `.ndjson` extension) as a source to `ingest/config/config.yaml`. This will tell the ingest pipeline to concatenate the records to the GenBank sequences and run them through the same transform pipeline. + +## Configuration + +Configuration takes place in `config/config.yaml` by default. +Optional configs for uploading files and Slack notifications are in `config/optional.yaml`. + +### Environment Variables + +The complete ingest pipeline with AWS S3 uploads and Slack notifications uses the following environment variables: + +#### Required + +- `AWS_ACCESS_KEY_ID` +- `AWS_SECRET_ACCESS_KEY` +- `SLACK_TOKEN` +- `SLACK_CHANNELS` + +#### Optional + +These are optional environment variables used in our automated pipeline for providing detailed Slack notifications. + +- `GITHUB_RUN_ID` - provided via [`github.run_id` in a GitHub Action workflow](https://docs.github.com/en/actions/learn-github-actions/contexts#github-context) +- `AWS_BATCH_JOB_ID` - provided via [AWS Batch Job environment variables](https://docs.aws.amazon.com/batch/latest/userguide/job_env_vars.html) + +## Input data + +### GenBank data + +GenBank sequences and metadata are fetched via [NCBI datasets](https://www.ncbi.nlm.nih.gov/datasets/docs/v2/download-and-install/). + +## `ingest/vendored` + +This repository uses [`git subrepo`](https://github.com/ingydotnet/git-subrepo) to manage copies of ingest scripts in [ingest/vendored](./vendored), from [nextstrain/ingest](https://github.com/nextstrain/ingest). + +See [vendored/README.md](vendored/README.md#vendoring) for instructions on how to update +the vendored scripts. diff --git a/ingest/Snakefile b/ingest/Snakefile new file mode 100644 index 0000000..fb26cc1 --- /dev/null +++ b/ingest/Snakefile @@ -0,0 +1,73 @@ +from snakemake.utils import min_version + +min_version( + "7.7.0" +) # Snakemake 7.7.0 introduced `retries` directive used in fetch-sequences + +# Use default configuration values. Override with Snakemake's --configfile/--config options. +configfile: "config/defaults.yaml" + + +send_slack_notifications = config.get("send_slack_notifications", False) + + +def _get_all_targets(wildcards): + # Default targets are the metadata TSV and sequences FASTA files + all_targets = ["results/sequences.fasta", "results/metadata.tsv"] + + # Add additional targets based on upload config + upload_config = config.get("upload", {}) + + for target, params in upload_config.items(): + files_to_upload = params.get("files_to_upload", {}) + + if not params.get("dst"): + print( + f"Skipping file upload for {target!r} because the destination was not defined." + ) + else: + all_targets.extend( + expand( + [f"data/upload/{target}/{{remote_file_name}}.done"], + zip, + remote_file_name=files_to_upload.keys(), + ) + ) + + # Add additional targets for Nextstrain's internal Slack notifications + if send_slack_notifications: + all_targets.extend( + [ + "data/notify/genbank-record-change.done", + "data/notify/metadata-diff.done", + ] + ) + + if config.get("trigger_rebuild", False): + all_targets.append("data/trigger/rebuild.done") + + return all_targets + + +rule all: + input: + _get_all_targets, + + +include: "rules/fetch_sequences.smk" +include: "rules/transform.smk" + + +if config.get("upload", False): + + include: "rules/upload.smk" + + +if send_slack_notifications: + + include: "rules/slack_notifications.smk" + + +if config.get("trigger_rebuild", False): + + include: "rules/trigger_rebuild.smk" diff --git a/ingest/bin/fasta-to-ndjson b/ingest/bin/fasta-to-ndjson new file mode 100755 index 0000000..1ee9f8f --- /dev/null +++ b/ingest/bin/fasta-to-ndjson @@ -0,0 +1,86 @@ +#!/usr/bin/env python3 +""" +Parse delimited fields from FASTA header into NDJSON format to stdout. +The output NDJSON records are guaranteed to have at least two fields: + 1. strain + 2. sequence + +Uses the `augur.io.read_sequences` function to read the FASTA file, +so `augur` must be installed in the environment running the script. +""" + +import argparse +import json +import sys + +from augur.io import read_sequences + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--fasta", required=True, + help="FASTA file to be transformed into NDJSON format") + parser.add_argument("--fields", nargs="+", + help="Fields in the FASTA header, listed in the same order as the header. " + + "These will be used as the keys in the final NDJSON output. " + + "One of the fields must be 'strain'. " + + "These cannot include the field 'sequence' as this field is reserved for the genomic sequence.") + parser.add_argument("--separator", default='|', + help="Field separator in the FASTA header") + parser.add_argument("--exclude", nargs="*", + help="List of fields to exclude from final NDJSON record. " + "These cannot include 'strain' or 'sequence'.") + + args = parser.parse_args() + + fasta_fields = [field.lower() for field in args.fields] + + exclude_fields = [] + if args.exclude: + exclude_fields = [field.lower() for field in args.exclude] + + passed_checks = True + + if 'strain' not in fasta_fields: + print("ERROR: FASTA fields must include a 'strain' field.", file=sys.stderr) + passed_checks = False + + if 'sequence' in fasta_fields: + print("ERROR: FASTA fields cannot include a 'sequence' field.", file=sys.stderr) + passed_checks = False + + if 'strain' in exclude_fields: + print("ERROR: The field 'strain' cannot be excluded from the output.", file=sys.stderr) + passed_checks = False + + if 'sequence' in exclude_fields: + print("ERROR: The field 'sequence' cannot be excluded from the output.", file=sys.stderr) + passed_checks = False + + missing_fields = [field for field in exclude_fields if field not in fasta_fields] + if missing_fields: + print(f"ERROR: The following exclude fields do not match any FASTA fields: {missing_fields}", file=sys.stderr) + passed_checks = False + + if not passed_checks: + print("ERROR: Failed to parse FASTA file into NDJSON records.","See detailed errors above.", file=sys.stderr) + sys.exit(1) + + sequences = read_sequences(args.fasta) + + for sequence in sequences: + field_values = [ + value.strip() + for value in sequence.description.split(args.separator) + ] + record = dict(zip(fasta_fields, field_values)) + record['sequence'] = str(sequence.seq).upper() + + for field in exclude_fields: + del record[field] + + json.dump(record, sys.stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/bin/fix-zika-strain-names.py b/ingest/bin/fix-zika-strain-names.py new file mode 100755 index 0000000..5353ae8 --- /dev/null +++ b/ingest/bin/fix-zika-strain-names.py @@ -0,0 +1,62 @@ +#! /usr/bin/env python3 +""" +Parses GenBank's 'strain' field of the NDJSON record from stdin and applies Zika-specific strain name corrections +based on historical modifications from the fauna repo. + +Outputs the modified record to stdout. +""" + +import argparse +import json +from sys import stdin, stdout + +import re + +def parse_args(): + parser = argparse.ArgumentParser( + description="Modify zika strain names by referencing historical modifications from the fauna repo." + ) + parser.add_argument("--strain-field", default='strain', + help="Field from the records to use as the strain name to be fixed.") + + return parser.parse_args() + + +def _set_strain_name(record): + """Replace spaces, dashes, and periods with underscores in strain name.""" + strain_name = record["strain"] + + strain_name = strain_name.replace('Zika_virus', '').replace('Zikavirus', '').replace('Zika virus', '').replace('Zika', '').replace('ZIKV', '') + strain_name = strain_name.replace('Human', '').replace('human', '').replace('H.sapiens_wt', '').replace('H.sapiens-wt', '').replace('H.sapiens_tc', '').replace('Hsapiens_tc', '').replace('H.sapiens-tc', '').replace('Homo_sapiens', '').replace('Homo sapiens', '').replace('Hsapiens', '').replace('H.sapiens', '') + strain_name = strain_name.replace('/Hu/', '') + strain_name = strain_name.replace('_Asian', '').replace('_Asia', '').replace('_asian', '').replace('_asia', '') + strain_name = strain_name.replace('_URI', '').replace('-URI', '').replace('_SER', '').replace('-SER', '').replace('_PLA', '').replace('-PLA', '').replace('_MOS', '').replace('_SAL', '') + strain_name = strain_name.replace('Aaegypti_wt', 'Aedes_aegypti').replace('Aedessp', 'Aedes_sp') + strain_name = strain_name.replace(' ', '').replace('\'', '').replace('(', '').replace(')', '').replace('//', '/').replace('__', '_').replace('.', '').replace(',', '') + strain_name = re.sub('^[\/\_\-]', '', strain_name) + + try: + strain_name = 'V' + str(int(strain_name)) + except ValueError: + pass + + return ( + strain_name.replace(" ", "_") + .replace("-", "_") + .replace(".", "_") + .replace("(", "_") + .replace(")", "_") + ) + + +def main(): + args = parse_args() + + for index, record in enumerate(stdin): + record = json.loads(record) + record[args.strain_field] = _set_strain_name(record) + stdout.write(json.dumps(record) + "\n") + + +if __name__ == "__main__": + main() diff --git a/ingest/bin/ndjson-to-tsv-and-fasta b/ingest/bin/ndjson-to-tsv-and-fasta new file mode 100755 index 0000000..d9d7331 --- /dev/null +++ b/ingest/bin/ndjson-to-tsv-and-fasta @@ -0,0 +1,67 @@ +#!/usr/bin/env python3 +""" +Parses NDJSON records from stdin to two different files: a metadata TSV and a +sequences FASTA. + +Records that do not have an ID or sequence will be excluded from the output files. +""" +import argparse +import csv +import json +from sys import stderr, stdin + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--metadata", metavar="TSV", default="data/metadata.tsv", + help="The output metadata TSV file") + parser.add_argument("--fasta", metavar="FASTA", default="data/sequences.fasta", + help="The output sequences FASTA file") + parser.add_argument("--metadata-columns", nargs="+", + help="List of fields from the NDJSON records to include as columns in the metadata TSV. " + + "Metadata TSV columns will be in the order of the columns provided.") + parser.add_argument("--id-field", default='strain', + help="Field from the records to use as the sequence ID in the FASTA file.") + parser.add_argument("--sequence-field", default='sequence', + help="Field from the record that holds the genomic sequence for the FASTA file.") + + args = parser.parse_args() + + with open(args.metadata, 'wt') as metadata_output: + with open(args.fasta, 'wt') as fasta_output: + metadata_csv = csv.DictWriter( + metadata_output, + args.metadata_columns, + restval="", + extrasaction='ignore', + delimiter='\t', + lineterminator='\n', + ) + metadata_csv.writeheader() + + for index, record in enumerate(stdin): + record = json.loads(record) + + sequence_id = str(record.get(args.id_field, '')) + sequence = str(record.get(args.sequence_field, '')) + + if not sequence_id: + print( + f"WARNING: Record number {index} does not have a sequence ID.", + "This record will be excluded from the output files.", + file=stderr + ) + elif not sequence: + print( + f"WARNING: Record number {index} does not have a sequence.", + "This record will be excluded from the output files.", + file=stderr + ) + else: + metadata_csv.writerow(record) + + print(f">{sequence_id}", file=fasta_output) + print(f"{sequence}" , file= fasta_output) diff --git a/ingest/config/annotations.tsv b/ingest/config/annotations.tsv new file mode 100644 index 0000000..502a3c1 --- /dev/null +++ b/ingest/config/annotations.tsv @@ -0,0 +1,237 @@ +KX922703 strain USA/2016/FL021 +KY765326 strain NIC/6188_13A1/2016 +KX922707 strain USA/2016/FL039 +KU922923 strain MEX/InDRE/2016 +KY075934 strain PuertoRico/2016/FL016U +KY765327 strain NIC/5005_13A1/2016 +KX922705 strain USA/2016/FL032 +KY075938 strain Aedes_aegypti/USA/2016/FL06 +KX922704 strain USA/2016/FL030 +KX673530 strain PHE_Guadeloupe +KY075935 strain USA/2016/FL022 +KX838906 strain Aedes_aegypti/USA/2016/FL03 +KY075933 strain PuertoRico/2016/FL008U +KX838904 strain Aedes_aegypti/USA/2016/FL01 +KX838905 strain Aedes_aegypti/USA/2016/FL02 +KY765320 strain NIC/6406_13A1/2016 +KY075936 strain USA/2016/FL036 +KY075932 strain Martinique/2016/FL001Sa +KY765321 strain NIC/4886_12A1/2016 +KY075939 strain Aedes_aegypti/USA/2016/FL08 +KX922706 strain USA/2016/FL038 +KY075937 strain Aedes_aegypti/USA/2016/FL05 +KX922708 strain Aedes_aegypti/USA/2016/FL04 +KY014295 strain USA/2016/FL010 +MT377503 strain V151144 +MF988734 strain SG_EHI_/33164Y17 +KU853013 strain Dominican_Republic/2016/PD2 +KY785443 strain USA/2016/FL028 +KX906952 strain 2016_HND_19563 +KY120348 strain MEX_CIENI551 +KX856011 strain Aedes_sp/MEX_I_44/2016 +KY785421 strain USA/2016/FL019 +KU527068 strain Natal_RGN +MF438286 strain Cuba_2017 +KF993678 strain THA/PLCal_ZV/2013 +KY631494 strain ENCB165P4 +KY785440 strain USA/2016/FL035 +KY785451 strain Martinique/2016/FL001 +MF664436 strain Dominican_Republic/2016/ZB +KY648934 strain Aedes_aegypti/MEX/MEX_I_44/2016 +KX879603 strain EC/Esmeraldas/062/2016 +OL414716 strain Faranah/18 +MN185326 strain French_Guiana_Aedes_aegypti_T1010 +MN185328 strain French_Guiana_Aedes_aegypti_T1141 +KX827268 strain USA/UT_1/2016 +KU853012 strain Dominican_Republic/2016/PD1 +MK028857 strain Puerto_Rico/2015/PRVABC59 +KY785457 strain USA/2016/FL029 +MH513600 strain BR/Sinop/H366_2P/2015 +KY927808 strain ZZ_1 +KX087102 strain COL/FLR/2015 +KX879604 strain EC/Esmeraldas/089/2016 +KF993678 country Thailand +KF993678 division Thailand +KF993678 location Thailand +KF993678 region Southeast Asia +KU647676 country Martinique +KU647676 division Martinique +KU647676 location Martinique +KU647676 region North America +KU740184 country Venezuela +KU740184 division Venezuela +KU740184 location Venezuela +KU740184 region South America +KU744693 country Venezuela +KU744693 division Venezuela +KU744693 location Venezuela +KU744693 region South America +KU758877 country French Guiana +KU758877 division French Guiana +KU758877 location French Guiana +KU758877 region South America +KU761560 country American Samoa +KU761560 division American Samoa +KU761560 location American Samoa +KU761560 region Oceania +KU761561 country American Samoa +KU761561 division American Samoa +KU761561 location American Samoa +KU761561 region Oceania +KU761564 country Venezuela +KU761564 division Venezuela +KU761564 location Venezuela +KU761564 region South America +KU820898 country Venezuela +KU820898 division Venezuela +KU820898 location Venezuela +KU820898 region South America +KU853012 country Dominican Republic +KU853012 division Dominican Republic +KU853012 location Dominican Republic +KU853012 region North America +KU866423 country American Samoa +KU866423 division American Samoa +KU866423 location American Samoa +KU866423 region Oceania +KU955589 country American Samoa +KU955589 division American Samoa +KU955589 location American Samoa +KU955589 region Oceania +KU955590 country Venezuela +KU955590 division Venezuela +KU955590 location Venezuela +KU955590 region South America +KU963796 country American Samoa +KU963796 division American Samoa +KU963796 location American Samoa +KU963796 region Oceania +KU991811 country Brazil +KU991811 division Brazil +KU991811 location Brazil +KU991811 region South America +KX056898 country Venezuela +KX056898 division Venezuela +KX056898 location Venezuela +KX056898 region South America +KX117076 country American Samoa +KX117076 division American Samoa +KX117076 location American Samoa +KX117076 region Oceania +KX185891 country American Samoa +KX185891 division American Samoa +KX185891 location American Samoa +KX185891 region Oceania +KX253996 country American Samoa +KX253996 division American Samoa +KX253996 location American Samoa +KX253996 region Oceania +KX266255 country American Samoa +KX266255 division American Samoa +KX266255 location American Samoa +KX266255 region Oceania +KX269878 country Haiti +KX269878 division Haiti +KX269878 location Haiti +KX269878 region North America +KX673530 country Guadeloupe +KX673530 division Guadeloupe +KX673530 location Guadeloupe +KX673530 region North America +KY120352 country Brazil +KY120352 division Brazil +KY120352 location Brazil +KY120352 region South America +KY120353 country Philippines +KY120353 division Philippines +KY120353 location Philippines +KY120353 region Southeast Asia +KY553111 country Philippines +KY553111 division Philippines +KY553111 location Philippines +KY553111 region Southeast Asia +KY785451 country Martinique +KY785451 division Martinique +KY785451 location Martinique +KY785451 region North America +KY785454 country El Salvador +KY785454 division El Salvador +KY785454 location El Salvador +KY785454 region North America +KY962729 country Philippines +KY962729 division Philippines +KY962729 location Philippines +KY962729 region Southeast Asia +LC191864 country Fiji +LC191864 division Fiji +LC191864 location Fiji +LC191864 region Oceania +LC219720 country Vietnam +LC219720 division Vietnam +LC219720 location Vietnam +LC219720 region Southeast Asia +LC369584 country Thailand +LC369584 division Thailand +LC369584 location Thailand +LC369584 region Southeast Asia +MF098764 country Dominican Republic +MF098764 division Dominican Republic +MF098764 location Dominican Republic +MF098764 region North America +MF098765 country Dominican Republic +MF098765 division Dominican Republic +MF098765 location Dominican Republic +MF098765 region North America +MF098766 country Dominican Republic +MF098766 division Dominican Republic +MF098766 location Dominican Republic +MF098766 region North America +MF098767 country Saint Barthelemy +MF098767 division Saint Barthelemy +MF098767 location Saint Barthelemy +MF098767 region North America +MF098768 country Dominican Republic +MF098768 division Dominican Republic +MF098768 location Dominican Republic +MF098768 region North America +MF098769 country Dominican Republic +MF098769 division Dominican Republic +MF098769 location Dominican Republic +MF098769 region North America +MF098770 country Mexico +MF098770 division Mexico +MF098770 location Mexico +MF098770 region North America +MF098771 country Mexico +MF098771 division Mexico +MF098771 location Mexico +MF098771 region North America +MF593625 country Guatemala +MF593625 division Guatemala +MF593625 location Guatemala +MF593625 region North America +MF664436 country Dominican Republic +MF664436 division Dominican Republic +MF664436 location Dominican Republic +MF664436 region North America +MF692778 country Thailand +MF692778 division Thailand +MF692778 location Thailand +MF692778 region Southeast Asia +MF988734 country Cuba +MF988734 division Cuba +MF988734 location Cuba +MF988734 region North America +MK829154 country Angola +MK829154 division Angola +MK829154 location Angola +MK829154 region Africa +MN185326 country French Guiana +MN185326 division French Guiana +MN185326 location French Guiana +MN185326 region South America +MN185328 country French Guiana +MN185328 division French Guiana +MN185328 location French Guiana +MN185328 region South America +KY328289 date 2016-05-15 \ No newline at end of file diff --git a/ingest/config/defaults.yaml b/ingest/config/defaults.yaml new file mode 100644 index 0000000..e7bd353 --- /dev/null +++ b/ingest/config/defaults.yaml @@ -0,0 +1,106 @@ +# Sources of sequences to include in the ingest run +sources: ['genbank'] +# Pathogen NCBI Taxonomy ID +ncbi_taxon_id: '64320' +# The list of NCBI Datasets fields to include from NCBI Datasets output +# These need to be the mneumonics of the NCBI Datasets fields, see docs for full list of fields +# https://www.ncbi.nlm.nih.gov/datasets/docs/v2/reference-docs/command-line/dataformat/tsv/dataformat_tsv_virus-genome/#fields +# Note: the "accession" field MUST be provided to match with the sequences +ncbi_datasets_fields: + - accession + - sourcedb + - sra-accs + - isolate-lineage + - geo-region + - geo-location + - isolate-collection-date + - release-date + - update-date + - length + - host-name + - isolate-lineage-source + - biosample-acc + - submitter-names + - submitter-affiliation + - submitter-country + +# Params for the transform rule +transform: + # NCBI fields to rename to Nextstrain field names. + # This is the first step in the pipeline, so any references to field names + # in the configs below should use the new field names + field_map: [ + 'accession=genbank_accession', + 'accession-rev=genbank_accession_rev', + 'isolate-lineage=strain', + 'sourcedb=database', + 'geo-region=region', + 'geo-location=location', + 'host-name=host', + 'isolate-collection-date=date', + 'release-date=release_date', + 'update-date=update_date', + 'sra-accs=sra_accessions', + 'submitter-names=authors', + 'submitter-affiliations=institution', + ] + # Standardized strain name regex + # Currently accepts any characters because we do not have a clear standard for strain names + strain_regex: '^.+$' + # Back up strain name field if 'strain' doesn't match regex above + strain_backup_fields: ['genbank_accession'] + # List of date fields to standardize + date_fields: ['date', 'release_date', 'update_date'] + # Expected date formats present in date fields + # These date formats should use directives expected by datetime + # See https://docs.python.org/3.9/library/datetime.html#strftime-and-strptime-format-codes + expected_date_formats: ['%Y', '%Y-%m', '%Y-%m-%d', '%Y-%m-%dT%H:%M:%SZ'] + # Titlecase rules + titlecase: + # Abbreviations not cast to titlecase, keeps uppercase + abbreviations: ['USA'] + # Articles that should not be cast to titlecase + articles: [ + 'and', 'd', 'de', 'del', 'des', 'di', 'do', 'en', 'l', 'la', 'las', 'le', + 'los', 'nad', 'of', 'op', 'sur', 'the', 'y' + ] + # List of string fields to titlecase + fields: ['region', 'country', 'division', 'location'] + # Authors field name + authors_field: 'authors' + # Authors default value if authors value is empty + authors_default_value: '?' + # Field name for the generated abbreviated authors + abbr_authors_field: 'abbr_authors' + # General geolocation rules to apply to geolocation fields + geolocation_rules_url: 'https://raw.githubusercontent.com/nextstrain/ncov-ingest/master/source-data/gisaid_geoLocationRules.tsv' + # Local geolocation rules that are only applicable to zika data + # Local rules can overwrite the general geolocation rules provided above + local_geolocation_rules: 'config/geolocation-rules.tsv' + # User annotations file + annotations: 'config/annotations.tsv' + # ID field used to merge annotations + annotations_id: 'genbank_accession' + # Field to use as the sequence ID in the FASTA file + id_field: 'genbank_accession' + # Field to use as the sequence in the FASTA file + sequence_field: 'sequence' + # Final output columns for the metadata TSV + metadata_columns: [ + 'genbank_accession', + 'genbank_accession_rev', + 'strain', + 'date', + 'region', + 'country', + 'division', + 'location', + 'length', + 'host', + 'release_date', + 'update_date', + 'sra_accessions', + 'authors', + 'institution', + ] + diff --git a/ingest/config/geolocation-rules.tsv b/ingest/config/geolocation-rules.tsv new file mode 100644 index 0000000..8b13789 --- /dev/null +++ b/ingest/config/geolocation-rules.tsv @@ -0,0 +1 @@ + diff --git a/ingest/config/optional.yaml b/ingest/config/optional.yaml new file mode 100644 index 0000000..9f00a7e --- /dev/null +++ b/ingest/config/optional.yaml @@ -0,0 +1,25 @@ +# Optional configs used by Nextstrain team +# Params for uploads +upload: + # Upload params for AWS S3 + s3: + # AWS S3 Bucket with prefix + dst: 's3://nextstrain-data/files/workflows/zika' + # Mapping of files to upload, with key as remote file name and the value + # the local file path relative to the ingest directory. + files_to_upload: + genbank.ndjson.xz: data/genbank.ndjson + all_sequences.ndjson.xz: data/sequences.ndjson + metadata.tsv.gz: results/metadata.tsv + sequences.fasta.xz: results/sequences.fasta + alignment.fasta.xz: data/alignment.fasta + insertions.csv.gz: data/insertions.csv + translations.zip: data/translations.zip + + cloudfront_domain: 'data.nextstrain.org' + +# Toggle for Slack notifications +send_slack_notifications: True + +# Toggle for triggering builds +trigger_rebuild: True diff --git a/ingest/profiles/default/config.yaml b/ingest/profiles/default/config.yaml new file mode 100644 index 0000000..c69390b --- /dev/null +++ b/ingest/profiles/default/config.yaml @@ -0,0 +1,4 @@ +cores: all +rerun-incomplete: true +printshellcmds: true +reason: true diff --git a/ingest/rules/fetch_sequences.smk b/ingest/rules/fetch_sequences.smk new file mode 100644 index 0000000..2fef4b1 --- /dev/null +++ b/ingest/rules/fetch_sequences.smk @@ -0,0 +1,106 @@ +""" +This part of the workflow handles fetching sequences from various sources. +Uses `config.sources` to determine which sequences to include in final output. + +Currently only fetches sequences from GenBank, but other sources can be +defined in the config. If adding other sources, add a new rule upstream +of rule `fetch_all_sequences` to create the file `data/{source}.ndjson` or the +file must exist as a static file in the repo. + +Produces final output as + + sequences_ndjson = "data/sequences.ndjson" + +""" + + +rule fetch_ncbi_dataset_package: + output: + dataset_package=temp("data/ncbi_dataset.zip"), + retries: 5 # Requires snakemake 7.7.0 or later + benchmark: + "benchmarks/fetch_ncbi_dataset_package.txt" + params: + ncbi_taxon_id=config["ncbi_taxon_id"], + shell: + """ + datasets download virus genome taxon {params.ncbi_taxon_id} \ + --no-progressbar \ + --filename {output.dataset_package} + """ + + +rule extract_ncbi_dataset_sequences: + input: + dataset_package="data/ncbi_dataset.zip", + output: + ncbi_dataset_sequences=temp("data/ncbi_dataset_sequences.fasta"), + benchmark: + "benchmarks/extract_ncbi_dataset_sequences.txt" + shell: + """ + unzip -jp {input.dataset_package} \ + ncbi_dataset/data/genomic.fna > {output.ncbi_dataset_sequences} + """ + + +rule format_ncbi_dataset_report: + # Formats the headers to match the NCBI mnemonic names + input: + dataset_package="data/ncbi_dataset.zip", + output: + ncbi_dataset_tsv=temp("data/ncbi_dataset_report.tsv"), + params: + ncbi_datasets_fields=",".join(config["ncbi_datasets_fields"]), + benchmark: + "benchmarks/format_ncbi_dataset_report.txt" + shell: + """ + dataformat tsv virus-genome \ + --package {input.dataset_package} \ + --fields {params.ncbi_datasets_fields:q} \ + --elide-header \ + | csvtk add-header -t -n {params.ncbi_datasets_fields:q} \ + | csvtk rename -t -f accession -n accession-rev \ + | csvtk -tl mutate -f accession-rev -n accession -p "^(.+?)\." \ + | tsv-select -H -f accession --rest last \ + > {output.ncbi_dataset_tsv} + """ + + +rule format_ncbi_datasets_ndjson: + input: + ncbi_dataset_sequences="data/ncbi_dataset_sequences.fasta", + ncbi_dataset_tsv="data/ncbi_dataset_report.tsv", + output: + ndjson="data/genbank.ndjson", + log: + "logs/format_ncbi_datasets_ndjson.txt", + benchmark: + "benchmarks/format_ncbi_datasets_ndjson.txt" + shell: + """ + augur curate passthru \ + --metadata {input.ncbi_dataset_tsv} \ + --fasta {input.ncbi_dataset_sequences} \ + --seq-id-column accession-rev \ + --seq-field sequence \ + --unmatched-reporting warn \ + --duplicate-reporting warn \ + 2> {log} > {output.ndjson} + """ + + +def _get_all_sources(wildcards): + return [f"data/{source}.ndjson" for source in config["sources"]] + + +rule fetch_all_sequences: + input: + all_sources=_get_all_sources, + output: + sequences_ndjson="data/sequences.ndjson", + shell: + """ + cat {input.all_sources} > {output.sequences_ndjson} + """ diff --git a/ingest/rules/slack_notifications.smk b/ingest/rules/slack_notifications.smk new file mode 100644 index 0000000..2b7ec61 --- /dev/null +++ b/ingest/rules/slack_notifications.smk @@ -0,0 +1,55 @@ +""" +This part of the workflow handles various Slack notifications. +Designed to be used internally by the Nextstrain team with hard-coded paths +to files on AWS S3. + +All rules here require two environment variables: + * SLACK_TOKEN + * SLACK_CHANNELS +""" +import os +import sys + +slack_envvars_defined = "SLACK_CHANNELS" in os.environ and "SLACK_TOKEN" in os.environ +if not slack_envvars_defined: + print( + "ERROR: Slack notifications require two environment variables: 'SLACK_CHANNELS' and 'SLACK_TOKEN'.", + file=sys.stderr, + ) + sys.exit(1) + +S3_SRC = "s3://nextstrain-data/files/workflows/zika" + + +rule notify_on_genbank_record_change: + input: + genbank_ndjson="data/genbank.ndjson", + output: + touch("data/notify/genbank-record-change.done"), + params: + s3_src=S3_SRC, + shell: + """ + ./vendored/notify-on-record-change {input.genbank_ndjson} {params.s3_src:q}/genbank.ndjson.xz Genbank + """ + + +rule notify_on_metadata_diff: + input: + metadata="results/metadata.tsv", + output: + touch("data/notify/metadata-diff.done"), + params: + s3_src=S3_SRC, + shell: + """ + ./vendored/notify-on-diff {input.metadata} {params.s3_src:q}/metadata.tsv.gz + """ + + +onstart: + shell("./vendored/notify-on-job-start Ingest nextstrain/zika") + + +onerror: + shell("./vendored/notify-on-job-fail Ingest nextstrain/zika") diff --git a/ingest/rules/transform.smk b/ingest/rules/transform.smk new file mode 100644 index 0000000..2860fdd --- /dev/null +++ b/ingest/rules/transform.smk @@ -0,0 +1,97 @@ +""" +This part of the workflow handles transforming the data into standardized +formats and expects input file + + sequences_ndjson = "data/sequences.ndjson" + +This will produce output files as + + metadata = "results/metadata.tsv" + sequences = "results/sequences.fasta" + +Parameters are expected to be defined in `config.transform`. +""" + + +rule fetch_general_geolocation_rules: + output: + general_geolocation_rules="data/general-geolocation-rules.tsv", + params: + geolocation_rules_url=config["transform"]["geolocation_rules_url"], + shell: + """ + curl {params.geolocation_rules_url} > {output.general_geolocation_rules} + """ + + +rule concat_geolocation_rules: + input: + general_geolocation_rules="data/general-geolocation-rules.tsv", + local_geolocation_rules=config["transform"]["local_geolocation_rules"], + output: + all_geolocation_rules="data/all-geolocation-rules.tsv", + shell: + """ + cat {input.general_geolocation_rules} {input.local_geolocation_rules} >> {output.all_geolocation_rules} + """ + + +rule transform: + input: + sequences_ndjson="data/sequences.ndjson", + all_geolocation_rules="data/all-geolocation-rules.tsv", + annotations=config["transform"]["annotations"], + output: + metadata="results/metadata.tsv", + sequences="results/sequences.fasta", + log: + "logs/transform.txt", + params: + field_map=config["transform"]["field_map"], + strain_regex=config["transform"]["strain_regex"], + strain_backup_fields=config["transform"]["strain_backup_fields"], + date_fields=config["transform"]["date_fields"], + expected_date_formats=config["transform"]["expected_date_formats"], + articles=config["transform"]["titlecase"]["articles"], + abbreviations=config["transform"]["titlecase"]["abbreviations"], + titlecase_fields=config["transform"]["titlecase"]["fields"], + authors_field=config["transform"]["authors_field"], + authors_default_value=config["transform"]["authors_default_value"], + abbr_authors_field=config["transform"]["abbr_authors_field"], + annotations_id=config["transform"]["annotations_id"], + metadata_columns=config["transform"]["metadata_columns"], + id_field=config["transform"]["id_field"], + sequence_field=config["transform"]["sequence_field"], + shell: + """ + (cat {input.sequences_ndjson} \ + | ./vendored/transform-field-names \ + --field-map {params.field_map} \ + | augur curate normalize-strings \ + | ./vendored/transform-strain-names \ + --strain-regex {params.strain_regex} \ + --backup-fields {params.strain_backup_fields} \ + | augur curate format-dates \ + --date-fields {params.date_fields} \ + --expected-date-formats {params.expected_date_formats} \ + | ./vendored/transform-genbank-location \ + | augur curate titlecase \ + --titlecase-fields {params.titlecase_fields} \ + --articles {params.articles} \ + --abbreviations {params.abbreviations} \ + | ./vendored/transform-authors \ + --authors-field {params.authors_field} \ + --default-value {params.authors_default_value} \ + | ./vendored/apply-geolocation-rules \ + --geolocation-rules {input.all_geolocation_rules} \ + | ./bin/fix-zika-strain-names.py \ + | ./vendored/merge-user-metadata \ + --annotations {input.annotations} \ + --id-field {params.annotations_id} \ + | ./bin/ndjson-to-tsv-and-fasta \ + --metadata-columns {params.metadata_columns} \ + --metadata {output.metadata} \ + --fasta {output.sequences} \ + --id-field {params.id_field} \ + --sequence-field {params.sequence_field} ) 2>> {log} + """ diff --git a/ingest/rules/trigger_rebuild.smk b/ingest/rules/trigger_rebuild.smk new file mode 100644 index 0000000..0cf6731 --- /dev/null +++ b/ingest/rules/trigger_rebuild.smk @@ -0,0 +1,22 @@ +""" +This part of the workflow handles triggering new zika builds after the +latest metadata TSV and sequence FASTA files have been uploaded to S3. + +Designed to be used internally by the Nextstrain team with hard-coded paths +to expected upload flag files. +""" + + +rule trigger_build: + """ + Triggering zika builds via repository action type `rebuild`. + """ + input: + metadata_upload="data/upload/s3/metadata.tsv.gz.done", + fasta_upload="data/upload/s3/sequences.fasta.xz.done", + output: + touch("data/trigger/rebuild.done"), + shell: + """ + ./vendored/trigger-on-new-data nextstrain/zika rebuild {input.metadata_upload} {input.fasta_upload} + """ diff --git a/ingest/rules/upload.smk b/ingest/rules/upload.smk new file mode 100644 index 0000000..60c5c9b --- /dev/null +++ b/ingest/rules/upload.smk @@ -0,0 +1,64 @@ +""" +This part of the workflow handles uploading files to a specified destination. + +Uses predefined wildcard `file_to_upload` determine input and predefined +wildcard `remote_file_name` as the remote file name in the specified destination. + +Produces output files as `data/upload/{upload_target_name}/{remote_file_name}.done`. + +Currently only supports uploads to AWS S3, but additional upload rules can +be easily added as long as they follow the output pattern described above. +""" +import os + +slack_envvars_defined = "SLACK_CHANNELS" in os.environ and "SLACK_TOKEN" in os.environ +send_notifications = ( + config.get("send_slack_notifications", False) and slack_envvars_defined +) + + +def _get_upload_inputs(wildcards): + """ + If the file_to_upload has Slack notifications that depend on diffs with S3 files, + then we want the upload rule to run after the notification rule. + + This function is mostly to keep track of which flag files to expect for + the rules in `slack_notifications.smk`, so it only includes flag files if + `send_notifications` is True. + """ + inputs = { + "file_to_upload": config["upload"]["s3"]["files_to_upload"][ + wildcards.remote_file_name + ], + } + + if send_notifications: + flag_file = [] + + if file_to_upload == "data/genbank.ndjson": + flag_file = "data/notify/genbank-record-change.done" + elif file_to_upload == "results/metadata.tsv": + flag_file = "data/notify/metadata-diff.done" + + inputs["notify_flag_file"] = flag_file + + return inputs + + +rule upload_to_s3: + input: + unpack(_get_upload_inputs), + output: + "data/upload/s3/{remote_file_name}.done", + params: + quiet="" if send_notifications else "--quiet", + s3_dst=config["upload"].get("s3", {}).get("dst", ""), + cloudfront_domain=config["upload"].get("s3", {}).get("cloudfront_domain", ""), + shell: + """ + ./vendored/upload-to-s3 \ + {params.quiet} \ + {input.file_to_upload:q} \ + {params.s3_dst:q}/{wildcards.remote_file_name:q} \ + {params.cloudfront_domain} 2>&1 | tee {output} + """ diff --git a/ingest/vendored/.cramrc b/ingest/vendored/.cramrc new file mode 100644 index 0000000..153d20f --- /dev/null +++ b/ingest/vendored/.cramrc @@ -0,0 +1,3 @@ +[cram] +shell = /bin/bash +indent = 2 diff --git a/ingest/vendored/.github/pull_request_template.md b/ingest/vendored/.github/pull_request_template.md new file mode 100644 index 0000000..ed4a5b2 --- /dev/null +++ b/ingest/vendored/.github/pull_request_template.md @@ -0,0 +1,16 @@ +### Description of proposed changes + + + +### Related issue(s) + + + +### Checklist + + + +- [ ] Checks pass +- [ ] If adding a script, add an entry for it in the README. + + diff --git a/ingest/vendored/.github/workflows/ci.yaml b/ingest/vendored/.github/workflows/ci.yaml new file mode 100644 index 0000000..c6a218a --- /dev/null +++ b/ingest/vendored/.github/workflows/ci.yaml @@ -0,0 +1,23 @@ +name: CI + +on: + push: + branches: + - main + pull_request: + workflow_dispatch: + +jobs: + shellcheck: + runs-on: ubuntu-latest + steps: + - uses: actions/checkout@v3 + - uses: nextstrain/.github/actions/shellcheck@master + + cram: + runs-on: ubuntu-latest + steps: + - uses: actions/checkout@v3 + - uses: actions/setup-python@v4 + - run: pip install cram + - run: cram tests/ \ No newline at end of file diff --git a/ingest/vendored/.gitrepo b/ingest/vendored/.gitrepo new file mode 100644 index 0000000..40287c2 --- /dev/null +++ b/ingest/vendored/.gitrepo @@ -0,0 +1,12 @@ +; DO NOT EDIT (unless you know what you are doing) +; +; This subdirectory is a git "subrepo", and this file is maintained by the +; git-subrepo command. See https://github.com/ingydotnet/git-subrepo#readme +; +[subrepo] + remote = https://github.com/nextstrain/ingest + branch = main + commit = a0faef53a0c6e7cc4057209454ef0852875dc3a9 + parent = 951d6b515a1b06f84d63dc0e2ee22bd13fe9d309 + method = merge + cmdver = 0.4.6 diff --git a/ingest/vendored/.shellcheckrc b/ingest/vendored/.shellcheckrc new file mode 100644 index 0000000..ebed438 --- /dev/null +++ b/ingest/vendored/.shellcheckrc @@ -0,0 +1,6 @@ +# Use of this file requires Shellcheck v0.7.0 or newer. +# +# SC2064 - We intentionally want variables to expand immediately within traps +# so the trap can not fail due to variable interpolation later. +# +disable=SC2064 diff --git a/ingest/vendored/README.md b/ingest/vendored/README.md new file mode 100644 index 0000000..0ad83f4 --- /dev/null +++ b/ingest/vendored/README.md @@ -0,0 +1,140 @@ +# ingest + +Shared internal tooling for pathogen data ingest. Used by our individual +pathogen repos which produce Nextstrain builds. Expected to be vendored by +each pathogen repo using `git subtree`. + +Some tools may only live here temporarily before finding a permanent home in +`augur curate` or Nextstrain CLI. Others may happily live out their days here. + +## Vendoring + +Nextstrain maintained pathogen repos will use [`git subrepo`](https://github.com/ingydotnet/git-subrepo) to vendor ingest scripts. +(See discussion on this decision in https://github.com/nextstrain/ingest/issues/3) + +For a list of Nextstrain repos that are currently using this method, use [this +GitHub code search](https://github.com/search?type=code&q=org%3Anextstrain+subrepo+%22remote+%3D+https%3A%2F%2Fgithub.com%2Fnextstrain%2Fingest%22). + +If you don't already have `git subrepo` installed, follow the [git subrepo installation instructions](https://github.com/ingydotnet/git-subrepo#installation). +Then add the latest ingest scripts to the pathogen repo by running: + +``` +git subrepo clone https://github.com/nextstrain/ingest ingest/vendored +``` + +Any future updates of ingest scripts can be pulled in with: + +``` +git subrepo pull ingest/vendored +``` + +If you run into merge conflicts and would like to pull in a fresh copy of the +latest ingest scripts, pull with the `--force` flag: + +``` +git subrepo pull ingest/vendored --force +``` + +> **Warning** +> Beware of rebasing/dropping the parent commit of a `git subrepo` update + +`git subrepo` relies on metadata in the `ingest/vendored/.gitrepo` file, +which includes the hash for the parent commit in the pathogen repos. +If this hash no longer exists in the commit history, there will be errors when +running future `git subrepo pull` commands. + +If you run into an error similar to the following: +``` +$ git subrepo pull ingest/vendored +git-subrepo: Command failed: 'git branch subrepo/ingest/vendored '. +fatal: not a valid object name: '' +``` +Check the parent commit hash in the `ingest/vendored/.gitrepo` file and make +sure the commit exists in the commit history. Update to the appropriate parent +commit hash if needed. + +## History + +Much of this tooling originated in +[ncov-ingest](https://github.com/nextstrain/ncov-ingest) and was passaged thru +[mpox's ingest/](https://github.com/nextstrain/mpox/tree/@/ingest/). It +subsequently proliferated from [mpox][] to other pathogen repos ([rsv][], +[zika][], [dengue][], [hepatitisB][], [forecasts-ncov][]) primarily thru +copying. To [counter that +proliferation](https://bedfordlab.slack.com/archives/C7SDVPBLZ/p1688577879947079), +this repo was made. + +[mpox]: https://github.com/nextstrain/mpox +[rsv]: https://github.com/nextstrain/rsv +[zika]: https://github.com/nextstrain/zika/pull/24 +[dengue]: https://github.com/nextstrain/dengue/pull/10 +[hepatitisB]: https://github.com/nextstrain/hepatitisB +[forecasts-ncov]: https://github.com/nextstrain/forecasts-ncov + +## Elsewhere + +The creation of this repo, in both the abstract and concrete, and the general +approach to "ingest" has been discussed in various internal places, including: + +- https://github.com/nextstrain/private/issues/59 +- @joverlee521's [workflows document](https://docs.google.com/document/d/1rLWPvEuj0Ayc8MR0O1lfRJZfj9av53xU38f20g8nU_E/edit#heading=h.4g0d3mjvb89i) +- [5 July 2023 Slack thread](https://bedfordlab.slack.com/archives/C7SDVPBLZ/p1688577879947079) +- [6 July 2023 team meeting](https://docs.google.com/document/d/1FPfx-ON5RdqL2wyvODhkrCcjgOVX3nlXgBwCPhIEsco/edit) +- _…many others_ + +## Scripts + +Scripts for supporting ingest workflow automation that don’t really belong in any of our existing tools. + +- [notify-on-diff](notify-on-diff) - Send Slack message with diff of a local file and an S3 object +- [notify-on-job-fail](notify-on-job-fail) - Send Slack message with details about failed workflow job on GitHub Actions and/or AWS Batch +- [notify-on-job-start](notify-on-job-start) - Send Slack message with details about workflow job on GitHub Actions and/or AWS Batch +- [notify-on-record-change](notify-on-recod-change) - Send Slack message with details about line count changes for a file compared to an S3 object's metadata `recordcount`. + If the S3 object's metadata does not have `recordcount`, then will attempt to download S3 object to count lines locally, which only supports `xz` compressed S3 objects. +- [notify-slack](notify-slack) - Send message or file to Slack +- [s3-object-exists](s3-object-exists) - Used to prevent 404 errors during S3 file comparisons in the notify-* scripts +- [trigger](trigger) - Triggers downstream GitHub Actions via the GitHub API using repository_dispatch events. +- [trigger-on-new-data](trigger-on-new-data) - Triggers downstream GitHub Actions if the provided `upload-to-s3` outputs do not contain the `identical_file_message` + A hacky way to ensure that we only trigger downstream phylogenetic builds if the S3 objects have been updated. + +NCBI interaction scripts that are useful for fetching public metadata and sequences. + +- [fetch-from-ncbi-entrez](fetch-from-ncbi-entrez) - Fetch metadata and nucleotide sequences from [NCBI Entrez](https://www.ncbi.nlm.nih.gov/books/NBK25501/) and output to a GenBank file. + Useful for pathogens with metadata and annotations in custom fields that are not part of the standard [NCBI Datasets](https://www.ncbi.nlm.nih.gov/datasets/) outputs. + +Historically, some pathogen repos used the undocumented NCBI Virus API through [fetch-from-ncbi-virus](https://github.com/nextstrain/ingest/blob/c97df238518171c2b1574bec0349a55855d1e7a7/fetch-from-ncbi-virus) to fetch data. However we've opted to drop the NCBI Virus scripts due to https://github.com/nextstrain/ingest/issues/18. + +Potential Nextstrain CLI scripts + +- [sha256sum](sha256sum) - Used to check if files are identical in upload-to-s3 and download-from-s3 scripts. +- [cloudfront-invalidate](cloudfront-invalidate) - CloudFront invalidation is already supported in the [nextstrain remote command for S3 files](https://github.com/nextstrain/cli/blob/a5dda9c0579ece7acbd8e2c32a4bbe95df7c0bce/nextstrain/cli/remote/s3.py#L104). + This exists as a separate script to support CloudFront invalidation when using the upload-to-s3 script. +- [upload-to-s3](upload-to-s3) - Upload file to AWS S3 bucket with compression based on file extension in S3 URL. + Skips upload if the local file's hash is identical to the S3 object's metadata `sha256sum`. + Adds the following user defined metadata to uploaded S3 object: + - `sha256sum` - hash of the file generated by [sha256sum](sha256sum) + - `recordcount` - the line count of the file +- [download-from-s3](download-from-s3) - Download file from AWS S3 bucket with decompression based on file extension in S3 URL. + Skips download if the local file already exists and has a hash identical to the S3 object's metadata `sha256sum`. + +Potential augur curate scripts + +- [apply-geolocation-rules](apply-geolocation-rules) - Applies user curated geolocation rules to NDJSON records +- [merge-user-metadata](merge-user-metadata) - Merges user annotations with NDJSON records +- [transform-authors](transform-authors) - Abbreviates full author lists to ' et al.' +- [transform-field-names](transform-field-names) - Rename fields of NDJSON records +- [transform-genbank-location](transform-genbank-location) - Parses `location` field with the expected pattern `"[:][, ]"` based on [GenBank's country field](https://www.ncbi.nlm.nih.gov/genbank/collab/country/) +- [transform-strain-names](transform-strain-names) - Ordered search for strain names across several fields. + +## Software requirements + +Some scripts may require Bash ≥4. If you are running these scripts on macOS, the builtin Bash (`/bin/bash`) does not meet this requirement. You can install [Homebrew's Bash](https://formulae.brew.sh/formula/bash) which is more up to date. + +## Testing + +Most scripts are untested within this repo, relying on "testing in production". That is the only practical testing option for some scripts such as the ones interacting with S3 and Slack. + +For more locally testable scripts, Cram-style functional tests live in `tests` and are run as part of CI. To run these locally, + +1. Download Cram: `pip install cram` +2. Run the tests: `cram tests/` diff --git a/ingest/vendored/apply-geolocation-rules b/ingest/vendored/apply-geolocation-rules new file mode 100755 index 0000000..776cf16 --- /dev/null +++ b/ingest/vendored/apply-geolocation-rules @@ -0,0 +1,234 @@ +#!/usr/bin/env python3 +""" +Applies user curated geolocation rules to the geolocation fields in the NDJSON +records from stdin. The modified records are output to stdout. This does not do +any additional transformations on top of the user curations. +""" +import argparse +import json +from collections import defaultdict +from sys import exit, stderr, stdin, stdout + + +class CyclicGeolocationRulesError(Exception): + pass + + +def load_geolocation_rules(geolocation_rules_file): + """ + Loads the geolocation rules from the provided *geolocation_rules_file*. + Returns the rules as a dict: + { + regions: { + countries: { + divisions: { + locations: corrected_geolocations_tuple + } + } + } + } + """ + geolocation_rules = defaultdict(lambda: defaultdict(lambda: defaultdict(dict))) + with open(geolocation_rules_file, 'r') as rules_fh: + for line in rules_fh: + # ignore comments + if line.strip()=="" or line.lstrip()[0] == '#': + continue + + row = line.strip('\n').split('\t') + # Skip lines that cannot be split into raw and annotated geolocations + if len(row) != 2: + print( + f"WARNING: Could not decode geolocation rule {line!r}.", + "Please make sure rules are formatted as", + "'region/country/division/locationregion/country/division/location'.", + file=stderr) + continue + + # remove trailing comments + row[-1] = row[-1].partition('#')[0].rstrip() + raw , annot = tuple( row[0].split('/') ) , tuple( row[1].split('/') ) + + # Skip lines where raw or annotated geolocations cannot be split into 4 fields + if len(raw) != 4: + print( + f"WARNING: Could not decode the raw geolocation {row[0]!r}.", + "Please make sure it is formatted as 'region/country/division/location'.", + file=stderr + ) + continue + + if len(annot) != 4: + print( + f"WARNING: Could not decode the annotated geolocation {row[1]!r}.", + "Please make sure it is formatted as 'region/country/division/location'.", + file=stderr + ) + continue + + + geolocation_rules[raw[0]][raw[1]][raw[2]][raw[3]] = annot + + return geolocation_rules + + +def get_annotated_geolocation(geolocation_rules, raw_geolocation, rule_traversal = None): + """ + Gets the annotated geolocation for the *raw_geolocation* in the provided + *geolocation_rules*. + + Recursively traverses the *geolocation_rules* until we get the annotated + geolocation, which must be a Tuple. Returns `None` if there are no + applicable rules for the provided *raw_geolocation*. + + Rules are applied in the order of region, country, division, location. + First checks the provided raw values for geolocation fields, then if there + are not matches, tries to use general rules marked with '*'. + """ + # Always instantiate the rule traversal as an empty list if not provided, + # e.g. the first call of this recursive function + if rule_traversal is None: + rule_traversal = [] + + current_rules = geolocation_rules + # Traverse the geolocation rules based using the rule_traversal values + for field_value in rule_traversal: + current_rules = current_rules.get(field_value) + # If we hit `None`, then we know there are no matching rules, so stop the rule traversal + if current_rules is None: + break + + # We've found the tuple of the annotated geolocation + if isinstance(current_rules, tuple): + return current_rules + + # We've reach the next level of geolocation rules, + # so try to traverse the rules with the next target in raw_geolocation + if isinstance(current_rules, dict): + next_traversal_target = raw_geolocation[len(rule_traversal)] + rule_traversal.append(next_traversal_target) + return get_annotated_geolocation(geolocation_rules, raw_geolocation, rule_traversal) + + # We did not find any matching rule for the last traversal target + if current_rules is None: + # If we've used all general rules and we still haven't found a match, + # then there are no applicable rules for this geolocation + if all(value == '*' for value in rule_traversal): + return None + + # If we failed to find matching rule with a general rule as the last + # traversal target, then delete all trailing '*'s to reset rule_traversal + # to end with the last index that is currently NOT a '*' + # [A, *, B, *] => [A, *, B] + # [A, B, *, *] => [A, B] + # [A, *, *, *] => [A] + if rule_traversal[-1] == '*': + # Find the index of the first of the consecutive '*' from the + # end of the rule_traversal + # [A, *, B, *] => first_consecutive_general_rule_index = 3 + # [A, B, *, *] => first_consecutive_general_rule_index = 2 + # [A, *, *, *] => first_consecutive_general_rule_index = 1 + for index, field_value in reversed(list(enumerate(rule_traversal))): + if field_value == '*': + first_consecutive_general_rule_index = index + else: + break + + rule_traversal = rule_traversal[:first_consecutive_general_rule_index] + + # Set the final value to '*' in hopes that by moving to a general rule, + # we can find a matching rule. + rule_traversal[-1] = '*' + + return get_annotated_geolocation(geolocation_rules, raw_geolocation, rule_traversal) + + +def transform_geolocations(geolocation_rules, geolocation): + """ + Transform the provided *geolocation* by looking it up in the provided + *geolocation_rules*. + + This will use all rules that apply to the geolocation and rules will + be applied in the order of region, country, division, location. + + Returns the original geolocation if no geolocation rules apply. + + Raises a `CyclicGeolocationRulesError` if more than 1000 rules have + been applied to the raw geolocation. + """ + transformed_values = geolocation + rules_applied = 0 + continue_to_apply = True + + while continue_to_apply: + annotated_values = get_annotated_geolocation(geolocation_rules, transformed_values) + + # Stop applying rules if no annotated values were found + if annotated_values is None: + continue_to_apply = False + else: + rules_applied += 1 + + if rules_applied > 1000: + raise CyclicGeolocationRulesError( + "ERROR: More than 1000 geolocation rules applied on the same entry {geolocation!r}." + ) + + # Create a new list of values for comparison to previous values + new_values = list(transformed_values) + for index, value in enumerate(annotated_values): + # Keep original value if annotated value is '*' + if value != '*': + new_values[index] = value + + # Stop applying rules if this rule did not change the values, + # since this means we've reach rules with '*' that no longer change values + if new_values == transformed_values: + continue_to_apply = False + + transformed_values = new_values + + return transformed_values + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--region-field", default="region", + help="Field that contains regions in NDJSON records.") + parser.add_argument("--country-field", default="country", + help="Field that contains countries in NDJSON records.") + parser.add_argument("--division-field", default="division", + help="Field that contains divisions in NDJSON records.") + parser.add_argument("--location-field", default="location", + help="Field that contains location in NDJSON records.") + parser.add_argument("--geolocation-rules", metavar="TSV", required=True, + help="TSV file of geolocation rules with the format: " + + "'' where the raw and annotated geolocations " + + "are formatted as '///'. " + + "If creating a general rule, then the raw field value can be substituted with '*'." + + "Lines starting with '#' will be ignored as comments." + + "Trailing '#' will be ignored as comments.") + + args = parser.parse_args() + + location_fields = [args.region_field, args.country_field, args.division_field, args.location_field] + + geolocation_rules = load_geolocation_rules(args.geolocation_rules) + + for record in stdin: + record = json.loads(record) + + try: + annotated_values = transform_geolocations(geolocation_rules, [record.get(field, '') for field in location_fields]) + except CyclicGeolocationRulesError as e: + print(e, file=stderr) + exit(1) + + for index, field in enumerate(location_fields): + record[field] = annotated_values[index] + + json.dump(record, stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/vendored/cloudfront-invalidate b/ingest/vendored/cloudfront-invalidate new file mode 100755 index 0000000..dbea398 --- /dev/null +++ b/ingest/vendored/cloudfront-invalidate @@ -0,0 +1,42 @@ +#!/usr/bin/env bash +# Originally from @tsibley's gist: https://gist.github.com/tsibley/a66262d341dedbea39b02f27e2837ea8 +set -euo pipefail + +main() { + local domain="$1" + shift + local paths=("$@") + local distribution invalidation + + echo "-> Finding CloudFront distribution" + distribution=$( + aws cloudfront list-distributions \ + --query "DistributionList.Items[?contains(Aliases.Items, \`$domain\`)] | [0].Id" \ + --output text + ) + + if [[ -z $distribution || $distribution == None ]]; then + exec >&2 + echo "Unable to find CloudFront distribution id for $domain" + echo + echo "Are your AWS CLI credentials for the right account?" + exit 1 + fi + + echo "-> Creating CloudFront invalidation for distribution $distribution" + invalidation=$( + aws cloudfront create-invalidation \ + --distribution-id "$distribution" \ + --paths "${paths[@]}" \ + --query Invalidation.Id \ + --output text + ) + + echo "-> Waiting for CloudFront invalidation $invalidation to complete" + echo " Ctrl-C to stop waiting." + aws cloudfront wait invalidation-completed \ + --distribution-id "$distribution" \ + --id "$invalidation" +} + +main "$@" diff --git a/ingest/vendored/download-from-s3 b/ingest/vendored/download-from-s3 new file mode 100755 index 0000000..4981186 --- /dev/null +++ b/ingest/vendored/download-from-s3 @@ -0,0 +1,48 @@ +#!/usr/bin/env bash +set -euo pipefail + +bin="$(dirname "$0")" + +main() { + local src="${1:?A source s3:// URL is required as the first argument.}" + local dst="${2:?A destination file path is required as the second argument.}" + # How many lines to subsample to. 0 means no subsampling. Optional. + # It is not advised to use this for actual subsampling! This is intended to be + # used for debugging workflows with large datasets such as ncov-ingest as + # described in https://github.com/nextstrain/ncov-ingest/pull/367 + + # Uses `tsv-sample` to subsample, so it will not work as expected with files + # that have a single record split across multiple lines (i.e. FASTA sequences) + local n="${3:-0}" + + local s3path="${src#s3://}" + local bucket="${s3path%%/*}" + local key="${s3path#*/}" + + local src_hash dst_hash no_hash=0000000000000000000000000000000000000000000000000000000000000000 + dst_hash="$("$bin/sha256sum" < "$dst" || true)" + src_hash="$(aws s3api head-object --bucket "$bucket" --key "$key" --query Metadata.sha256sum --output text 2>/dev/null || echo "$no_hash")" + + echo "[ INFO] Downloading $src → $dst" + if [[ $src_hash != "$dst_hash" ]]; then + aws s3 cp --no-progress "$src" - | + if [[ "$src" == *.gz ]]; then + gunzip -cfq + elif [[ "$src" == *.xz ]]; then + xz -T0 -dcq + elif [[ "$src" == *.zst ]]; then + zstd -T0 -dcq + else + cat + fi | + if [[ "$n" -gt 0 ]]; then + tsv-sample -H -i -n "$n" + else + cat + fi >"$dst" + else + echo "[ INFO] Files are identical, skipping download" + fi +} + +main "$@" diff --git a/ingest/vendored/fetch-from-ncbi-entrez b/ingest/vendored/fetch-from-ncbi-entrez new file mode 100755 index 0000000..194a0c8 --- /dev/null +++ b/ingest/vendored/fetch-from-ncbi-entrez @@ -0,0 +1,70 @@ +#!/usr/bin/env python3 +""" +Fetch metadata and nucleotide sequences from NCBI Entrez and output to a GenBank file. +""" +import json +import argparse +from Bio import SeqIO, Entrez + +# To use the efetch API, the docs indicate only around 10,000 records should be fetched per request +# https://www.ncbi.nlm.nih.gov/books/NBK25499/#chapter4.EFetch +# However, in my testing with HepB, the max records returned was 9,999 +# - Jover, 16 August 2023 +BATCH_SIZE = 9999 + +Entrez.email = "hello@nextstrain.org" + +def parse_args(): + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument('--term', required=True, type=str, + help='Genbank search term. Replace spaces with "+", e.g. "Hepatitis+B+virus[All+Fields]complete+genome[All+Fields]"') + parser.add_argument('--output', required=True, type=str, help='Output file (Genbank)') + return parser.parse_args() + + +def get_esearch_history(term): + """ + Search for the provided *term* via ESearch and store the results using the + Entrez history server.¹ + + Returns the total count of returned records, query key, and web env needed + to access the records from the server. + + ¹ https://www.ncbi.nlm.nih.gov/books/NBK25497/#chapter2.Using_the_Entrez_History_Server + """ + handle = Entrez.esearch(db="nucleotide", term=term, retmode="json", usehistory="y", retmax=0) + esearch_result = json.loads(handle.read())['esearchresult'] + print(f"Search term {term!r} returned {esearch_result['count']} IDs.") + return { + "count": int(esearch_result["count"]), + "query_key": esearch_result["querykey"], + "web_env": esearch_result["webenv"] + } + + +def fetch_from_esearch_history(count, query_key, web_env): + """ + Fetch records in batches from Entrez history server using the provided + *query_key* and *web_env* and yields them as a BioPython SeqRecord iterator. + """ + print(f"Fetching GenBank records in batches of n={BATCH_SIZE}") + + for start in range(0, count, BATCH_SIZE): + handle = Entrez.efetch( + db="nucleotide", + query_key=query_key, + webenv=web_env, + retstart=start, + retmax=BATCH_SIZE, + rettype="gb", + retmode="text") + + yield SeqIO.parse(handle, "genbank") + + +if __name__=="__main__": + args = parse_args() + + with open(args.output, "w") as output_handle: + for batch_results in fetch_from_esearch_history(**get_esearch_history(args.term)): + SeqIO.write(batch_results, output_handle, "genbank") diff --git a/ingest/vendored/merge-user-metadata b/ingest/vendored/merge-user-metadata new file mode 100755 index 0000000..341c2df --- /dev/null +++ b/ingest/vendored/merge-user-metadata @@ -0,0 +1,55 @@ +#!/usr/bin/env python3 +""" +Merges user curated annotations with the NDJSON records from stdin, with the user +curations overwriting the existing fields. The modified records are output +to stdout. This does not do any additional transformations on top of the user +curations. +""" +import argparse +import csv +import json +from collections import defaultdict +from sys import exit, stdin, stderr, stdout + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--annotations", metavar="TSV", required=True, + help="Manually curated annotations TSV file. " + + "The TSV should not have a header and should have exactly three columns: " + + "id to match existing metadata, field name, and field value. " + + "If there are multiple annotations for the same id and field, then the last value is used. " + + "Lines starting with '#' are treated as comments. " + + "Any '#' after the field value are treated as comments.") + parser.add_argument("--id-field", default="accession", + help="The ID field in the metadata to use to merge with the annotations.") + + args = parser.parse_args() + + annotations = defaultdict(dict) + with open(args.annotations, 'r') as annotations_fh: + csv_reader = csv.reader(annotations_fh, delimiter='\t') + for row in csv_reader: + if not row or row[0].lstrip()[0] == '#': + continue + elif len(row) != 3: + print("WARNING: Could not decode annotation line " + "\t".join(row), file=stderr) + continue + id, field, value = row + annotations[id][field] = value.partition('#')[0].rstrip() + + for record in stdin: + record = json.loads(record) + + record_id = record.get(args.id_field) + if record_id is None: + print(f"ERROR: ID field {args.id_field!r} does not exist in record", file=stderr) + exit(1) + + record.update(annotations.get(record_id, {})) + + json.dump(record, stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/vendored/notify-on-diff b/ingest/vendored/notify-on-diff new file mode 100755 index 0000000..ddbe7da --- /dev/null +++ b/ingest/vendored/notify-on-diff @@ -0,0 +1,35 @@ +#!/usr/bin/env bash + +set -euo pipefail + +: "${SLACK_TOKEN:?The SLACK_TOKEN environment variable is required.}" +: "${SLACK_CHANNELS:?The SLACK_CHANNELS environment variable is required.}" + +bin="$(dirname "$0")" + +src="${1:?A source file is required as the first argument.}" +dst="${2:?A destination s3:// URL is required as the second argument.}" + +dst_local="$(mktemp -t s3-file-XXXXXX)" +diff="$(mktemp -t diff-XXXXXX)" + +trap "rm -f '$dst_local' '$diff'" EXIT + +# if the file is not already present, just exit +"$bin"/s3-object-exists "$dst" || exit 0 + +"$bin"/download-from-s3 "$dst" "$dst_local" + +# diff's exit code is 0 for no differences, 1 for differences found, and >1 for errors +diff_exit_code=0 +diff "$dst_local" "$src" > "$diff" || diff_exit_code=$? + +if [[ "$diff_exit_code" -eq 1 ]]; then + echo "Notifying Slack about diff." + "$bin"/notify-slack --upload "$src.diff" < "$diff" +elif [[ "$diff_exit_code" -gt 1 ]]; then + echo "Notifying Slack about diff failure" + "$bin"/notify-slack "Diff failed for $src" +else + echo "No change in $src." +fi diff --git a/ingest/vendored/notify-on-job-fail b/ingest/vendored/notify-on-job-fail new file mode 100755 index 0000000..7dd2409 --- /dev/null +++ b/ingest/vendored/notify-on-job-fail @@ -0,0 +1,23 @@ +#!/usr/bin/env bash +set -euo pipefail + +: "${SLACK_TOKEN:?The SLACK_TOKEN environment variable is required.}" +: "${SLACK_CHANNELS:?The SLACK_CHANNELS environment variable is required.}" + +: "${AWS_BATCH_JOB_ID:=}" +: "${GITHUB_RUN_ID:=}" + +bin="$(dirname "$0")" +job_name="${1:?A job name is required as the first argument}" +github_repo="${2:?A GitHub repository with owner and repository name is required as the second argument}" + +echo "Notifying Slack about failed ${job_name} job." +message="❌ ${job_name} job has FAILED 😞 " + +if [[ -n "${AWS_BATCH_JOB_ID}" ]]; then + message+="See AWS Batch job \`${AWS_BATCH_JOB_ID}\` () for error details. " +elif [[ -n "${GITHUB_RUN_ID}" ]]; then + message+="See GitHub Action for error details. " +fi + +"$bin"/notify-slack "$message" diff --git a/ingest/vendored/notify-on-job-start b/ingest/vendored/notify-on-job-start new file mode 100755 index 0000000..1c8ce7d --- /dev/null +++ b/ingest/vendored/notify-on-job-start @@ -0,0 +1,27 @@ +#!/usr/bin/env bash +set -euo pipefail + +: "${SLACK_TOKEN:?The SLACK_TOKEN environment variable is required.}" +: "${SLACK_CHANNELS:?The SLACK_CHANNELS environment variable is required.}" + +: "${AWS_BATCH_JOB_ID:=}" +: "${GITHUB_RUN_ID:=}" + +bin="$(dirname "$0")" +job_name="${1:?A job name is required as the first argument}" +github_repo="${2:?A GitHub repository with owner and repository name is required as the second argument}" +build_dir="${3:-ingest}" + +echo "Notifying Slack about started ${job_name} job." +message="${job_name} job has started." + +if [[ -n "${GITHUB_RUN_ID}" ]]; then + message+=" The job was submitted by GitHub Action ." +fi + +if [[ -n "${AWS_BATCH_JOB_ID}" ]]; then + message+=" The job was launched as AWS Batch job \`${AWS_BATCH_JOB_ID}\` ()." + message+=" Follow along in your local clone of ${github_repo} with: "'```'"nextstrain build --aws-batch --no-download --attach ${AWS_BATCH_JOB_ID} ${build_dir}"'```' +fi + +"$bin"/notify-slack "$message" diff --git a/ingest/vendored/notify-on-record-change b/ingest/vendored/notify-on-record-change new file mode 100755 index 0000000..f424252 --- /dev/null +++ b/ingest/vendored/notify-on-record-change @@ -0,0 +1,53 @@ +#!/usr/bin/env bash +set -euo pipefail + +: "${SLACK_TOKEN:?The SLACK_TOKEN environment variable is required.}" +: "${SLACK_CHANNELS:?The SLACK_CHANNELS environment variable is required.}" + +bin="$(dirname "$0")" + +src="${1:?A source ndjson file is required as the first argument.}" +dst="${2:?A destination ndjson s3:// URL is required as the second argument.}" +source_name=${3:?A record source name is required as the third argument.} + +# if the file is not already present, just exit +"$bin"/s3-object-exists "$dst" || exit 0 + +s3path="${dst#s3://}" +bucket="${s3path%%/*}" +key="${s3path#*/}" + +src_record_count="$(wc -l < "$src")" + +# Try getting record count from S3 object metadata +dst_record_count="$(aws s3api head-object --bucket "$bucket" --key "$key" --query "Metadata.recordcount || ''" --output text 2>/dev/null || true)" +if [[ -z "$dst_record_count" ]]; then + # This object doesn't have the record count stored as metadata + # We have to download it and count the lines locally + dst_record_count="$(wc -l < <(aws s3 cp --no-progress "$dst" - | xz -T0 -dcfq))" +fi + +added_records="$(( src_record_count - dst_record_count ))" + +printf "%'4d %s\n" "$src_record_count" "$src" +printf "%'4d %s\n" "$dst_record_count" "$dst" +printf "%'4d added records\n" "$added_records" + +slack_message="" + +if [[ $added_records -gt 0 ]]; then + echo "Notifying Slack about added records (n=$added_records)" + slack_message="📈 New records (n=$added_records) found on $source_name." + +elif [[ $added_records -lt 0 ]]; then + echo "Notifying Slack about fewer records (n=$added_records)" + slack_message="📉 Fewer records (n=$added_records) found on $source_name." + +else + echo "Notifying Slack about same number of records" + slack_message="⛔ No new records found on $source_name." +fi + +slack_message+=" (Total record count: $src_record_count)" + +"$bin"/notify-slack "$slack_message" diff --git a/ingest/vendored/notify-slack b/ingest/vendored/notify-slack new file mode 100755 index 0000000..a343435 --- /dev/null +++ b/ingest/vendored/notify-slack @@ -0,0 +1,56 @@ +#!/usr/bin/env bash +set -euo pipefail + +: "${SLACK_TOKEN:?The SLACK_TOKEN environment variable is required.}" +: "${SLACK_CHANNELS:?The SLACK_CHANNELS environment variable is required.}" + +upload=0 +output=/dev/null +thread_ts="" +broadcast=0 +args=() + +for arg; do + case "$arg" in + --upload) + upload=1;; + --output=*) + output="${arg#*=}";; + --thread-ts=*) + thread_ts="${arg#*=}";; + --broadcast) + broadcast=1;; + *) + args+=("$arg");; + esac +done + +set -- "${args[@]}" + +text="${1:?Some message text is required.}" + +if [[ "$upload" == 1 ]]; then + echo "Uploading data to Slack with the message: $text" + curl https://slack.com/api/files.upload \ + --header "Authorization: Bearer $SLACK_TOKEN" \ + --form-string channels="$SLACK_CHANNELS" \ + --form-string title="$text" \ + --form-string filename="$text" \ + --form-string thread_ts="$thread_ts" \ + --form file=@/dev/stdin \ + --form filetype=text \ + --fail --silent --show-error \ + --http1.1 \ + --output "$output" +else + echo "Posting Slack message: $text" + curl https://slack.com/api/chat.postMessage \ + --header "Authorization: Bearer $SLACK_TOKEN" \ + --form-string channel="$SLACK_CHANNELS" \ + --form-string text="$text" \ + --form-string thread_ts="$thread_ts" \ + --form-string reply_broadcast="$broadcast" \ + --fail --silent --show-error \ + --http1.1 \ + --output "$output" +fi diff --git a/ingest/vendored/s3-object-exists b/ingest/vendored/s3-object-exists new file mode 100755 index 0000000..679c20a --- /dev/null +++ b/ingest/vendored/s3-object-exists @@ -0,0 +1,8 @@ +#!/usr/bin/env bash +set -euo pipefail + +url="${1#s3://}" +bucket="${url%%/*}" +key="${url#*/}" + +aws s3api head-object --bucket "$bucket" --key "$key" &>/dev/null diff --git a/ingest/vendored/sha256sum b/ingest/vendored/sha256sum new file mode 100755 index 0000000..32d7ef8 --- /dev/null +++ b/ingest/vendored/sha256sum @@ -0,0 +1,15 @@ +#!/usr/bin/env python3 +""" +Portable sha256sum utility. +""" +from hashlib import sha256 +from sys import stdin + +chunk_size = 5 * 1024**2 # 5 MiB + +h = sha256() + +for chunk in iter(lambda: stdin.buffer.read(chunk_size), b""): + h.update(chunk) + +print(h.hexdigest()) diff --git a/ingest/vendored/tests/transform-strain-names/transform-strain-names.t b/ingest/vendored/tests/transform-strain-names/transform-strain-names.t new file mode 100644 index 0000000..1c05df7 --- /dev/null +++ b/ingest/vendored/tests/transform-strain-names/transform-strain-names.t @@ -0,0 +1,17 @@ +Look for strain name in "strain" or a list of backup fields. + +If strain entry exists, do not do anything. + + $ echo '{"strain": "i/am/a/strain", "strain_s": "other"}' \ + > | $TESTDIR/../../transform-strain-names \ + > --strain-regex '^.+$' \ + > --backup-fields strain_s accession + {"strain":"i/am/a/strain","strain_s":"other"} + +If strain entry does not exists, search the backup fields + + $ echo '{"strain_s": "other"}' \ + > | $TESTDIR/../../transform-strain-names \ + > --strain-regex '^.+$' \ + > --backup-fields accession strain_s + {"strain_s":"other","strain":"other"} \ No newline at end of file diff --git a/ingest/vendored/transform-authors b/ingest/vendored/transform-authors new file mode 100755 index 0000000..0bade20 --- /dev/null +++ b/ingest/vendored/transform-authors @@ -0,0 +1,66 @@ +#!/usr/bin/env python3 +""" +Abbreviates a full list of authors to be ' et al.' of the NDJSON +record from stdin and outputs modified records to stdout. + +Note: This is a "best effort" approach and can potentially mangle the author name. +""" +import argparse +import json +import re +from sys import stderr, stdin, stdout + + +def parse_authors(record: dict, authors_field: str, default_value: str, + index: int, abbr_authors_field: str = None) -> dict: + # Strip and normalize whitespace + new_authors = re.sub(r'\s+', ' ', record[authors_field]) + + if new_authors == "": + new_authors = default_value + else: + # Split authors list on comma/semicolon + # OR "and"/"&" with at least one space before and after + new_authors = re.split(r'(?:\s*[,，;；]\s*|\s+(?:and|&)\s+)', new_authors)[0] + + # if it does not already end with " et al.", add it + if not new_authors.strip('. ').endswith(" et al"): + new_authors += ' et al' + + if abbr_authors_field: + if record.get(abbr_authors_field): + print( + f"WARNING: the {abbr_authors_field!r} field already exists", + f"in record {index} and will be overwritten!", + file=stderr + ) + + record[abbr_authors_field] = new_authors + else: + record[authors_field] = new_authors + + return record + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--authors-field", default="authors", + help="The field containing list of authors.") + parser.add_argument("--default-value", default="?", + help="Default value to use if authors list is empty.") + parser.add_argument("--abbr-authors-field", + help="The field for the generated abbreviated authors. " + + "If not provided, the original authors field will be modified.") + + args = parser.parse_args() + + for index, record in enumerate(stdin): + record = json.loads(record) + + parse_authors(record, args.authors_field, args.default_value, index, args.abbr_authors_field) + + json.dump(record, stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/vendored/transform-field-names b/ingest/vendored/transform-field-names new file mode 100755 index 0000000..fde223f --- /dev/null +++ b/ingest/vendored/transform-field-names @@ -0,0 +1,48 @@ +#!/usr/bin/env python3 +""" +Renames fields of the NDJSON record from stdin and outputs modified records +to stdout. +""" +import argparse +import json +from sys import stderr, stdin, stdout + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--field-map", nargs="+", + help="Fields names in the NDJSON record mapped to new field names, " + + "formatted as '{old_field_name}={new_field_name}'. " + + "If the old field does not exist in record, the new field will be added with an empty string value." + + "If the new field already exists in record, then the renaming of the old field will be skipped.") + parser.add_argument("--force", action="store_true", + help="Force renaming of old field even if the new field already exists. " + + "Please keep in mind this will overwrite the value of the new field.") + + args = parser.parse_args() + + field_map = {} + for field in args.field_map: + old_name, new_name = field.split('=') + field_map[old_name] = new_name + + for record in stdin: + record = json.loads(record) + + for old_field, new_field in field_map.items(): + + if record.get(new_field) and not args.force: + print( + f"WARNING: skipping rename of {old_field} because record", + f"already has a field named {new_field}.", + file=stderr + ) + continue + + record[new_field] = record.pop(old_field, '') + + json.dump(record, stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/vendored/transform-genbank-location b/ingest/vendored/transform-genbank-location new file mode 100755 index 0000000..70ba56f --- /dev/null +++ b/ingest/vendored/transform-genbank-location @@ -0,0 +1,43 @@ +#!/usr/bin/env python3 +""" +Parses GenBank's 'location' field of the NDJSON record from stdin to 3 separate +fields: 'country', 'division', and 'location'. Checks that a record is from +GenBank by verifying that the 'database' field has a value of "GenBank" or "RefSeq". + +Outputs the modified record to stdout. +""" +import json +from sys import stdin, stdout + + +def parse_location(record: dict) -> dict: + # Expected pattern for the location field is "[:][, ]" + # See GenBank docs for their "country" field: + # https://www.ncbi.nlm.nih.gov/genbank/collab/country/ + geographic_data = record['location'].split(':') + + country = geographic_data[0] + division = '' + location = '' + + if len(geographic_data) == 2: + division , _ , location = geographic_data[1].partition(',') + + record['country'] = country.strip() + record['division'] = division.strip() + record['location'] = location.strip() + + return record + + +if __name__ == '__main__': + + for record in stdin: + record = json.loads(record) + + database = record.get('database', '') + if database in {'GenBank', 'RefSeq'}: + parse_location(record) + + json.dump(record, stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/vendored/transform-strain-names b/ingest/vendored/transform-strain-names new file mode 100755 index 0000000..d86c0e4 --- /dev/null +++ b/ingest/vendored/transform-strain-names @@ -0,0 +1,50 @@ +#!/usr/bin/env python3 +""" +Verifies strain name pattern in the 'strain' field of the NDJSON record from +stdin. Adds a 'strain' field to the record if it does not already exist. + +Outputs the modified records to stdout. +""" +import argparse +import json +import re +from sys import stderr, stdin, stdout + + +if __name__ == '__main__': + parser = argparse.ArgumentParser( + description=__doc__, + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + parser.add_argument("--strain-regex", default="^.+$", + help="Regex pattern for strain names. " + + "Strain names that do not match the pattern will be dropped.") + parser.add_argument("--backup-fields", nargs="*", + help="List of backup fields to use as strain name if the value in 'strain' " + + "does not match the strain regex pattern. " + + "If multiple fields are provided, will use the first field that has a non-empty string.") + + args = parser.parse_args() + + strain_name_pattern = re.compile(args.strain_regex) + + for index, record in enumerate(stdin): + record = json.loads(record) + + # Verify strain name matches the strain regex pattern + if strain_name_pattern.match(record.get('strain', '')) is None: + # Default to empty string if not matching pattern + record['strain'] = '' + # Use non-empty value of backup fields if provided + if args.backup_fields: + for field in args.backup_fields: + if record.get(field): + record['strain'] = str(record[field]) + break + + if record['strain'] == '': + print(f"WARNING: Record number {index} has an empty string as the strain name.", file=stderr) + + + json.dump(record, stdout, allow_nan=False, indent=None, separators=',:') + print() diff --git a/ingest/vendored/trigger b/ingest/vendored/trigger new file mode 100755 index 0000000..586f9cc --- /dev/null +++ b/ingest/vendored/trigger @@ -0,0 +1,56 @@ +#!/usr/bin/env bash +set -euo pipefail + +: "${PAT_GITHUB_DISPATCH:=}" + +github_repo="${1:?A GitHub repository with owner and repository name is required as the first argument.}" +event_type="${2:?An event type is required as the second argument.}" +shift 2 + +if [[ $# -eq 0 && -z $PAT_GITHUB_DISPATCH ]]; then + cat >&2 <<. +You must specify options to curl for your GitHub credentials. For example, you +can specify your GitHub username, and will be prompted for your password: + + $0 $github_repo $event_type --user + +Be sure to enter a personal access token¹ as your password since GitHub has +discontinued password authentication to the API starting on November 13, 2020². + +You can also store your credentials or a personal access token in a netrc +file³: + + machine api.github.com + login + password + +and then tell curl to use it: + + $0 $github_repo $event_type --netrc + +which will then not require you to type your password every time. + +¹ https://help.github.com/en/github/authenticating-to-github/creating-a-personal-access-token-for-the-command-line +² https://docs.github.com/en/rest/overview/other-authentication-methods#via-username-and-password +³ https://ec.haxx.se/usingcurl/usingcurl-netrc +. + exit 1 +fi + +auth=':' +if [[ -n $PAT_GITHUB_DISPATCH ]]; then + auth="Authorization: Bearer ${PAT_GITHUB_DISPATCH}" +fi + +if curl -fsS "https://api.github.com/repos/${github_repo}/dispatches" \ + -H 'Accept: application/vnd.github.v3+json' \ + -H 'Content-Type: application/json' \ + -H "$auth" \ + -d '{"event_type":"'"$event_type"'"}' \ + "$@" +then + echo "Successfully triggered $event_type" +else + echo "Request failed" >&2 + exit 1 +fi diff --git a/ingest/vendored/trigger-on-new-data b/ingest/vendored/trigger-on-new-data new file mode 100755 index 0000000..470d2f4 --- /dev/null +++ b/ingest/vendored/trigger-on-new-data @@ -0,0 +1,32 @@ +#!/usr/bin/env bash +set -euo pipefail + +: "${PAT_GITHUB_DISPATCH:?The PAT_GITHUB_DISPATCH environment variable is required.}" + +bin="$(dirname "$0")" + +github_repo="${1:?A GitHub repository with owner and repository name is required as the first argument.}" +event_type="${2:?An event type is required as the second argument.}" +metadata="${3:?A metadata upload output file is required as the third argument.}" +sequences="${4:?An sequence FASTA upload output file is required as the fourth argument.}" +identical_file_message="${5:-files are identical}" + +new_metadata=$(grep "$identical_file_message" "$metadata" >/dev/null; echo $?) +new_sequences=$(grep "$identical_file_message" "$sequences" >/dev/null; echo $?) + +slack_message="" + +# grep exit status 0 for found match, 1 for no match, 2 if an error occurred +if [[ $new_metadata -eq 1 || $new_sequences -eq 1 ]]; then + slack_message="Triggering new builds due to updated metadata and/or sequences" + "$bin"/trigger "$github_repo" "$event_type" +elif [[ $new_metadata -eq 0 && $new_sequences -eq 0 ]]; then + slack_message="Skipping trigger of rebuild: Both metadata TSV and sequences FASTA are identical to S3 files." +else + slack_message="Skipping trigger of rebuild: Unable to determine if data has been updated." +fi + + +if ! "$bin"/notify-slack "$slack_message"; then + echo "Notifying Slack failed, but exiting with success anyway." +fi diff --git a/ingest/vendored/upload-to-s3 b/ingest/vendored/upload-to-s3 new file mode 100755 index 0000000..36d171c --- /dev/null +++ b/ingest/vendored/upload-to-s3 @@ -0,0 +1,78 @@ +#!/usr/bin/env bash +set -euo pipefail + +bin="$(dirname "$0")" + +main() { + local quiet=0 + + for arg; do + case "$arg" in + --quiet) + quiet=1 + shift;; + *) + break;; + esac + done + + local src="${1:?A source file is required as the first argument.}" + local dst="${2:?A destination s3:// URL is required as the second argument.}" + local cloudfront_domain="${3:-}" + + local s3path="${dst#s3://}" + local bucket="${s3path%%/*}" + local key="${s3path#*/}" + + local src_hash dst_hash no_hash=0000000000000000000000000000000000000000000000000000000000000000 + src_hash="$("$bin/sha256sum" < "$src")" + dst_hash="$(aws s3api head-object --bucket "$bucket" --key "$key" --query Metadata.sha256sum --output text 2>/dev/null || echo "$no_hash")" + + if [[ $src_hash != "$dst_hash" ]]; then + # The record count may have changed + src_record_count="$(wc -l < "$src")" + + echo "Uploading $src → $dst" + if [[ "$dst" == *.gz ]]; then + gzip -c "$src" + elif [[ "$dst" == *.xz ]]; then + xz -2 -T0 -c "$src" + elif [[ "$dst" == *.zst ]]; then + zstd -T0 -c "$src" + else + cat "$src" + fi | aws s3 cp --no-progress - "$dst" --metadata sha256sum="$src_hash",recordcount="$src_record_count" "$(content-type "$dst")" + + if [[ -n $cloudfront_domain ]]; then + echo "Creating CloudFront invalidation for $cloudfront_domain/$key" + if ! "$bin"/cloudfront-invalidate "$cloudfront_domain" "/$key"; then + echo "CloudFront invalidation failed, but exiting with success anyway." + fi + fi + + if [[ $quiet == 1 ]]; then + echo "Quiet mode. No Slack notification sent." + exit 0 + fi + + if ! "$bin"/notify-slack "Updated $dst available."; then + echo "Notifying Slack failed, but exiting with success anyway." + fi + else + echo "Uploading $src → $dst: files are identical, skipping upload" + fi +} + +content-type() { + case "$1" in + *.tsv) echo --content-type=text/tab-separated-values;; + *.csv) echo --content-type=text/comma-separated-values;; + *.ndjson) echo --content-type=application/x-ndjson;; + *.gz) echo --content-type=application/gzip;; + *.xz) echo --content-type=application/x-xz;; + *.zst) echo --content-type=application/zstd;; + *) echo --content-type=text/plain;; + esac +} + +main "$@" diff --git a/phylogenetic/README.md b/phylogenetic/README.md new file mode 100644 index 0000000..5d831e7 --- /dev/null +++ b/phylogenetic/README.md @@ -0,0 +1,53 @@ +# nextstrain.org/zika + +This is the [Nextstrain](https://nextstrain.org) build for Zika, visible at +[nextstrain.org/zika](https://nextstrain.org/zika). + +## Software requirements + +Follow the [standard installation instructions](https://docs.nextstrain.org/en/latest/install.html) for Nextstrain's suite of software tools. + +## Usage + +If you're unfamiliar with Nextstrain builds, you may want to follow our +[Running a Pathogen Workflow guide][] first and then come back here. + +The easiest way to run this pathogen build is using the Nextstrain +command-line tool: + + nextstrain build . + +Build output goes into the directories `data/`, `results/` and `auspice/`. + +Once you've run the build, you can view the results in auspice: + + nextstrain view auspice/ + +## Configuration + +Configuration takes place entirely with the `Snakefile`. This can be read top-to-bottom, each rule +specifies its file inputs and output and also its parameters. There is little redirection and each +rule should be able to be reasoned with on its own. + +### Using GenBank data + +This build starts by pulling preprocessed sequence and metadata files from: + +* https://data.nextstrain.org/files/zika/sequences.fasta.zst +* https://data.nextstrain.org/files/zika/metadata.tsv.zst + +The above datasets have been preprocessed and cleaned from GenBank and are updated at regular intervals. + +### Using example data + +Alternatively, you can run the build using the +example data provided in this repository. To run the build by copying the +example sequences into the `data/` directory, use the following: + + nextstrain build . --configfile profiles/ci/profiles_config.yaml + +[Nextstrain]: https://nextstrain.org +[augur]: https://docs.nextstrain.org/projects/augur/en/stable/ +[auspice]: https://docs.nextstrain.org/projects/auspice/en/stable/index.html +[Installing Nextstrain guide]: https://docs.nextstrain.org/en/latest/install.html +[Running a Pathogen Workflow guide]: https://docs.nextstrain.org/en/latest/tutorials/running-a-workflow.html diff --git a/phylogenetic/Snakefile b/phylogenetic/Snakefile new file mode 100644 index 0000000..d40f00e --- /dev/null +++ b/phylogenetic/Snakefile @@ -0,0 +1,26 @@ +configfile: "config/config_zika.yaml" + +rule all: + input: + auspice_json = "auspice/zika.json", + +include: "rules/usvi.smk" +include: "rules/prepare_sequences.smk" +include: "rules/construct_phylogeny.smk" +include: "rules/annotate_phylogeny.smk" +include: "rules/export.smk" + +# Include custom rules defined in the config. +if "custom_rules" in config: + for rule_file in config["custom_rules"]: + + include: rule_file + +rule clean: + """Removing directories: {params}""" + params: + "data ", + "results ", + "auspice" + shell: + "rm -rfv {params}" diff --git a/config/auspice_config.json b/phylogenetic/config/auspice_config.json similarity index 100% rename from config/auspice_config.json rename to phylogenetic/config/auspice_config.json diff --git a/config/colors.tsv b/phylogenetic/config/colors.tsv similarity index 100% rename from config/colors.tsv rename to phylogenetic/config/colors.tsv diff --git a/phylogenetic/config/config_zika.yaml b/phylogenetic/config/config_zika.yaml new file mode 100644 index 0000000..fa4e134 --- /dev/null +++ b/phylogenetic/config/config_zika.yaml @@ -0,0 +1,2 @@ +strain_id_field: "accession" +display_strain_field: "strain" \ No newline at end of file diff --git a/config/description.md b/phylogenetic/config/description.md similarity index 100% rename from config/description.md rename to phylogenetic/config/description.md diff --git a/phylogenetic/config/dropped_strains.txt b/phylogenetic/config/dropped_strains.txt new file mode 100644 index 0000000..746e1ba --- /dev/null +++ b/phylogenetic/config/dropped_strains.txt @@ -0,0 +1,87 @@ +MG827392 +KX369547 # PF13/251013_18 # reference included in config/zika_reference.gb +KY553111 # AFMC_U # too basal +KY962729 # AFMC_S # too basal +KY120353 # Boracay/16423 # too basal +KU179098 # JMB_185 # too basal +KU681082 # PHL/2012/CPC_0740 # too basal +VIE/Bra/2016 # too basal +KU853013 # Dominican_Republic/2016/PD2 # duplicate of other strain in dataset +KU740184 # GD01 # duplicate of other strain in dataset +KU761564 # GDZ16001 # duplicate of other strain in dataset +KX893855 # VEN/UF_2/2016 # duplicate of other strain in dataset +KY927808 # ZZ_1 # duplicate of other strain in dataset +KY003154 # VR10599/Pavia/2016 # export with unknown origin +KY003153 # 34997/Pavia/2016 # export with unknown origin +MF574552 # COL/FLR_00001/2015 # duplicate of COL/FLR/2015 +MF574559 # COL/FLR_00002/2015 # duplicate of COL/FLR/2015 +MF574560 # COL/FLR_00003/2015 # duplicate of COL/FLR/2015 +MF574561 # COL/FLR_00004/2015 # duplicate of COL/FLR/2015 +MF574571 # COL/FLR_00005/2015 # duplicate of COL/FLR/2015 +MF574555 # COL/FLR_00006/2015 # duplicate of COL/FLR/2015 +MF574557 # COL/FLR_00007/2015 # duplicate of COL/FLR/2015 +MF574562 # COL/FLR_00008/2015 # duplicate of COL/FLR/2015 +MF574572 # COL/FLR_00009/2015 # duplicate of COL/FLR/2015 +MF574570 # COL/FLR_00010/2015 # duplicate of COL/FLR/2015 +MF574565 # COL/FLR_00011/2015 # duplicate of COL/FLR/2015 +MF574568 # COL/FLR_00012/2015 # duplicate of COL/FLR/2015 +MF574558 # COL/FLR_00013/2015 # duplicate of COL/FLR/2015 +MF574576 # COL/FLR_00014/2015 # duplicate of COL/FLR/2015 +MF574567 # COL/FLR_00015/2015 # duplicate of COL/FLR/2015 +MF574575 # COL/FLR_00016/2015 # duplicate of COL/FLR/2015 +MF574553 # COL/FLR_00017/2015 # duplicate of COL/FLR/2015 +MF574573 # COL/FLR_00018/2015 # duplicate of COL/FLR/2015 +MF574574 # COL/FLR_00019/2015 # duplicate of COL/FLR/2015 +MF574577 # COL/FLR_00020/2015 # duplicate of COL/FLR/2015 +MF574556 # COL/FLR_00021/2015 # duplicate of COL/FLR/2015 +MF574554 # COL/FLR_00022/2015 # duplicate of COL/FLR/2015 +MF574566 # COL/FLR_00023/2015 # duplicate of COL/FLR/2015 +MF574569 # COL/FLR_00024/2015 # duplicate of COL/FLR/2015 +MF574563 # COL/FLR_00025/2015 # duplicate of COL/FLR/2015 +MF574564 # COL/FLR_00026/2015 # duplicate of COL/FLR/2015 +MF574581 # COL/FLR_00034/2015 # duplicate of COL/FLR/2015 +MF574588 # COL/FLR_00035/2015 # duplicate of COL/FLR/2015 +MF574582 # COL/FLR_00036/2015 # duplicate of COL/FLR/2015 +MF574586 # COL/FLR_00038/2015 # duplicate of COL/FLR/2015 +MF574584 # COL/FLR_00040/2015 # duplicate of COL/FLR/2015 +MF574583 # COL/FLR_00041/2015 # duplicate of COL/FLR/2015 +MF574580 # COL/FLR_00042/2015 # duplicate of COL/FLR/2015 +MF574579 # COL/PRV_00027/2015 # misdated +MF574578 # COL/PRV_00028/2015 # misdated +MF574585 # COL/PAN_00029/2015 # misdated +MF574587 # COL/PAN_00030/2015 # misdated +KY785436 # BRA/2016/FC_DQ12D1 # large indel +KY559010 # Brazil/2016/ZBRX8 # large indel +KY559011 # Brazil/2016/ZBRX11 # large indel +KX986761 # CX17 # large indel +MF801405 # MEX/2016/mex27 # large indel +MF801424 # MEX/2016/mex50 # large indel +MF801377 # SLV/2016/ElSalvador_1055 # large indel +VI20_12plex # USVI/20/2016 # large indel +USVI/21/2016 # large indel +VI23_12plex # USVI/23/2016 # large indel +VI27_1d # USVI/27/2016 # large indel +VI30_1d # USVI/30/2016 # large indel +VI32_12plex # USVI/32/2016 # large indel +KY126351 # Thailand/1605aTw # excess divergence +KU744693 # VE_Ganxian # excess divergence +KY328290 # ZK_YN001 # excess divergence +KY415986 # Haiti/0029/2014 # contamination present +KY415987 # Haiti/0033/2014 # contamination present +KY415990 # Haiti/0036/2014 # contamination present +KY415988 # Haiti/0054/2014 # contamination present +KY415989 # Haiti/0074/2014 # contamination present +KY415991 # Haiti/0097/2014 # contamination present +MF384325 # mosquito/Haiti/1682/2016 # contamination present +ZF36_36S # contamination present +MK105975 # MR766 # lab strain +KX856011 # Aedes_sp/MEX_I_44/2016 # duplicate of Aedes_aegypti/MEX/MEX_I_44/2016 +MK028857 # Puerto_Rico/2015/PRVABC59 # duplicate of PRVABC59 +MN025403 # V15555 # highly diverged +MT505349 # DK # lab strain +MT505350 # DK23 # lab strain +MW680969 # rGZ02a/2018 # highly diverged +MW680970 # rGZ02p/2018 # highly diverged +OK054351 # V211784 # highly diverged +MT478034 # LMM/AG5643 +OL414716 # Faranah/18 diff --git a/config/zika_reference.gb b/phylogenetic/config/zika_reference.gb similarity index 100% rename from config/zika_reference.gb rename to phylogenetic/config/zika_reference.gb diff --git a/phylogenetic/example_data/metadata.tsv b/phylogenetic/example_data/metadata.tsv new file mode 100644 index 0000000..3d39cf9 --- /dev/null +++ b/phylogenetic/example_data/metadata.tsv @@ -0,0 +1,35 @@ +strain virus genbank_accession date region country division city db segment authors +PAN/CDC_259359_V1_V3/2015 zika KX156774 2015-12-18 North America Panama Panama Panama genbank genome Shabman et al +COL/FLR_00024/2015 zika MF574569 2015-12-XX South America Colombia Colombia Colombia genbank genome Pickett et al +PRVABC59 zika KU501215 2015-12-XX North America Puerto Rico Puerto Rico Puerto Rico genbank genome Lanciotti et al +COL/FLR_00008/2015 zika MF574562 2015-12-XX South America Colombia Colombia Colombia genbank genome Pickett et al +Colombia/2016/ZC204Se zika KY317939 2016-01-06 South America Colombia Colombia Colombia genbank genome Quick et al +ZKC2/2016 zika KX253996 2016-02-16 Oceania American Samoa American Samoa American Samoa genbank genome Wu et al +VEN/UF_1/2016 zika KX702400 2016-03-25 South America Venezuela Venezuela Venezuela genbank genome Blohm et al +DOM/2016/BB_0059 zika KY785425 2016-04-04 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al +BRA/2016/FC_6706 zika KY785433 2016-04-08 South America Brazil Brazil Brazil genbank genome Metsky et al +DOM/2016/BB_0183 zika KY785420 2016-04-18 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al +EcEs062_16 zika KX879603 2016-04-XX South America Ecuador Ecuador Ecuador genbank genome Marquez et al +HND/2016/HU_ME59 zika KY785418 2016-05-13 North America Honduras Honduras Honduras genbank genome Metsky et al +DOM/2016/MA_WGS16_011 zika KY785484 2016-06-06 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al +DOM/2016/BB_0433 zika KY785441 2016-06-13 North America Dominican Republic Dominican Republic Dominican Republic genbank genome Metsky et al +USA/2016/FL022 zika KY075935 2016-07-22 North America Usa Usa Usa genbank genome Grubaugh et al +SG_027 zika KY241697 2016-08-27 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al +SG_074 zika KY241744 2016-08-28 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al +SG_056 zika KY241726 2016-08-28 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al +USA/2016/FLUR022 zika KY325473 2016-08-31 North America Usa Usa Usa genbank genome Grubaugh et al +Aedes_aegypti/USA/2016/FL05 zika KY075937 2016-09-09 North America Usa Usa Usa genbank genome Grubaugh et al +SG_018 zika KY241688 2016-09-13 Southeast Asia Singapore Singapore Singapore genbank genome Ho et al +USA/2016/FLWB042 zika KY325478 2016-09-26 North America Usa Usa Usa genbank genome Grubaugh et al +COL/PRV_00028/2015 zika MF574578 2016-12-XX South America Colombia Colombia Colombia genbank genome Pickett et al +Thailand/1610acTw zika MF692778 2016-10-XX Southeast Asia Thailand Thailand Thailand genbank genome Lin et al +1_0087_PF zika KX447509 2013-12-XX Oceania French Polynesia French Polynesia French Polynesia genbank genome Pettersson et al +1_0199_PF zika KX447519 2013-11-XX Oceania French Polynesia French Polynesia French Polynesia genbank genome Pettersson et al +1_0181_PF zika KX447512 2013-12-XX Oceania French Polynesia French Polynesia French Polynesia genbank genome Pettersson et al +Brazil/2015/ZBRC301 zika KY558995 2015-05-13 South America Brazil Brazil Brazil genbank genome Faria et al +Brazil/2015/ZBRA105 zika KY558989 2015-02-23 South America Brazil Brazil Brazil genbank genome Faria et al +Brazil/2016/ZBRC16 zika KY558991 2016-01-19 South America Brazil Brazil Brazil genbank genome Faria et al +V8375 zika KU501217 2015-11-01 North America Guatemala Guatemala Guatemala genbank genome Lanciotti et al +Nica1_16 zika KX421195 2016-01-19 North America Nicaragua Nicaragua Nicaragua genbank genome Tabata et al +Brazil/2015/ZBRC303 zika KY558997 2015-05-14 South America Brazil Brazil Brazil genbank genome Faria et al +SMGC_1 zika KX266255 2016-02-14 Oceania American Samoa American Samoa American Samoa genbank genome Bi et al diff --git a/phylogenetic/example_data/metadata_usvi.tsv b/phylogenetic/example_data/metadata_usvi.tsv new file mode 100644 index 0000000..96d3d52 --- /dev/null +++ b/phylogenetic/example_data/metadata_usvi.tsv @@ -0,0 +1,2 @@ +genbank_accession genbank_accession_rev accession strain date region country division location length host release_date update_date sra_accessions authors institution url +USVI/37/2016 VI37 USVI/37/2016 2016-10-06 North America Usvi Saint Croix Saint Croix 10807 Homo sapiens Black et al FH https://github.com/blab/zika-usvi/ diff --git a/example_data/sequences.fasta b/phylogenetic/example_data/sequences.fasta similarity index 99% rename from example_data/sequences.fasta rename to phylogenetic/example_data/sequences.fasta index 64facba..9203c90 100644 --- a/example_data/sequences.fasta +++ b/phylogenetic/example_data/sequences.fasta @@ -1,4 +1,4 @@ ->PAN/CDC_259359_V1_V3/2015 +>KX156774 gaatttgaagcgaatgctaacaacagtatcaacaggttttattttggatttggaaacgag agtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgc taaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggac @@ -179,7 +179,7 @@ gaccttccccacccttcaatctggggcctgaactggagatcagctgtggatctccagaag agggactagtggttagaggagaccccccggaaaacgcaaaacagcatattgacgctggga aagaccagagactccatgagtttccaccacgctggccgccaggcacagatcgccgaatag cggcggccggtgtggggaaatccatgggtct ->COL/FLR_00024/2015 +>MF574569 tcagactgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttatt ttggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggatt ccggattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaa @@ -358,7 +358,7 @@ agctgggaaaccaagcctatagtcaggccgagaacgccatggcacggaagaagccatgct gcctgtgagcccctcagaggacactgagtcaaaaaaccccacgcgcttggaggcgcagga tgggaaaagaaggtggcgaccttccccacccttcaatctggggcctgaactggagatcag ctgtggatctccagaagagggactagtggttagaggaga ->PRVABC59 +>KU501215 gttgttgatctgtgtgaatcagactgcgacagttcgagtttgaagcgaaagctagcaaca gtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaaa aaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtgag @@ -537,7 +537,7 @@ tgtgacccccccaggagaagctgggaaaccaagcctatagtcaggccgagaacgccatgg cacggaagaagccatgctgcctgtgagcccctcagaggacactgagtcaaaaaaccccac gcgcttggaggcgcaggatgggaaaagaaggtggcgaccttccccacccttcaatctggg gcctgaactggagatcagctgtggatctccagaagagggactagtggttagagga ->COL/FLR_00008/2015 +>MF574562 tcagactgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttatt ttggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggatt ccggattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaa @@ -716,7 +716,7 @@ agctgggaaaccaagcctatagtcaggccgagaacgccatggcacggaagaagccatgct gcctgtgagcccctcagaggacactgagtcaaaaaaccccacgcgcttggaggcgcagga tgggaaaagaaggtggcgaccttccccacccttcaatctggggcctgaactggagatcag ctgtggatctccagaagagggactagtggttagaggaga ->Colombia/2016/ZC204Se +>KY317939 gacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttattttggatttg gaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgt caatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgcc @@ -894,7 +894,7 @@ agtcagccacagcttggggaaagctgtgcagcctgtgacccccccaggagaagctgggaa accaagcctatagtcaggccgagaacgccatggcacggaagaagccatgctgcctgtgag cccctcagaggacactgagtcaaaaaaccccacgcgcttggaggcgcaggatgggaaaag aaggtggcgaccttccccacccttcaatctggggcctgaactggagat ->ZKC2/2016 +>KX253996 agttgttgatctgtgtgaatcagactgcgacagttcgagtttgaagcgaaagctagcaac agtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaa aaaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtga @@ -1076,7 +1076,7 @@ ggcctgaactggagatcagctgtggatctccagaagagggactagtggttagaggagacc ccccggaaaacgcaaaacagcatattgacgctgggaaagaccagagactccatgagtttc caccacgctggccgccaggcacagatcgccgaatagcggcggccggtgtggggaaatcca tgggtct ->VEN/UF_1/2016 +>KX702400 agttgttactgttgctgactcagactgcgacagttcgagtttgaagcgaaagctagcaac agtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaa aaaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtga @@ -1258,7 +1258,7 @@ ggcctgaactggagatcagctgtggatctccagaagagggactagtggttagaggagacc ccccggaaaacgcaaaacagcatattgacgctgggaaagaccagagactccatgagtttc caccacgctggccgccaggcacagatcgccgaatagcggcggccggtgtggggaaatcca tgggtctt ->DOM/2016/BB_0059 +>KY785425 tggctgccatgctgagaataatcaatgctaggaaggagaagaagagacgaggcgcagata ctagtgtcggaattgttggcctcctgctgaccacagctatggcagcggaggtcactagac gtgggagtgcatactacatgtacttggacagaaacgatgctggggaggccatatctttcc @@ -1427,7 +1427,7 @@ ggtgtggatctctcatagggcacagaccgcgcaccacctgggctgagaacattaaaaaca cagtcaacatggtgcgcaggatcataggtgaggaagaaaagtacatggactacctatcca cccaagttcgctacttgggtgaagaagggtctacacctggagtgctgtaagcaccaatct taatgttgtcaggcc ->BRA/2016/FC_6706 +>KY785433 agtttgaagcgaaagctagcaacagtatcaacaggttttatttyggatttggaaacgaga gtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgct aaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggact @@ -1601,7 +1601,7 @@ cattccctatttgggaaaaagggaagacttgtggtgtggatctctcatagggcacagacc gcgcaccacctgggctgagaacattaaaaacacagtcaacatggtgcgcaggatcatagg tgatgaagaaaagtacatggactacctatccacccaagttcgctacttgggtgaagaagg gtctacacctggagtgctgtaagcaccaatcttaatgttgtcaggc ->DOM/2016/BB_0183 +>KY785420 gtttgaagcgaaagctagcaacagtatcaacaggttttattttggatttggaaacgagag tttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgcta aaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggactt @@ -1780,7 +1780,7 @@ tagtcaggccgagaacgccatggcacggaagaagccatgctgcctgtgagcccctcagag gacactgagtcaaaaaaccccacgcgcttggaggcgcaggatgggaaaagaaggtggcga ccttccccacccttcaatctggggcctgaactggagatcagctgtggatccccagaagag g ->EcEs062_16 +>KX879603 agtagttgatctgtgtgaatcagactgcgacagttcgagtttgaagcgaaagctagcaac agtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaa aaaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtga @@ -1962,7 +1962,7 @@ ggcctgaactggagatcagctgtggatctccagaagagggactagtggttagaggagacc ccccggaaaacgcaaaacagcatattgacgctgggaaagaccagagactccatgagtttc caccacgctggccgccaggcacagatcgccgaatagcggcggccggtgtggggaaatcca tgggagatcgga ->HND/2016/HU_ME59 +>KY785418 gtttgaagcgaaagctagcaacagtatcaacaggttttattttggatttggaaacgagag tttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgcta aaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggactt @@ -2136,7 +2136,7 @@ attccctatttgggaaaaagggaagacttgtggtgtggatctctcatagggcacagaccg cgcaccacctgggctgagaacattaaaaacacagtcaacatggtgcgcaggatcataggt gatgaagaaaagtacatggactacctatccacccaagttcgctacttgggtgaagaaggg tctacacctggagtgctgtaagcaccaatcttaatgttgtcaggc ->DOM/2016/MA_WGS16_011 +>KY785484 aagcgaaagctagcaacagtatcaacaggttttattttggatttggaaacgagagtttct ggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgctaaaacg cggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggacttctgct @@ -2314,7 +2314,7 @@ ggggaaagctgtgcagcctgtgacccccccaggagaagctgggaaaccaagcctatagtc aggccgagaacgccatggcacggaagaagccatgctgcctgtgagcccctcagaggacac tgagtcaaaaaaccccacgcgcttggaggcgcaggatgggaaaagaaggtggcgaccttc cccacccttcaatctggggcctgaactggggatcag ->DOM/2016/BB_0433 +>KY785441 tttgaagcgaaagctagcaacagtatcaacaggttttattttggatttggaaacgagagt ttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgctaa aacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggacttc @@ -2488,7 +2488,7 @@ ttccctatttgggaaaaagggaagacttgtggtgtggatctctcatagggcacagaccgc gcaccacctgggctgagaacattaaaaacacagtcaacatggtgcgcaggatcataggtg aggaagaaaagtacatggactacctatccacccaagttcgctacttgggtgaagaagggt ctacacctggagtgctgtaagcaccaatcctaatgttgtcaggcc ->USA/2016/FL022 +>KY075935 gcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttattttggatt tggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggatt gtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctg @@ -2662,7 +2662,7 @@ aaatggacagacattccctatttgggaaaaagggaagacttgtggtgtggatctctcata gggcacagaccgcgcaccacctgggctgagaacattaaaaacacagtcaacatggtgcgc aggatcataggtgaggaagaaaagtacatggactacctatccacccaagtccgctacttg ggtgaagaagggtctacacctggagtgctgtaagcaccaatctta ->SG_027 +>KY241697 ctgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttattttgga tttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccgga ttgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggc @@ -2842,7 +2842,7 @@ tgagcccctcagaggacactgagtcaaaaaaccccacgcgcttggaggcgcaggatggga aaagaaggtggcgaccttccccacccttcaatctggggcctgaactggagatcagctgtg gatctccagaagagggactagtggttagaggagaccccccggaaaacgcaaaacagcata ttgacgctgggaaagaccagagactccatgagtttccaccacgctggccgccag ->SG_074 +>KY241744 gaatcagactgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggtttt attttggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggagg attccggattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggctt @@ -3023,7 +3023,7 @@ ggatgggaaaagaaggtggcgaccttccccacccttcaatctggggcctgaactggagat cagctgtggatctccagaagagggactagtggttagaggagaccccccggaaaacgcaaa acagcatattgacgctgggaaagaccagagactccatgagtttccaccacgctggccgcc aggcacagatcgccgaatagcg ->SG_056 +>KY241726 gaatcagactgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggtttt attttggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggagg attccggattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggctt @@ -3203,7 +3203,7 @@ gctgcctgtgagcccctcagaggacactgagtcaaaaaaccccacgcgcttggaggcgca ggatgggaaaagaaggtggcgaccttccccacccttcaatctggggcctgaactggagat cagctgtggatctccagaagagggactagtggttagaggagaccccccggaaaacgcaaa acagcatattgacgctgggaaagaccagagactccatgagtttccaccacgctggcc ->USA/2016/FLUR022 +>KY325473 gtgtgaatcagactgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacagg ttttattttggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccg gaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggg @@ -3384,7 +3384,7 @@ cgcaggatgggaaaagaaggtggcgaccttccccacccttcaatctggggcctgaactgg agatcagctgtggatctccagaagagggactagtggttagaggagaccccccggaaaacg caaaacagcatattgacgctgggaaagaccagagactccatgagtttccaccacgctggc cgccaggcacagatcgccgaatagcggcggccggtgtggggaaatc ->Aedes_aegypti/USA/2016/FL05 +>KY075937 gacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttattttggatttg gaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgt caatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgcc @@ -3562,7 +3562,7 @@ agtcagccacagcttggggaaagctgtgcagcctgtgacccccccaggagaagctgggaa accaagcctatagtcaggccgagaacgccatggcacggaagaagccatgctgcctgtgag cccctcagaggacactgagtcaaaaaaccccacgcgcttggaggcgcaggatgggaaaag aaggtggcgaccttccccacccttcaatctggggcctgaactggagat ->SG_018 +>KY241688 atgnnnnnnnnnnnnnnnnnnnccggaggattccggattgtcaatatgctaaaacgcgga gtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggacttctgctgggt catgggcccatcaggatggtcttggcgattctagcctttttgaggttcacggcaatcaag @@ -3741,7 +3741,7 @@ tcaaaaaaccccacgcgcttggaggcgcaggatgggaaaagaaggtggcgaccttcccca cccttcaatctggggcctgaactggagatcagctgtggatctccagaagagggactagtg gttagaggagaccccccggaaaacgcaaaacagcatattgacgctgggaaagaccagaga ctccatgagtttccaccacgctggccgccaggcacagat ->USA/2016/FLWB042 +>KY325478 ctttgggggcttgaagaggctgccagccggacttctgctgggtcatgggcccatcaggat ggtcttggcgattctagcctttttgagattcacggcaatcaagccatcactgggtctcat caatagatggggttcagtggggaaaaaagaggctatggaaataataaagaagttcaagaa @@ -3916,7 +3916,7 @@ aatctcaatgttgtcaggcctgctagtcagccacagcttggggaaagctgtgcagcctgt gacccccccaggagaagctgggaaaccaagcctatagtcaggccgagaacgccatggcac ggaagaagccatgctgcctgtgagcccctcagaggacactgagtcaaaaaaccccacgcg cttggaggcgcaggnnnnnnaaagaag ->COL/PRV_00028/2015 +>MF574578 ttgaagcgaaagctagcaacagtatcaacaggttttattttggatttggaaacgagagtt tctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgctaaa acgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggacttct @@ -4095,7 +4095,7 @@ gtcaggccgagaacgccatggcacggaagaagccatgctgcctgtgagcccctcagagga cactgagtcaaaaaaccccacgcgcttggaggcgcaggatgggaaaagaaggtggcgacc ttccccacccttcaatctggggcctgaactggagatcagctgtggatctccagaagaggg actagtggttagaggaga ->Thailand/1610acTw +>MF692778 gcaacagtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaa cccaaaaaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccg tgtgagcccctttgggggcttgaagaggctgccagccggacttctgctgggccatgggcc @@ -4271,7 +4271,7 @@ ggactacctatccacccaagttcgctacttgggtgaagaagggtctacacctggagtgct gtaagcaccaatcttagtgttgtcaggcctgctagtcagccacagcttggggaaagctgt gcagcctgtgacccccccaggagaagctgggaaaccaagcccatagtcaggccgagaacg ccatggcacggaag ->1_0087_PF +>KX447509 agtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaa aaaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtga gcccctttgggggcttgaagaggctgccagccggacttctgctgggtcatgggcccatca @@ -4449,7 +4449,7 @@ ctgtgacccccccaggagaagctgggaaaccaagcctatagtcaggccgagaacgccatg gcacggaagaagccatgctgcctgtgagcccctcagaggacactgagtcaaaaaacccca cgcgcttggaggcgcaggatgggaaaagaaggtggcgaccttccccacccttcaatctgg ggcctgaactggagatcagctgtggat ->1_0199_PF +>KX447519 actgcgacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttattttgg atttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccgg attgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagagg @@ -4603,7 +4603,7 @@ tgggctctagtggacaaggaaagagagcaccacctgagaggagagtgccagagttgtgtg tacaacatgatgggaaaaagagaaaagaaacaaggggaatttggaaaggccaagggcagc cgcgccatctggtatatgtggctaggggctagatttctagagttcgaagcccttggattc ttgaacgaggatcactggatgg ->1_0181_PF +>KX447512 agtatcaacaggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaa aaaagaaatccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtga gcccctttgggggcttgaagaggctgccagccggacttctgctgggtcatgggcccatca @@ -4781,7 +4781,7 @@ ctgtgacccccccaggagaagctgggaaaccaagcctatagtcaggccgagaacgccatg gcacggaagaagccatgctgcctgtgagcccctcagaggacactgagtcaaaaaacccca cgcgcttggaggcgcaggatgggaaaagaaggtggcgaccttccccacccttcaatctgg ggcctgaactggagatcagctgtgga ->Brazil/2015/ZBRC301 +>KY558995 gatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccg gattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagag gctgccagccggacttctgctgggtcatgggcccatcaggatggtcttggcgattctagc @@ -4950,7 +4950,7 @@ gactgcttgcctagcaaaatcatatgcgcagatgtggcagctcctttatttccacagaan ggacctccgactgatggccaatgccatttgttcatctgtgccagttgactgggttccaac tgggagaactacctggtcaatccatggaaanggagaatggatgaccactgaagacatgct tg ->Brazil/2015/ZBRA105 +>KY558989 gatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccg gattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagag gctgccagccggacttctgctgggtcatgggcccatcaggatggtcttggcgattctagc @@ -5119,7 +5119,7 @@ gactgcttgcctagcaaaatcatatgcgcaaatgtggcagctcctttatttccacagaag ggacctccgactgatggccaatgccatttgttcatctgtgccagttgactgggttccaac tgggagaactacctggtcaatccatggaaagggagaatggatgaccactgaagacatgct tg ->Brazil/2016/ZBRC16 +>KY558991 tgagaataatcaatgctaggaaggagaagaagagacgaggcgcagatactagtgtcggaa ttgttggcctcctgctgaccacagctatggcagcggaggtcactagacgtgggagtgcat actatatgtacttggacagaaacgatgctggggaggccatatcttttccaaccacattgg @@ -5272,7 +5272,7 @@ atgcagatgacactgctggctgggacacccgcatcagcaggtttgatctggagaatgaag ctctaatcaccaaccaaatggagagagggcacagggccttggcattggccataatcaagt acacataccaaaacaaagtggtaaaggtccttagaccagctgaaaaagggaaaacagtta tggacatcatttcgagacaagaccaaaggggg ->V8375 +>KU501217 atgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgctaaaacgcgga gtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggacttctgctgggt catgggcccatcaggatggtcttggcgattctagcctttttgagattcacggcaatcaag @@ -5445,7 +5445,7 @@ ttgggaaaaagggaagacttgtggtgtggatctctcatagggcacagaccgcgcaccacc tgggctgagaacattaaaaacacagtcaacatggtgcgcaggatcataggtgatgaagaa aagtacatggactacctatccacccaagttcgctacttgggtgaagaagggtctacacct ggagtgctgtaa ->Nica1_16 +>KX421195 tcgagtttgaagcgaaagctagcaacagtatcaacaggttttattttggatttggaaacg agagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatat gctaaaacgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccgg @@ -5624,7 +5624,7 @@ cctatagtcaggccgagaacgccatggcacggaagaagccatgctgcctgtgagcccctc agaggacactgagtcaaaaaaccccacgcgcttggaggcgcaggatgggaaaagaaggtg gcgaccttccccacccttcaatctggggcctgaactggagatcagctgtggatctccaga agagggactagtggttagaggag ->Brazil/2015/ZBRC303 +>KY558997 tgagaataatcaatgctaggaaggagaagaagagacgaggcacagatactagtgtcggaa ttgttggcctcctgctgaccacagctatggcagcggaggtcactagacgtgggagtgcat actatatgtacttggacagaaacgatgctggggaggccatatcttttccaaccacattgg @@ -5782,7 +5782,7 @@ agatgcaagacttgtggctgctgcggaggtcagagaaagtgaccaactggttgcagagca acggatgggataggctcaaacgaatggcagtcagtggagatgattgcgttgtgaagccaa ttgatgataggtttgcacatgccctcaggttcttgaatgatatgggaaaagttaggaagg acacacaagagtgg ->SMGC_1 +>KX266255 tctgtgtgaatcagactgcgacagttcgagtttgaagcgaaagctagcaacagtatcaac aggttttattttggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaat ccggaggattccggattgtcaatatgctaaaacgcggagtagcccgtgtgagcccctttg diff --git a/phylogenetic/example_data/sequences_usvi.fasta b/phylogenetic/example_data/sequences_usvi.fasta new file mode 100644 index 0000000..d677bfc --- /dev/null +++ b/phylogenetic/example_data/sequences_usvi.fasta @@ -0,0 +1,137 @@ +>VI37 +nnnnnnnnnnnnnnnnnnnnnnnnnnnngacagttcgagtttgaagcgaaagctagcaacagtatcaacaggttttattt +tggatttggaaacgagagtttctggtcatgaaaaacccaaaaaagaaatccggaggattccggattgtcaatatgctaaa +acgcggagtagcccgtgtgagcccctttgggggcttgaagaggctgccagccggacttctgctgggtcatgggcccatca +ggatggtcttggcgattctagcctttttgagattcacggcaatcaagccatcactgggcctcatcaatagatggggttca +gtggggaaaaaagaggctatggaaacaataaagaagttcaagaaagatctggctgccatgctgagaataatcaatgctag +gaaggagaagaagagacgaggcgcagatactagtgtcggaattgttggcctcctgctgaccacagctatggcagcggagg +tcactagacgtgggagtgcatactatatgtacttggacagaaacgatgctggggaggccatatcttttccaaccacattg +gggatgaataagtgttatatacagatcatggatcttggacacatgtgtgatgccaccatgagctatgaatgccctatgct +ggatgagggggtggaaccagatgacgtcgattgttggtgcaacacgacgtcaacttgggttgtgtacggaacctgccatc +acaaaaaaggtgaagcacggagatctagaagagctgtgacgctcccctcccattccaccaggaagctgcaaacgcggtcg +caaacctggttggaatcaagagaatacacaaagcacttgattagagtcgaaaattggatattcaggaaccctggcttcgc +gttagcagcagctgccatcgcttggcttttgggaagctcaacgagccaaaaagtcatatacttggtcatgatactgctga +ttgccccggcatacagcatcaggtgcataggagtcagcaatagggactttgtggaaggtatgtcaggtgggacttgggtt +gatgttgtcttggaacatggaggttgtgtcaccgtaatggcacaggacaaaccgactgtcgacatagagctggttacaac +aacagtcagcaacatggcggaggtaagatcctactgctatgaggcatcaatatcagacatggcttctgacagccgctgcc +caacacaaggtgaagcctaccttgacaagcaatcagacactcaatatgtctgcaaaagaacgttagtggacagaggctgg +ggaaatggatgtggactttttggcaaagggagcctggtgacatgcgctaagtttgcatgctccaagaaaatgaccgggaa +gagcatccagccagagaatctggagtaccggataatgctgtcagttcatggctcccagcacagtgggatgatcgttaatg +acacaggacatgaaactgatgagaatagagcgaaagttgagataacgcccaattcaccgagagccgaagccaccctgggg +ggttttggaagcctaggacttgattgtgaaccgaggacaggccttgacttttcagatttgtattacttgactatgaataa +caagcactggttggttcacaaggagtggttccacgacattccattaccttggcacgctggggcagacaccggaactccac +actggaacaacaaagaagcactggtagagttcaaggacgcacatgccaaaaggcaaactgtcgtggttctagggagtcaa +gaaggagcagttcacacggcccttgctggagctctggaggctgagatggatggtgcaaagggaaggctgtcctctggcca +cttgaaatgtcgcctgaaaatggataaacttagattgaagggcgtgtcatactccttgtgtactgcagcgttcacattca +ccaagatcccggctgaaacactgcacgggacagtcacagtggaggtacagtacgcagggacagatggaccttgcaaggtt +ccagctcagatggcggtggacatgcaaactctgaccccagttgggaggttgataaccgctaaccccgtaatcactgaaag +cactgagaactctaagatgatgctggaacttgatccaccatttggggactcttacattgtcataggagtcggggagaaga +agatcacccaccactggcacaggagtggcagcaccattggaaaagcatttgaagccactgtgagaggtgccaagagaatg +gcagtcttgggagacacagcctgggactttggatcagttggaggcgctctcaactcattgggcaagggcatccatcaaat +ttttggagcagctttcaaatcattgtttggaggaatgtcctggttctcacaaattctcattggaacgttgctgatgtggt +tgggtctgaacacaaagaatggatctatttcccttatgtgcttggccttagggggagtgttgatcttcttatccacagcc +gtctctgctgatgtggggtgctcggtggacttctcaaagaaggagacgagatgcggtacaggggtgttcgtctataacga +cgttgaagcctggagggacaggtacaagtaccatcctgactccccccgtagattggcagcagcagttaagcaagcctggg +aagatggtatctgcgggatctcctctgtttcaagaatggaaaacatcatgtggagatcagtagaaggggagctcaacgca +atcctggaagagaatggagttcaactgacggtcgttgtgggatctgtaaaaaaccccatgtggagaggtccacagagatt +gcccgtgcctgtgaacgagctgccccacggctggaaggcttgggggaaatcgtacttcgtcagagcagcaaagacaaata +acagctttgtcgtggatggtgacacactgaaggaatgcccactcaaacatagagcatggaacagctttcttgtggaggat +catgggttcggggtatttcacactagtgtctggctcaaggttagagaagattattcattagagtgtgatccagccgttat +tggaacagctgttaagggaaaggaggctgtacacagtgatctaggctactggattgagagtgagaagaatgacacatgga +ggctggagagggcccatctgatcgagatgaaaacatgtgaatggccaaagtcccacacattgtggacagatggaatagaa +gagagtgatctgatcatacccaagtctttagctgggccactcagccatcacaataccagagagggctacaggacccaaat +gaaagggccatggcacagtgaagagcttgaaattcggtttgaggaatgcccaggcactaaggtccacgtggaggaaacat +gtggaacaagaggaccatctctgagatcaaccactgcaagcggaagggtgatcgaggaatggtgctgcagggagtgcaca +atgcccccactgtcgttccgggctaaagatggctgttggtatggaatggagataaggcccaggaaagaaccagaaagcaa +cttagtaaggtcaatggtgactgcaggatcaactgatcacatggaccacttctcccttggagtgcttgtgatcctgctca +tggtgcaggaagggctgaagaagagaatgaccacaaagatcatcataagcacatcaatggcagtgctggtagctatgatc +ctgggaggattttcaatgagtgacctggctaagcttgcaattttgatgggtgccaccttcgcggaaatgaacactggagg +agatgtagctcatctggcgctgatagcggcattcaaagtcagaccagcgttgctggtatctttcatcttcagagctaatt +ggacaccccgtgaaagcatgctgctggccttggcctcgtgtcttttgcaaactgcgatctccgccttggaaggcgacctg +atggttctcatcaatggttttgctttggcctggttggcaatacgagcgatggttgttccacgcactgataacatcacctt +ggcaatcctggctgctctgacaccactggcccggggcacactgcttgtggcgtggagagcaggccttgctacttgcgggg +ggtttatgctcctctctctgaagggaaaaggcagtgtgaagaagaacttaccatttgtcatggccctgggactaaccgct +gtgaggctggtcgaccccatcaacgtggtgggactgctgttgctcacaaggagtgggaagcggagctggccccctagcga +agtactcacagctgttggcctgatatgcgcattggctggagggttcgccaaggcagatatagagatggctgggcccatgg +ccgcggtcggtctgctaattgtcagttacgtggtctcaggaaagagtgtggacatgtacattgaaagagcaggtgacatc +acatgggaaaaagatgcggaagtcactggaaacagtccccggctcgatgtggcgctagatgagagtggtgatttctccct +ggtggaggatgacggtccccccatgagagagatcatactcaaggtggtcctgatgaccatctgtggcatgaacccaatag +ccataccctttgcagctggagcgtggtacgtatacgtgaagactggaaaaaggagtggtgctctatgggatgtgcctgct +cccaaggaagtaaaaaagggggagaccacagatggagtgtacagagtaatgactcgtagactgctaggttcaacacaagt +tggagtgggagttatgcaagagggggtctttcacactatgtggcacgtcacaaaaggatccgcgctgagaagcggtgaag +ggagacttgatccatactggggagatgtcaagcaggatctggtgtcatactgtggtccatggaagctagatgccgcctgg +gatgggcacagcgaggtgcagctcttggccgtgccccccggagagagagcgaggaacatccagactctgcccggaatatt +taagacaaaggatggggacattggagcggttgcgctggattacccagcaggaacttcaggatctccaatcctagacaagt +gtgggagagtgataggactttatggcaatggggtcgtgatcaaaaacgggagttatgttagtgccatcacccaagggagg +agggaggaagagactcctgttgagtgcttcgagccctcgatgctgaagaagaagcagctaactgtcttagacttgcatcc +tggagctgggaaaaccaggagagttcttcctgaaatagtccgtgaagccataaaaacaagactccgtactgtgatcttag +ctccaaccagggttgtcgctgctgaaatggaggaggcccttagagggcttccagtgcgttatatgacaacagcagtcaat +gtcacccactctggaacagaaatcgtcgacttaatgtgccatgccaccttcacttcacgtctactacagccaatcagagt +ccccaactataatctgtatattatggatgaggcccacttcacagatccctcaagtatagcagcaagaggatacatttcaa +caagggttgagatgggcgaggcggctgccatcttcatgaccgccacgccaccaggaacccgtgacgcatttccggactcc +aactcaccaattatggacaccgaagtggaagtcccagagagagcctggagctcaggctttgattgggtgacggatcattc +tggaaaaacagtttggtttgttccaagcgtgaggaacggcaatgagatcgcagcttgtctgacaaaggctggaaaacggg +tcatacagctcagcagaaagacttttgagacagagttccagaaaacaaaacatcaagagtgggactttgtcgtgacaact +gacatttcagagatgggcgccaactttaaagctgaccgtgtcatagattccaggagatgcctaaagccggtcatacttga +tggcgagagagtcattctggctggacccatgcctgtcacacatgccagcgctgcccagaggagggggcgcataggcagga +atcccaacaaacctggagatgagtatctgtatggaggtgggtgcgcagagactgacgaagaccatgcacactggcttgaa +gcaagaatgctccttgacaatatttacctccaagatggcctcatagcctcgctctatcgacctgaggccgacaaagtagc +agccattgagggagagttcaagcttaggacggagcaaaggaagacctttgtggaactcatgaaaagaggagatcttcctg +tttggctggcctatcaggttgcatctgccggaataacctacacagatagaagatggtgctttgatggcacgaccaacaac +accataatggaagacagtgtgccggcagaggtgtggaccagacacggagagaaaagagtgctcaaaccgaggtggatgga +cgccagagtttgttcagatcatgcggccctgaagtcattcaaggagtttgccgctgggaaaagaggagcggcttttggag +tgatggaagccctgggaacactgccaggacacatgacnnagagattccaggaagcnattgacaacctcgctgtgctcatg +cgngcagagactggaagcaggccttacaaagccgcggcggcccaattgccggagaccctagagaccataatgcntttggg +gttgctgggaacagtctcgctgggaatcttcttcgtcttgatgaggaacaagggcatagggaagatgggctttggaatgg +tgactcttggggccagcgcatggctcatgtggctctcggaaattgagccagccagaattgcatgtgtcctcattgttgtg +ttcctattgctggtggtgctcatacctgagccagaaaagcaaagatctccccaggacaaccaaatggcaatcatcatcat +ggtagcagtaggtcttttgggcttgattaccgccaatgaactcggatggttggagagaacaaagagtgacctaagccatc +taatgggaaggagagaggagggggcaaccataggattctcaatggacattgacctgcggccagcctcagcttgggccatc +tatgctgccttgacaactttcattaccccagccgtccaacatgcagtgaccacctcatacaacaactactccttaatggc +gatggccacgcaagctggagtgttgtttggcatgggcaaagggatgccattctacgcatgggactttggagtcccgctgc +taatgataggttgctactcacaattaacacccctgaccctaatagtggccatcattttgctcgtggcgcactacatgtac +ttgatcccagggctgcaggcagcagctgcgcgtgctgcccagaagagaacggcagctggcatcatgaagaaccctgttgt +ggatggaatagtggtgactgacattgacacaatgacaattgacccccaagtggagaaaaagatgggacaggtgctactca +tagcagtggccgtctccagcgccatactgtcgcggaccgcctgggggtggggggaggctggggctctgatcacagccgca +acttccactttgtgggaaggctctccgaacaagtactggaactcctctacagccacttcactgtgtaacatttttagggg +aagttacttggctggagcttctctaatctacacagtaacaagaaacgctggcttggtcaagagacgtgggggtggaacag +gagagaccctgggagagaaatggaaggcccgcttgaaccagatgtcggccctggagttctactcctacaaaaagtcaggc +atcaccgaggtgtgcagagaagaggcccgccgcgccctcaaggacggtgtggcaacgggaggccatgctgtgtcccgagg +aagtgcaaagctgagatggttggtggagcggggatacctgcagccctatggaaaggtcattgatcttggatgtggcagag +ggggctggagttactacgccgccaccatccgcaaagttcaagaagtgaaaggatacacaaaaggaggccctggtcatgaa +gaacccgtgttggtgcaaagctatgggtggaacatagtccgtcttaagagtggggtggacgtctttcatatggcggctga +gccgtgtgacacgttgctgtgtgacataggtgagtcatcatctagtcctgaagtggaagaagcacggacgctcagagtcc +tctccatggtgggggattggcttgaaaaaagaccaggagccttttgtataaaagtgttgtgcccatacaccagcactatg +atggaaaccctggagcgactgcagcgtaggtatgggggaggactggtcagagtgccactctcccgcaactctacacatga +gatgtactgggtctctggagcgaaaagcaacaccataaaaagtgtgtccaccacgagccagctcctcttggggcgcatgg +acgggcctaggaggccagtgaaatatgaggaggatgtgaatctcggctctggcacgcgggctgtggtaagctgcgctgaa +gctcccaacatgaagatcattggtaaccgcattgaaaggatccgcagtgagcacgcggaaacgtggttctttgacgagaa +ccacccatataggacatgggcttaccatggaagctatgaggcccccacacaagggtcagcgtcctctctaataaacgggg +ttgtcaggctcctgtcaaaaccctgggatgtggtgactggagtcacaggaatagccatgaccgacaccacaccgtatggt +cagcaaagagttttcaaggaaaaagtggacactagggtgccagacccccaagaaggcactcgtcaggttatgagcatggt +ctcttcctggttgtggaaagagctaggcaaacacaaacggccacgagtctgcaccaaagaagagttcatcaacaaggttc +gtagcaatgcagcattaggggcaatatttgaggaggaaaaagagtggaagactgcagtggaagctgtgaacgatccaagg +ttctgggctctagtggacaaggaaagagagcaccacctgagaggagagtgccagagctgtgtgtacaacatgatgggaaa +aagagaaaagaaacaaggggaatttggaaaggccaagggcagccgcgccatctggtatatgtggctaggggctagatttc +tagagttcgaagcccttggattcttgaacgaggatcactggatggggagagagaactcaggaggtggtgttgaagggctg +ggattacaaagactcggatatgtcctagaagagatgagtcgtataccaggaggaaggatgtatgcagatgacactgctgg +ctgggacacccgcattagcaggtttgatctggagaatgaagctctaatcaccaaccaaatggagaaagggcacagggcct +tggcattggccataatcaagtacacataccaaaacaaagtggtaaaggtccttagaccagctgaaaaagggaaaacagtt +atggacattatttcgagacaagaccaaagggggagcggacaagttgtcacttacgctcttaacacatttaccaacctagt +ggtgcaactcattcggaatatggaggctgaggaagttctagagatgcaagacttgtggctgctgcggaggtcagagaaag +tgaccaactggttgcagagcaacggatgggataggctcaaacgaatggcagtcagtggagatgattgcgttgtgaagcca +attgatgataggtttgcacatgccctcaggttcttgaatgatatgggaaaagttaggaaggacacacaagagtggaaacc +ctcaactggatgggacaactgggaagaagttccgttttgctcccaccacttcaacaagctccatctcaaggacgggaggt +ccattgtggttccctgccgccaccaagatgaactgattggtcgggcccgcgtctctccaggggcgggatggagcatccgg +gagactgcttgcctagcaaaatcatatgcgcaaatgtggcagctcctttatttccacagaagggacctccgactgatggc +caatgccatttgttcatctgtgccagttgactgggttccaactgggagaactacctggtcaatccatggaaagggagaat +ggatgaccactgaagacatgcttgtggtgtggaacagagtgtggatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +nnnnnnn diff --git a/phylogenetic/profiles/ci/copy_example_data.smk b/phylogenetic/profiles/ci/copy_example_data.smk new file mode 100644 index 0000000..495d778 --- /dev/null +++ b/phylogenetic/profiles/ci/copy_example_data.smk @@ -0,0 +1,21 @@ +rule copy_example_data: + input: + sequences="example_data/sequences.fasta", + metadata="example_data/metadata.tsv", + usvi_sequences="example_data/sequences_usvi.fasta", + usvi_metadata="example_data/metadata_usvi.tsv", + output: + sequences="data/sequences.fasta", + metadata="data/metadata.tsv", + usvi_sequences="data/sequences_usvi.fasta", + usvi_metadata="data/metadata_usvi.tsv", + shell: + """ + cp -f {input.sequences} {output.sequences} + cp -f {input.metadata} {output.metadata} + cp -f {input.usvi_sequences} {output.usvi_sequences} + cp -f {input.usvi_metadata} {output.usvi_metadata} + """ + +ruleorder: copy_example_data > decompress +ruleorder: copy_example_data > decompress_usvi \ No newline at end of file diff --git a/phylogenetic/profiles/ci/profiles_config.yaml b/phylogenetic/profiles/ci/profiles_config.yaml new file mode 100644 index 0000000..17bad21 --- /dev/null +++ b/phylogenetic/profiles/ci/profiles_config.yaml @@ -0,0 +1,2 @@ +custom_rules: + - profiles/ci/copy_example_data.smk diff --git a/phylogenetic/rules/annotate_phylogeny.smk b/phylogenetic/rules/annotate_phylogeny.smk new file mode 100644 index 0000000..ad00d0f --- /dev/null +++ b/phylogenetic/rules/annotate_phylogeny.smk @@ -0,0 +1,93 @@ +""" +This part of the workflow creates additonal annotations for the phylogenetic tree. + +REQUIRED INPUTS: + + metadata = data/metadata_all.tsv + prepared_sequences = results/aligned.fasta + tree = results/tree.nwk + +OUTPUTS: + + node_data = results/*.json + + There are no required outputs for this part of the workflow as it depends + on which annotations are created. All outputs are expected to be node data + JSON files that can be fed into `augur export`. + + See Nextstrain's data format docs for more details on node data JSONs: + https://docs.nextstrain.org/page/reference/data-formats.html + +This part of the workflow usually includes the following steps: + + - augur traits + - augur ancestral + - augur translate + - augur clades + +See Augur's usage docs for these commands for more details. + +Custom node data files can also be produced by build-specific scripts in addition +to the ones produced by Augur commands. +""" + +rule ancestral: + """Reconstructing ancestral sequences and mutations""" + input: + tree = "results/tree.nwk", + alignment = "results/aligned.fasta" + output: + node_data = "results/nt_muts.json" + params: + inference = "joint" + shell: + """ + augur ancestral \ + --tree {input.tree} \ + --alignment {input.alignment} \ + --output-node-data {output.node_data} \ + --inference {params.inference} + """ + +rule translate: + """Translating amino acid sequences""" + input: + tree = "results/tree.nwk", + node_data = "results/nt_muts.json", + reference = "config/zika_reference.gb" + output: + node_data = "results/aa_muts.json" + shell: + """ + augur translate \ + --tree {input.tree} \ + --ancestral-sequences {input.node_data} \ + --reference-sequence {input.reference} \ + --output {output.node_data} \ + """ + +rule traits: + """ + Inferring ancestral traits for {params.columns!s} + - increase uncertainty of reconstruction by {params.sampling_bias_correction} to partially account for sampling bias + """ + input: + tree = "results/tree.nwk", + metadata = "data/metadata_all.tsv" + output: + node_data = "results/traits.json", + params: + columns = "region country", + sampling_bias_correction = 3, + strain_id = config.get("strain_id_field", "strain"), + shell: + """ + augur traits \ + --tree {input.tree} \ + --metadata {input.metadata} \ + --metadata-id-columns {params.strain_id} \ + --output {output.node_data} \ + --columns {params.columns} \ + --confidence \ + --sampling-bias-correction {params.sampling_bias_correction} + """ diff --git a/phylogenetic/rules/construct_phylogeny.smk b/phylogenetic/rules/construct_phylogeny.smk new file mode 100644 index 0000000..efc5ff6 --- /dev/null +++ b/phylogenetic/rules/construct_phylogeny.smk @@ -0,0 +1,69 @@ +""" +This part of the workflow constructs the phylogenetic tree. + +REQUIRED INPUTS: + + metadata = data/metadata_all.tsv + prepared_sequences = results/aligned.fasta + +OUTPUTS: + + tree = results/tree.nwk + branch_lengths = results/branch_lengths.json + +This part of the workflow usually includes the following steps: + + - augur tree + - augur refine + +See Augur's usage docs for these commands for more details. +""" + +rule tree: + """Building tree""" + input: + alignment = "results/aligned.fasta" + output: + tree = "results/tree_raw.nwk" + shell: + """ + augur tree \ + --alignment {input.alignment} \ + --output {output.tree} + """ + +rule refine: + """ + Refining tree + - estimate timetree + - use {params.coalescent} coalescent timescale + - estimate {params.date_inference} node dates + - filter tips more than {params.clock_filter_iqd} IQDs from clock expectation + """ + input: + tree = "results/tree_raw.nwk", + alignment = "results/aligned.fasta", + metadata = "data/metadata_all.tsv" + output: + tree = "results/tree.nwk", + node_data = "results/branch_lengths.json" + params: + coalescent = "opt", + date_inference = "marginal", + clock_filter_iqd = 4, + strain_id = config.get("strain_id_field", "strain"), + shell: + """ + augur refine \ + --tree {input.tree} \ + --alignment {input.alignment} \ + --metadata {input.metadata} \ + --metadata-id-columns {params.strain_id} \ + --output-tree {output.tree} \ + --output-node-data {output.node_data} \ + --timetree \ + --coalescent {params.coalescent} \ + --date-confidence \ + --date-inference {params.date_inference} \ + --clock-filter-iqd {params.clock_filter_iqd} + """ diff --git a/phylogenetic/rules/export.smk b/phylogenetic/rules/export.smk new file mode 100644 index 0000000..e44b8d5 --- /dev/null +++ b/phylogenetic/rules/export.smk @@ -0,0 +1,80 @@ +""" +This part of the workflow collects the phylogenetic tree and annotations to +export a Nextstrain dataset. + +REQUIRED INPUTS: + + metadata = data/metadata_all.tsv + tree = results/tree.nwk + branch_lengths = results/branch_lengths.json + node_data = results/*.json + +OUTPUTS: + + auspice_json = auspice/${build_name}.json + + There are optional sidecar JSON files that can be exported as part of the dataset. + See Nextstrain's data format docs for more details on sidecar files: + https://docs.nextstrain.org/page/reference/data-formats.html + +This part of the workflow usually includes the following steps: + + - augur export v2 + - augur frequencies + +See Augur's usage docs for these commands for more details. +""" + +rule export: + """Exporting data files for for auspice""" + input: + tree = "results/tree.nwk", + metadata = "data/metadata_all.tsv", + branch_lengths = "results/branch_lengths.json", + traits = "results/traits.json", + nt_muts = "results/nt_muts.json", + aa_muts = "results/aa_muts.json", + colors = "config/colors.tsv", + auspice_config = "config/auspice_config.json", + description = "config/description.md" + output: + auspice_json = "results/raw_zika.json", + root_sequence = "results/raw_zika_root-sequence.json", + params: + strain_id = config.get("strain_id_field", "strain"), + shell: + """ + augur export v2 \ + --tree {input.tree} \ + --metadata {input.metadata} \ + --metadata-id-columns {params.strain_id} \ + --node-data {input.branch_lengths} {input.traits} {input.nt_muts} {input.aa_muts} \ + --colors {input.colors} \ + --auspice-config {input.auspice_config} \ + --description {input.description} \ + --include-root-sequence \ + --output {output.auspice_json} + """ + +rule final_strain_name: + input: + auspice_json="results/raw_zika.json", + metadata="data/metadata_all.tsv", + root_sequence="results/raw_zika_root-sequence.json", + output: + auspice_json="auspice/zika.json", + root_sequence="auspice/zika_root-sequence.json", + params: + strain_id=config["strain_id_field"], + display_strain_field=config.get("display_strain_field", "strain"), + shell: + """ + python3 scripts/set_final_strain_name.py \ + --metadata {input.metadata} \ + --metadata-id-columns {params.strain_id} \ + --input-auspice-json {input.auspice_json} \ + --display-strain-name {params.display_strain_field} \ + --output {output.auspice_json} + + cp {input.root_sequence} {output.root_sequence} + """ diff --git a/phylogenetic/rules/prepare_sequences.smk b/phylogenetic/rules/prepare_sequences.smk new file mode 100644 index 0000000..2a11420 --- /dev/null +++ b/phylogenetic/rules/prepare_sequences.smk @@ -0,0 +1,104 @@ +""" +This part of the workflow prepares sequences for constructing the phylogenetic tree. + +REQUIRED INPUTS: + + metadata_url = url to metadata.tsv.zst + sequences_url = url to sequences.fasta.zst + reference = path to reference sequence or genbank + +OUTPUTS: + + prepared_sequences = results/aligned.fasta + +This part of the workflow usually includes the following steps: + + - augur index + - augur filter + - augur align + - augur mask + +See Augur's usage docs for these commands for more details. +""" + +rule download: + """Downloading sequences and metadata from data.nextstrain.org""" + output: + sequences = "data/sequences.fasta.zst", + metadata = "data/metadata.tsv.zst" + params: + sequences_url = "https://data.nextstrain.org/files/zika/sequences.fasta.zst", + metadata_url = "https://data.nextstrain.org/files/zika/metadata.tsv.zst" + shell: + """ + curl -fsSL --compressed {params.sequences_url:q} --output {output.sequences} + curl -fsSL --compressed {params.metadata_url:q} --output {output.metadata} + """ + +rule decompress: + """Decompressing sequences and metadata""" + input: + sequences = "data/sequences.fasta.zst", + metadata = "data/metadata.tsv.zst" + output: + sequences = "data/sequences.fasta", + metadata = "data/metadata.tsv" + shell: + """ + zstd -d -c {input.sequences} > {output.sequences} + zstd -d -c {input.metadata} > {output.metadata} + """ + +rule filter: + """ + Filtering to + - {params.sequences_per_group} sequence(s) per {params.group_by!s} + - from {params.min_date} onwards + - excluding strains in {input.exclude} + - minimum genome length of {params.min_length} (50% of Zika virus genome) + """ + input: + sequences = "data/sequences_all.fasta", + metadata = "data/metadata_all.tsv", + exclude = "config/dropped_strains.txt", + output: + sequences = "results/filtered.fasta" + params: + group_by = "country year month", + sequences_per_group = 40, + min_date = 2012, + min_length = 5385, + strain_id = config.get("strain_id_field", "strain"), + shell: + """ + augur filter \ + --sequences {input.sequences} \ + --metadata {input.metadata} \ + --metadata-id-columns {params.strain_id} \ + --exclude {input.exclude} \ + --output {output.sequences} \ + --group-by {params.group_by} \ + --sequences-per-group {params.sequences_per_group} \ + --min-date {params.min_date} \ + --min-length {params.min_length} + """ + +rule align: + """ + Aligning sequences to {input.reference} + - filling gaps with N + """ + input: + sequences = "results/filtered.fasta", + reference = "config/zika_reference.gb" + output: + alignment = "results/aligned.fasta" + shell: + """ + augur align \ + --sequences {input.sequences} \ + --reference-sequence {input.reference} \ + --output {output.alignment} \ + --fill-gaps \ + --remove-reference + """ \ No newline at end of file diff --git a/phylogenetic/rules/usvi.smk b/phylogenetic/rules/usvi.smk new file mode 100644 index 0000000..5ae8b3d --- /dev/null +++ b/phylogenetic/rules/usvi.smk @@ -0,0 +1,52 @@ +rule download_usvi: + """Downloading sequences and metadata from data.nextstrain.org""" + output: + sequences = "data/sequences_usvi.fasta.zst", + metadata = "data/metadata_usvi.tsv.zst" + params: + sequences_url = "https://data.nextstrain.org/files/zika/sequences_usvi.fasta.zst", + metadata_url = "https://data.nextstrain.org/files/zika/metadata_usvi.tsv.zst" + shell: + """ + curl -fsSL --compressed {params.sequences_url:q} --output {output.sequences} + curl -fsSL --compressed {params.metadata_url:q} --output {output.metadata} + """ + +rule decompress_usvi: + """Decompressing sequences and metadata""" + input: + sequences = "data/sequences_usvi.fasta.zst", + metadata = "data/metadata_usvi.tsv.zst" + output: + sequences = "data/sequences_usvi.fasta", + metadata = "data/metadata_usvi.tsv" + shell: + """ + zstd -d -c {input.sequences} > {output.sequences} + zstd -d -c {input.metadata} > {output.metadata} + """ + +rule append_usvi: + """Appending USVI sequences""" + input: + sequences = "data/sequences.fasta", + metadata = "data/metadata.tsv", + usvi_sequences = "data/sequences_usvi.fasta", + usvi_metadata = "data/metadata_usvi.tsv" + output: + sequences = "data/sequences_all.fasta", + metadata = "data/metadata_all.tsv" + shell: + """ + cat {input.sequences} {input.usvi_sequences} > {output.sequences} + + csvtk mutate2 -tl \ + -n url \ + -e '"https://www.ncbi.nlm.nih.gov/nuccore/" + $genbank_accession' \ + {input.metadata} \ + | csvtk mutate2 -tl \ + -n accession \ + -e '$genbank_accession' \ + | csvtk concat -tl - {input.usvi_metadata} \ + > {output.metadata} + """ \ No newline at end of file diff --git a/scripts/check-countries-have-colors.sh b/phylogenetic/scripts/check-countries-have-colors.sh similarity index 100% rename from scripts/check-countries-have-colors.sh rename to phylogenetic/scripts/check-countries-have-colors.sh diff --git a/phylogenetic/scripts/set_final_strain_name.py b/phylogenetic/scripts/set_final_strain_name.py new file mode 100644 index 0000000..d104ca1 --- /dev/null +++ b/phylogenetic/scripts/set_final_strain_name.py @@ -0,0 +1,51 @@ +import pandas as pd +import json, argparse +from augur.io import read_metadata + +def replace_name_recursive(node, lookup, saveoldcolumn): + if node["name"] in lookup: + if saveoldcolumn == "accession": + node["node_attrs"][saveoldcolumn] = node["name"] + elif saveoldcolumn == "genbank_accession": + node["node_attrs"][saveoldcolumn] = {} + node["node_attrs"][saveoldcolumn]["value"] = node["name"] + else: + node["node_attrs"][saveoldcolumn] = node["name"] + + node["name"] = lookup[node["name"]] + + if "children" in node: + for child in node["children"]: + replace_name_recursive(child, lookup, saveoldcolumn) + +if __name__=="__main__": + parser = argparse.ArgumentParser( + description="Swaps out the strain names in the Auspice JSON with the final strain name", + formatter_class=argparse.ArgumentDefaultsHelpFormatter + ) + + parser.add_argument('--input-auspice-json', type=str, required=True, help="input auspice_json") + parser.add_argument('--metadata', type=str, required=True, help="input data") + parser.add_argument('--metadata-id-columns', nargs="+", help="names of possible metadata columns containing identifier information, ordered by priority. Only one ID column will be inferred.") + parser.add_argument('--display-strain-name', type=str, required=True, help="field to use as strain name in auspice") + parser.add_argument('--output', type=str, metavar="JSON", required=True, help="output Auspice JSON") + args = parser.parse_args() + + metadata = read_metadata(args.metadata, id_columns=args.metadata_id_columns) + + if args.display_strain_name in metadata.columns: + name_lookup = {} + for ri, row in metadata.iterrows(): + strain_id = row.name + name_lookup[strain_id] = args.display_strain_name if pd.isna(row[args.display_strain_name]) else row[args.display_strain_name] + + with open(args.input_auspice_json, 'r') as fh: + data = json.load(fh) + + replace_name_recursive(data['tree'], name_lookup, args.metadata_id_columns[0]) + else: + with open(args.input_auspice_json, 'r') as fh: + data = json.load(fh) + + with open(args.output, 'w') as fh: + json.dump(data, fh, allow_nan=False, indent=None, separators=",:")