diff --git a/MANIFEST.in b/MANIFEST.in index 6489dac..452a986 100644 --- a/MANIFEST.in +++ b/MANIFEST.in @@ -6,3 +6,6 @@ recursive-include tests/data/allele_resolution *.fasta *.vcf *.txt *.md recursive-include scripts *.py recursive-include tests/data/additional_svs *.bam *.bai *.md +recursive-include tests/data/comprehensive *.json.gz *.md +recursive-include tests/data/evidence-overlap *.bam *.md +recursive-include tests/data/retrieval *.bam *.bai *.md diff --git a/docs/changelog.md b/docs/changelog.md index 005c70a..2ab03dc 100644 --- a/docs/changelog.md +++ b/docs/changelog.md @@ -5,9 +5,28 @@ your version with `osteosarc --version`. Pin both the package version and your snapshot (by name or download date) for reproducible analyses. Full release notes are on [GitHub](https://github.com/iskandr/osteosarc/releases). -## Unreleased - +## 0.15.0 (2026-09-29) + +- `subset_bundle` and `test-data make --from` carve out members offline while + preserving original source headers, acquisition receipts and selection results (#90). +- New `sv-regressions-v2` panel supplies the three Isovar fusions' retained sides; + newly requested fusion bundles use it. Published v1 panels and bundles stay unchanged (#96). +- Historical retrieval cases have verified native coordinates, exact BAM contig names, + mitochondrial reference identity and a guard against incompatible merges (#99). +- Reviewed Tempus evidence overlap is available on files and file selections, with + explicit preference required to exclude one product. Both original labels and + acquisition receipts remain intact; the true sample identity is still unresolved (#100). - Python 3.14 support: the tests run on Python 3.9 to 3.14. +- Comprehensive vaccine/RNA test corpus: 51 vaccine-associated variants from the + union of membership sources, a complete per-BAM support matrix, four + DNA-supported SNVs with zero reported RNA alternate reads, a historical RNA + disagreement case, frameshifts and SV evidence. Its + openvax-v3 read specification is an unpublished candidate. +- Shared read builds can checkpoint completed source selections and set their + supplementary-alignment depth and region limits explicitly in the spec. +- Compact carry-forward preserves query positions for placed-unmapped records. + Comprehensive control audits verify source URLs and BAM/index checksums against + acquisition receipts; packaged RNA-support claims follow the actual recounts. ## 0.14.4 (2026-09-28) diff --git a/docs/samples.md b/docs/samples.md index ee5f662..ac5cf51 100644 --- a/docs/samples.md +++ b/docs/samples.md @@ -1,5 +1,33 @@ # Samples and files +## Known overlapping RNA evidence + +The reprocessed Tempus ALMY2X4KMV and KCVBE1UI1P products overlap almost completely +in the audited vaccine regions: 18,971 shared read names and 40,684 matching core +alignment records out of 40,696 per file, including base qualities. They must not +be counted as independent RNA evidence. This is a regional observation, not proof +that the full libraries are identical or that either biological sample label is correct. +See [the provenance investigation](https://github.com/iskandr/osteosarc/issues/100). + +Each `file.evidence_overlaps` lists reviewed relationships for its exact product +URL. A selection's `files.overlap_groups` reports pairs present together, and +`files.require_no_known_overlaps()` raises before they can be used as independent +evidence. To keep one explicitly, call +`files.without_known_overlaps(prefer=[chosen_url])`. The returned selection records +every exclusion in `files.source["excluded_evidence_overlaps"]`; original labels, +sample claims and receipts remain unchanged. No listed overlap means no reviewed +overlap is known, not proof of independence. + +The published FASTQ catalogue already identifies KCVBE1UI1P as a duplicate delivery +of ALMY2X4KMV RNA. Corresponding mate objects also have matching lengths and multipart +ETags (server metadata, not whole-file SHA-256 hashes). The overlap registry preserves +that source receipt and the object metadata. The existing `tempus-file-labels` +curation disputes the published T1 timepoint: several observations point to T0, but +do not establish the specimen conclusively. Resolving that still requires specimen +documentation; neither the alias nor this audit silently changes the timepoint. + +## Catalogue + - **Samples** are what was collected: tumor biopsies and resections at time points T0 to T3, an organoid grown from the T1 tumor, and blood draws. - **Files** are what's in the public S3 bucket: aligned reads (BAMs), raw reads diff --git a/docs/test-data.md b/docs/test-data.md index cc26f97..91e443a 100644 --- a/docs/test-data.md +++ b/docs/test-data.md @@ -77,6 +77,54 @@ instead, use `osteosarc test-data export`. ## Shared test data +To carve out a library's members without reacquiring its source BAMs: + + +```sh +osteosarc test-data make isovar-subset --from openvax-v2 --member isovar/ +``` + +The Python equivalent is `osteosarc.subset_bundle(bundle, members, destination)`; +`members` contains exact names, whereas the CLI accepts prefixes. This keeps the +original source headers, acquisition receipts, selection outcomes and record +multiplicities, and pins the parent manifest checksum. Empty, unresolved and +omitted members retain their status. A local bundle needs no network access. + +New fusion requests use `sv-regressions-v2`. Its GABBR1--SLC29A1 and OTUD7A--FMN1 +breakends retain right/right; PARD3B--CDKN2B retains left/right. The versioned v1 +panel and already published bundles retain their original metadata. + +### Historical retrieval cases + +The 49 `shared-v1` cases are small indexed-retrieval examples. They use five BAM +reference dictionaries and **cannot all be merged and queried under one genome +build or contig naming convention**. Their `variant_id` is the catalogue identity; +it is not necessarily the coordinate in the BAM. Read the reviewed metadata with +`osteosarc.retrieval.load_retrieval_cases()`, query each original BAM using its +`query_region`, and use `assert_compatible_retrieval_cases(cases)` before a raw merge. +Matching dictionaries establish coordinate compatibility, not sample independence. + +| Case | Catalogue position | Native BAM query | Nuclear assembly | Mitochondrial reference | +| --- | --- | --- | --- | --- | +| 44, MT-ND5 / Tempus | chrM:12994 | MT:12994 | GRCh37 | rCRS, 16,569 bases; validation uses hg38 chrM | +| 45, MT-ND5 / CeGaT | chrM:12994 | chrM:12995 | GRCh37 | UCSC hg19 chrM, 16,571 bases | +| 48, NR2F2 / CeGaT | chr15:96332299 | chr15:96875528 | GRCh37 | Not applicable | + +Positions in this table are one-based; `query_region` is zero-based and half-open. +The new `native-retrieval-v1` metadata preserves the original cases, validation +receipts and BAM checksums. `annotate_retrieval_manifest(manifest, directory)` +reproduces it from an existing export, checking every asset and native indexed +query. No BAM or historical manifest is silently rewritten or lifted over. + +### Comprehensive corpus + +For the comprehensive vaccine/RNA candidate, see the +[frozen corpus and build instructions](https://github.com/iskandr/osteosarc/tree/main/tests/data/comprehensive). +It includes the union of all vaccine membership sources (51 variants in the +2026-09-28 snapshot), the full per-BAM support matrix, RNA-negative DNA-positive +SNV controls, frameshifts and structural candidates. Its local openvax-v3 build +preserves openvax-v2's library fixtures; it is not yet a published bundle. + Isovar, Topiary, Varcode and Vaxrank can all test against one bundle of reads, openvax-v2, chosen once, here. It holds: diff --git a/osteosarc/__init__.py b/osteosarc/__init__.py index 85aba4b..e7f8dab 100644 --- a/osteosarc/__init__.py +++ b/osteosarc/__init__.py @@ -18,6 +18,7 @@ export_bundle, generate_bundle, list_bundle, + subset_bundle, verify_bundle, verify_digest, verify_gzip_digests, @@ -56,7 +57,7 @@ from .sv_candidates import load_sv_candidates from .timeline import Event, Timeline -__version__ = "0.14.4" +__version__ = "0.15.0" # The public API. A few other helpers are importable from here because the OpenVax # libraries use them (digest, parse_variants, inspect_alignment, ...); everything @@ -68,7 +69,7 @@ # Reads and test data "extract_reads", "ReadFilter", "ReadSubset", "RecoveryPolicy", "bundle_file", "fetch_bundle", "list_bundle", "export_bundle", "check_fixtures", "verify_bundle", - "generate_bundle", "validate_recipe", + "generate_bundle", "subset_bundle", "validate_recipe", "load_panel", "load_sv_candidates", # Corrections diff --git a/osteosarc/bundles.py b/osteosarc/bundles.py index c341c34..fb6ab62 100644 --- a/osteosarc/bundles.py +++ b/osteosarc/bundles.py @@ -14,7 +14,7 @@ from .cache import Cache, digest, file_lock, is_sha256, stable_id, write_json from .errors import IntegrityError, SchemaError -from .fixtures import select_fixtures, validate_recipe +from .fixtures import FixtureSelection, select_fixtures, validate_recipe from .models import File, Region from .reads import extract_reads from .records import RECORD_ENCODING, read_records, record_multiset @@ -339,6 +339,46 @@ def list_bundle(bundle, *, cache=None): return verify_bundle(bundle, cache=cache)["members"] +def subset_bundle(bundle, members, destination, *, recipe_id=None, cache=None, + size_budget=DEFAULT_SIZE_BUDGET): + """Repack named members offline, preserving original headers and receipts. + + Members are exact names, including empty, omitted and unresolved members. + Selection policies are not rerun: their recorded outcomes and reasons survive + unchanged. Only referenced sources, targets and record occurrences are kept. + The parent manifest checksum pins the provenance of this subset. A published + bundle name is downloaded on first use; a local folder needs no cache/network. + """ + if isinstance(members, (str, bytes)): + raise TypeError("members must be an iterable of exact member names, not a string") + names = sorted(set(members)) + root = _folder(bundle, cache) + manifest = verify_bundle(root) + if missing := set(names) - manifest["members"].keys(): + raise KeyError(f"Unknown bundle members: {sorted(missing)}") + recipe = json.loads((root / "recipe.json").read_text()) + recipe["id"] = recipe_id if recipe_id is not None else recipe["id"] + "-subset-" + stable_id(names)[:12] + recipe["members"] = {name: recipe["members"][name] for name in names} + for section, field in (("sources", "source"), ("targets", "target")): + needed = {m[field] for m in recipe["members"].values()} + recipe[section] = {key: value for key, value in recipe[section].items() if key in needed} + recipe = validate_recipe(recipe) + selected = {name: copy.deepcopy(manifest["members"][name]) for name in names} + active = {m["source"] for m in selected.values() if m["status"] not in ("omitted", "unresolved")} + headers, records = {}, {} + for sid in sorted(active): + source = manifest["sources"][sid] + headers[sid] = json.loads(safe_path(root, source["original_header"]).read_text()) + records[sid] = list(read_records(safe_path(root, source["bam"]))) + receipts = json.loads((root / "acquisition.json").read_text()) + selection = FixtureSelection(recipe, selected, headers, records, + {sid: value for sid, value in receipts.items() if sid in recipe["sources"]}) + return pack_bundle(selection, destination, header_policy=manifest["header_policy"], + size_budget=size_budget, + parent=dict(manifest_sha256=digest(root / "manifest.json"), + recipe_sha256=manifest["recipe_sha256"])) + + def export_bundle(bundle, to, *, members=None, format="bam", cache=None): """Write a bundle's members into a folder, each as a file named after it. diff --git a/osteosarc/cli.py b/osteosarc/cli.py index 2f07a8e..a86a310 100644 --- a/osteosarc/cli.py +++ b/osteosarc/cli.py @@ -225,6 +225,10 @@ def command(name, *, data=True, epilog=None): "your newest, which must list each BAM unchanged; or give them with --source") make.add_argument("--source", action="append", default=[], metavar="ID=LOCAL_BAM", help="With --recipe: use a BAM you already have for one of its sources") + make.add_argument("--from", dest="from_bundle", metavar="BUNDLE", + help="Subset an existing bundle, keeping its original headers and acquisition receipts") + make.add_argument("--member", action="append", metavar="PREFIX", + help="With --from: keep members whose names start with this prefix; repeat for several") make.add_argument("--header-policy", choices=("full", "compact"), default="full", help="compact keeps only the header lines the records need") make.add_argument("--unplaced-mates", action="store_true", @@ -610,13 +614,36 @@ def test_data(args, cache): """test-data make, list, verify, export and check.""" from pathlib import Path - from .bundles import export_bundle, generate_bundle, list_bundle, sources_to_read, verify_bundle + from .bundles import ( + export_bundle, + generate_bundle, + list_bundle, + sources_to_read, + subset_bundle, + verify_bundle, + ) from .fixtures import validate_recipe from .shared import bundle_folder, check_fixtures, read_json from .views import plural, table action = args.test_data_command if action == "make": - if args.recipe: + if args.member and not args.from_bundle: + raise ValueError("--member goes with --from") + if args.from_bundle: + if (args.recipe or args.source or args.sources or args.variant or args.sv or args.assay + or args.platform or args.unplaced_mates or args.header_policy != "full"): + raise ValueError("--from preserves the existing bundle's selections and header policy; " + "use only --member and --size-budget") + if not args.member: + raise ValueError("--from requires at least one --member prefix") + root = bundle_folder(args.from_bundle, cache=cache) + available = list_bundle(root) + for prefix in args.member: + if not any(name.startswith(prefix) for name in available): + raise ValueError(f"No bundle member starts with {prefix!r}") + names = [name for name in available if any(name.startswith(p) for p in args.member)] + manifest = subset_bundle(root, names, args.output, size_budget=args.size_budget) + elif args.recipe: if args.sources or args.variant or args.sv or args.assay or args.platform or args.unplaced_mates: raise ValueError("--recipe makes the bundle from the recipe alone, which says how each BAM is read; " "drop the BAMs, --variant, --sv and --unplaced-mates") diff --git a/osteosarc/corpus.py b/osteosarc/corpus.py new file mode 100644 index 0000000..e04f642 --- /dev/null +++ b/osteosarc/corpus.py @@ -0,0 +1,328 @@ +"""Auditable evidence tables for the comprehensive regression corpus. + +Published read counts, published rounded VAFs, and balanced fixture template +counts are different measurements. Never pool them, or different processing +products of the same biological sample. A zero is only a measured zero. +""" + +from collections import Counter, defaultdict +from pathlib import Path + +from .errors import IntegrityError + +RNA_ASSAYS = {"RNA", "scRNA", "scRNA_ONT", "PacBio"} +LOW_COVERAGE_CONTROLS = ("CTSE-chr1-206022947", "DBH-chr9-133652279") +NEGATIVE_CONTROLS = ("ACE-chr17-63497361", "BTN3A3-chr6-26448446", *LOW_COVERAGE_CONTROLS) +DISCORDANCE_CONTROLS = ("NR2F2-chr15-96332299",) +AUDIT_SNVS = (*NEGATIVE_CONTROLS, *DISCORDANCE_CONTROLS) +CONTROL_THRESHOLDS = dict(tumor_depth=50, tumor_alt=10, tumor_vaf=0.10, + normal_depth=30, normal_max_vaf=0.01, rna_ref=20) +COUNT_FIELDS = ("ref_reads", "alt_reads", "other_reads", "total_reads") + + +def verify_control_extracts(output, control): + """Bind each control's source and delivered BAM/index to its acquisition receipt. + + Recounting verifies the bases in an extract, not which source supplied them. + Both corpus audits use these checks before attributing counts to a product. + Receipts remain evidence of acquisition, not proof of biological identity. + """ + from .bundles import safe_path, verify_manifest_files + + directory = Path(output) / "controls" + files = control["files"] + verify_manifest_files(directory, files) + sources = {} + for row in control["audits"]: + source = row["source"] + identity = (row["source_url"], row["extract_file"], row["source_extract_sha256"]) + if source in sources and sources[source] != identity: + raise IntegrityError(f"Conflicting control source/extract: {source}") + sources[source] = identity + if set(sources) != set(control["acquisition"]): + raise IntegrityError("Control sources differ from acquisition receipts") + if len({identity[0] for identity in sources.values()}) != len(sources): + raise IntegrityError("Multiple control labels refer to the same source URL") + used = set() + for source, (url, filename, checksum) in sources.items(): + receipt = control["acquisition"][source] + request = receipt.get("request", {}) + if request.get("source") != url: + raise IntegrityError(f"Control source URL differs from acquisition receipt: {source}") + if request.get("snapshot_id") != control["snapshot"]["id"]: + raise IntegrityError(f"Control snapshot differs from acquisition receipt: {source}") + path = safe_path(output, filename) + if path.parent != directory: + raise IntegrityError(f"Control extract must be in controls/: {filename}") + bam, index = path.name, path.name + ".bai" + acquired = receipt.get("files", {}) + if not checksum or checksum != files.get(bam) or checksum != acquired.get("reads.bam"): + raise IntegrityError(f"Control BAM differs from acquisition receipt: {source}") + if not files.get(index) or files[index] != acquired.get("reads.bam.bai"): + raise IntegrityError(f"Control index differs from acquisition receipt: {source}") + used.update((bam, index)) + if used != set(files): + raise IntegrityError("Control file inventory differs from the audited BAM/index pairs") + + +def counts(row): + """Validate published counts; unknown counts stay None, never zero.""" + result = {} + for key in COUNT_FIELDS: + value = row.get(key) + if value in (None, ""): + result[key] = None + else: + try: + number = int(value) + except (ValueError, TypeError) as error: + raise IntegrityError(f"Invalid {key}: {value!r}") from error + if str(number) != str(value) or number < 0: + raise IntegrityError(f"Invalid {key}: {value!r}") + result[key] = number + if all(value is not None for value in result.values()): + if sum(result[k] for k in COUNT_FIELDS[:3]) != result["total_reads"]: + raise IntegrityError("Published ref + alt + other differs from depth") + return result + + +def support_status(values): + if any(values.get(k) is None for k in COUNT_FIELDS): + return "not_measured" + if values["total_reads"] == 0: + return "no_coverage" + if values["alt_reads"]: + return "alt_observed" + if values["ref_reads"]: + return "covered_no_alt" + return "other_only" + + +def _locus(chrom, pos): + return (str(chrom).removeprefix("chr").replace("MT", "M"), int(pos)) + + +def vaccine_membership(variants, vaccine_rows): + """Union independent vaccine assertions, preserving their disagreements. + + Each overlap row must join exactly one literal allele by locus. Duplicate + rows at the same locus (TECPR1) retain their own assertions. Neither gene + names nor protein names alone establish allele identity. + """ + loci = defaultdict(list) + result = {} + for v in variants: + if v["status"] == "ready": + chrom, pos, _, _ = v["alleles"][0] + loci[_locus(chrom, pos)].append(v["id"]) + result[v["id"]] = dict(index_count=v.get("vaccine_count"), + source_variants=list(v["annotations"].get("source_vaccines", ())), + parsed_overlap=list(v.get("vaccines", ())), overlap_rows=[]) + joined = [] + for number, row in enumerate(vaccine_rows): + matches = loci[_locus(row["chrom"], row["pos"])] + if len(matches) != 1: + raise IntegrityError(f"Vaccine row {number} ({row['gene']}) joins {len(matches)} alleles") + vid = matches[0] + result[vid]["overlap_rows"].append(number) + joined.append(dict(row, variant_id=vid, row=number)) + for vid, entry in result.items(): + overlap = {name for i in entry["overlap_rows"] for name, used in vaccine_rows[i]["vaccines"].items() + if used} + entry["overlap_union"] = sorted(overlap) + entry["vaccines_union"] = sorted(overlap | set(entry["source_variants"]) | set(entry["parsed_overlap"])) + entry["included"] = bool(entry["vaccines_union"] or (entry["index_count"] or 0) > 0) + entry["membership_disagreement"] = set(entry["source_variants"]) != overlap + return result, joined + + +def count_matrix(variants, rows): + """Complete variant × reported-BAM matrix, with explicit missing cells.""" + by_key, sources = {}, {} + source_fields = ("bam_file", "sample_label", "data_source", "pipeline", "assay_type", + "timepoint", "tissue", "sample_date") + for row in rows: + key = row["variant_id"], row["bam_file"] + if key in by_key: + raise IntegrityError(f"Duplicate evidence row: {key}") + by_key[key] = row + source = {k: row.get(k, "") for k in source_fields} + if row["bam_file"] in sources and sources[row["bam_file"]] != source: + raise IntegrityError(f"Conflicting source metadata: {row['bam_file']}") + sources[row["bam_file"]] = source + known = {v["id"] for v in variants} + if set(vid for vid, _ in by_key) - known: + raise IntegrityError("Count table contains variants missing from the catalogue") + matrix = [] + for v in sorted(variants, key=lambda v: v["id"]): + for bam, source in sorted(sources.items()): + row = by_key.get((v["id"], bam)) + numbers = counts(row or {}) + status = support_status(numbers) + if v["status"] != "ready": + status = "unresolved_allele" + elif row and status != "not_measured": + actual = [row["chrom"], int(row["pos"]), row["ref"], row["alt"]] + if actual != list(v["alleles"][0]): + raise IntegrityError(f"Counts are for another allele: {v['id']} / {bam}") + matrix.append(dict(variant_id=v["id"], **source, **numbers, status=status, + reported_vaf=(row or {}).get("vaf") or None, + corrections=(row or {}).get("corrections", ""), + row_present=row is not None, evidence="published_allele_counts")) + return matrix, sources + + +def negative_controls(variants, matrix, ids=NEGATIVE_CONTROLS): + """Require DNA support and matched-normal evidence, with explicit RNA coverage. + + ALL reported tumor RNA products must have measured zero alternate reads. + Products are never summed or counted as independent replicates. + """ + by_variant = defaultdict(list) + for row in matrix: + by_variant[row["variant_id"]].append(row) + by_id = {v["id"]: v for v in variants} + result = [] + t = CONTROL_THRESHOLDS + for vid in ids: + v = by_id[vid] + if v["status"] != "ready" or any(len(a) != 1 for a in v["alleles"][0][2:]): + raise IntegrityError(f"Negative control is not a literal SNV: {vid}") + rows = by_variant[vid] + rna = [r for r in rows if r["assay_type"] in RNA_ASSAYS and r["tissue"] == "tumor"] + if not rna or any(r["alt_reads"] != 0 or r["status"] == "not_measured" for r in rna): + raise IntegrityError(f"Negative control has alternate or unmeasured RNA evidence: {vid}") + low_coverage = vid in LOW_COVERAGE_CONTROLS + if low_coverage and max(r["ref_reads"] for r in rna) >= t["rna_ref"]: + raise IntegrityError(f"Low-coverage control now has covered RNA: {vid}") + good_dna = [r for r in rows if r["assay_type"] in {"WGS", "WES"} and r["tissue"] == "tumor" + and r["status"] == "alt_observed" and r["total_reads"] >= t["tumor_depth"] + and r["alt_reads"] >= t["tumor_alt"] + and r["alt_reads"] / r["total_reads"] >= t["tumor_vaf"]] + matches = [] + for dna in good_dna: + normal = [r for r in rows if r["tissue"] == "blood" and r["assay_type"] == dna["assay_type"] + and r["timepoint"] == dna["timepoint"] and r["data_source"] == dna["data_source"] + and r["status"] in {"covered_no_alt", "alt_observed"} + and r["total_reads"] >= t["normal_depth"] + and r["alt_reads"] / r["total_reads"] <= t["normal_max_vaf"]] + covered = [r for r in rna if r["timepoint"] == dna["timepoint"] and r["ref_reads"] >= t["rna_ref"]] + if normal and (covered or low_coverage): + matches.append(dict(tumor_dna=dna["bam_file"], timepoint=dna["timepoint"], + normal_dna=sorted(r["bam_file"] for r in normal), + covered_rna=sorted(r["bam_file"] for r in covered))) + if not matches: + raise IntegrityError(f"No matched DNA/normal/covered-RNA comparison for {vid}") + result.append(dict(variant_id=vid, evidence="published_allele_counts", thresholds=t, + control_class="insufficient_rna_coverage" if low_coverage else "covered_rna_no_alt", + comparisons=matches, tumor_rna_products_checked=len(rna), + interpretation="No alternate RNA reads reported; not proof of absent expression.")) + return result + + +def snv_read_support(reads, position, ref, alt, *, min_mapping_quality=20, min_base_quality=20): + """Independent SNV audit of full regional extracts, before balanced sampling. + + Counts templates (RG + QNAME), collapses paired ends, and calls conflicting + observations 'other'. Missing QUAL is unknown. MAPQ 255 is accepted only with + NH:i:1 (the STAR convention), never as a numerical quality of 255. + """ + from .records import read_template + if len(ref) != 1 or len(alt) != 1: + raise ValueError("SNV audit requires single-base REF and ALT") + shown = defaultdict(set) + skipped = Counter() + for read in reads: + if read.is_unmapped or read.is_secondary or read.is_supplementary or read.is_qcfail or read.is_duplicate: + skipped["flag_filtered"] += 1 + continue + if read.mapping_quality == 255: + if not (read.has_tag("NH") and read.get_tag("NH") == 1): + skipped["unknown_mapping_quality"] += 1 + continue + elif read.mapping_quality < min_mapping_quality: + skipped["low_mapping_quality"] += 1 + continue + offsets = [q for q, r in read.get_aligned_pairs(matches_only=True) if r == position - 1] + if len(offsets) != 1 or read.query_sequence is None: + skipped["no_aligned_base"] += 1 + continue + q = offsets[0] + if read.query_qualities is None or read.query_qualities[q] == 255: + skipped["missing_base_quality"] += 1 + continue + if read.query_qualities[q] < min_base_quality: + skipped["low_base_quality"] += 1 + continue + base = read.query_sequence[q].upper() + shown[read_template(read)].add("alt" if base == alt else "ref" if base == ref else "other") + result = Counter(next(iter(values)) if len(values) == 1 else "other" for values in shown.values()) + return dict(templates={key: result[key] for key in ("alt", "ref", "other")}, + filtered_records=dict(sorted(skipped.items())), min_mapping_quality=min_mapping_quality, + min_base_quality=min_base_quality, unit="RG+QNAME", measured_before_sampling=True) + + +def evidence_catalog(inputs): + variants = inputs["variants"] + memberships, vaccine_rows = vaccine_membership(variants, inputs["vaccine_rows"]) + matrix, sources = count_matrix(variants, inputs["counts"]) + controls = negative_controls(variants, matrix) + historical = inputs.get("historical_rna", []) + historical_positive = {e["variant_id"] for e in historical if e["observed_before_sampling"].get("alt", 0) > 0} + if positive := historical_positive & set(NEGATIVE_CONTROLS): + raise IntegrityError(f"Negative controls have historical RNA support: {sorted(positive)}") + disagreements = [e for e in historical if e["variant_id"] in DISCORDANCE_CONTROLS + and e["observed_before_sampling"].get("alt", 0) > 0] + if {e["variant_id"] for e in disagreements} != set(DISCORDANCE_CONTROLS): + raise IntegrityError("The known cross-build RNA disagreement must be retained") + targets = {} + source_summaries = [] + for v in variants: + a = v["annotations"] + source = a.get("source_record", {}) + allele = list(v["alleles"][0]) if v["status"] == "ready" else None + targets[v["id"]] = dict(gene=v["gene"], assembly=v["assembly"], allele=allele, + status=v["status"], on_site=v["on_site"], + consequence=a.get("consequence"), protein_change=a.get("protein_change"), + annotated_frameshift="frameshift" in (a.get("consequence") or ""), + length_change_modulo_three=(len(allele[3]) - len(allele[2])) % 3 if allele else None, + vaccine=memberships[v["id"]], pipelines=v["pipelines"], + corrections=a.get("corrections", []), + allele_resolution=a.get("allele_resolution"), + vaccine_peptides=source.get("vaccine_peptides", []), + peptides=source.get("peptides", {}), + validation=source.get("validation", {})) + for row in source.get("vafs", []): + source_summaries.append(dict(variant_id=v["id"], **row, evidence="published_depth_and_rounded_vaf", + interpretation="Not raw allele counts; do not infer integer counts or pool products.")) + for control in controls: + control["scope"] = "The tumor RNA products in the published allele-count matrix." + control["nonzero_rna_summary_exceptions"] = [ + row for row in source_summaries if row["variant_id"] == control["variant_id"] + and row["assay"] not in {"WGS", "WES"} and (row.get("vaf") or 0) > 0] + if any(row["tissue"] == "tumor" for row in control["nonzero_rna_summary_exceptions"]): + raise IntegrityError(f"Negative control has a nonzero tumor RNA summary: {control['variant_id']}") + overlap_groups = inputs.get("evidence_overlap_registry", {}).get("groups", []) + count_sources = {k: dict(v, **inputs["count_sources"].get(k, {})) for k, v in sources.items()} + for source in count_sources.values(): + urls = {f["url"] for f in source.get("files", [])} + source["evidence_overlap_groups"] = [g["id"] for g in overlap_groups + if urls & {s["url"] for s in g["sources"]}] + if source["evidence_overlap_groups"]: + source["sample_identity_caution"] = "Published labels retained; biological specimen/timepoint unresolved." + return dict(schema_version=1, snapshot=inputs["snapshot"], provenance=inputs["provenance"], + suitable_for_abundance=False, variants=targets, vaccine_rows=vaccine_rows, + count_sources=count_sources, evidence_overlaps=overlap_groups, + allele_support=matrix, source_reported_support=source_summaries, + negative_controls=controls, samples=inputs["samples"], + historical_rna=historical, known_rna_disagreements=disagreements, + structural_candidates=inputs["structural_candidates"], + summary=dict(variants=len(targets), vaccine_variants=sum(m["included"] for m in memberships.values()), + vaccine_rows=len(vaccine_rows), count_sources=len(sources), support_cells=len(matrix), + rna_count_sources=sum(s["assay_type"] in RNA_ASSAYS for s in sources.values()), + annotated_frameshifts=sum(t["annotated_frameshift"] for t in targets.values()), + structural_candidates=len(inputs["structural_candidates"]["targets"]), + samples=len(inputs["samples"]), source_summary_rows=len(source_summaries), + source_summary_products=len({r["sample"] for r in source_summaries}), + statuses=dict(Counter(r["status"] for r in matrix)), + negative_controls=len(controls))) diff --git a/osteosarc/data/evidence-overlaps.json b/osteosarc/data/evidence-overlaps.json new file mode 100644 index 0000000..1179eea --- /dev/null +++ b/osteosarc/data/evidence-overlaps.json @@ -0,0 +1,183 @@ +{ + "groups": [ + { + "audit": { + "different_a": 12, + "different_b": 12, + "names_a": 18971, + "names_b": 18971, + "read_groups_a": [ + { + "ID": "TL-24-ALMY2X4KMV", + "SM": "TL-24-ALMY2X4KMV" + } + ], + "read_groups_b": [ + { + "ID": "TL-24-KCVBE1UI1P", + "SM": "TL-24-KCVBE1UI1P" + } + ], + "records_a": 40696, + "records_b": 40696, + "shared_names": 18971, + "shared_records_excluding_tags": 40684, + "union_names": 18971 + }, + "evidence_date": "2026-09-28", + "id": "tempus-almy-kcv-regional-v1", + "interpretation": "Do not treat these products as independent RNA evidence. Original labels and receipts are retained. Choosing one for analysis does not establish the correct sample identity.", + "issue": "https://github.com/iskandr/osteosarc/issues/100", + "provenance_gap": "Duplicate delivery is explicitly documented and supported by matching FASTQ object metadata and regional alignment content. The biological specimen/timepoint remains disputed by the existing tempus-file-labels curation; preserve published labels until specimen-level documentation resolves it.", + "published_delivery_alias": { + "evidence": "The published FASTQ catalogue identifies KCVBE1UI1P as a duplicate delivery of ALMY2X4KMV RNA. Corresponding mate objects have equal byte lengths and equal multipart ETags. ETags are recorded as server metadata, not claimed to be whole-file MD5/SHA-256 hashes.", + "object_metadata_checked_at": "2026-09-29T13:50:42.767541+00:00", + "objects": [ + { + "headers": { + "Content-Length": "680558575", + "ETag": "\"acee7145ec61f38fa7b9ea30a7adc3b5-82\"", + "Last-Modified": "Mon, 20 Jul 2026 22:47:27 GMT", + "x-amz-checksum-sha256": null + }, + "label": "TL-24-ALMY2X4KMV", + "mate": "1", + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/tempus/TL-24-ALMY2X4KMV/RNA/FastQ/TL-24-ALMY2X4KMV_T_RSQ1_1.fastq.gz" + }, + { + "headers": { + "Content-Length": "697402401", + "ETag": "\"41da6be7e63ac1aa83a72890686f6be1-84\"", + "Last-Modified": "Mon, 20 Jul 2026 22:48:53 GMT", + "x-amz-checksum-sha256": null + }, + "label": "TL-24-ALMY2X4KMV", + "mate": "3", + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/tempus/TL-24-ALMY2X4KMV/RNA/FastQ/TL-24-ALMY2X4KMV_T_RSQ1_3.fastq.gz" + }, + { + "headers": { + "Content-Length": "680558575", + "ETag": "\"acee7145ec61f38fa7b9ea30a7adc3b5-82\"", + "Last-Modified": "Mon, 20 Jul 2026 22:50:40 GMT", + "x-amz-checksum-sha256": null + }, + "label": "TL-24-KCVBE1UI1P", + "mate": "1", + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/tempus/TL-24-KCVBE1UI1P/RNA/FastQ/TL-24-KCVBE1UI1P_T_RSQ1_1.fastq.gz" + }, + { + "headers": { + "Content-Length": "697402401", + "ETag": "\"41da6be7e63ac1aa83a72890686f6be1-84\"", + "Last-Modified": "Mon, 20 Jul 2026 22:50:44 GMT", + "x-amz-checksum-sha256": null + }, + "label": "TL-24-KCVBE1UI1P", + "mate": "3", + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/tempus/TL-24-KCVBE1UI1P/RNA/FastQ/TL-24-KCVBE1UI1P_T_RSQ1_3.fastq.gz" + } + ], + "source": { + "receipt": { + "etag": "\"34794b7fe02affb3c5495f6391145e6d\"", + "filename": "fastqs-consolidated.tsv", + "last_modified": null, + "md5": null, + "retrieved_at": "2026-09-28T03:09:35.249736+00:00", + "sha256": "d5ba79663f1af7fe6faa370698f82d70bbd883693cb7d5404c1d094856363cbf", + "size": 54606, + "url": "https://gitlab.com/slowkow/osteosarc.com/-/raw/main/scripts/data/fastqs-consolidated.tsv" + }, + "rows": [ + { + "analyst": "", + "assay": "RNA", + "b2_folder": "", + "display_name": "T1 Tempus Tumor RNA 2024-06 (TL-24-ALMY2X4KMV)", + "file_count": "2", + "is_primary": "", + "is_superseded_by": "", + "notes": "Tempus ID: TL-24-ALMY2X4KMV", + "provider": "Tempus", + "s3_folder": "rna-seq/tempus/TL-24-ALMY2X4KMV/RNA", + "sample_date": "2024-06", + "sample_id": "T1_tumor", + "timepoint": "T1", + "tissue": "Tumor", + "total_size_bytes": "1238829178", + "total_size_human": "1.15 GiB" + }, + { + "analyst": "", + "assay": "RNA", + "b2_folder": "", + "display_name": "T1 Tempus Tumor RNA 2024-06 (TL-24-ALMY2X4KMV vendor)", + "file_count": "2", + "is_primary": "", + "is_superseded_by": "", + "notes": "RNA mates are _1/_3 (_2 was the index read). Byte-identical to the catalog copy under rna-seq/tempus/TL-24-ALMY2X4KMV/RNA/.", + "provider": "Tempus", + "s3_folder": "vendor/tempus/TL-24-ALMY2X4KMV/RNA/FastQ", + "sample_date": "2024-06", + "sample_id": "T1_tumor", + "timepoint": "T1", + "tissue": "Tumor", + "total_size_bytes": "1377960976", + "total_size_human": "1.28 GiB" + }, + { + "analyst": "", + "assay": "RNA", + "b2_folder": "", + "display_name": "T1 Tempus Tumor RNA 2024-06 (TL-24-KCVBE1UI1P vendor)", + "file_count": "2", + "is_primary": "", + "is_superseded_by": "", + "notes": "Duplicate delivery of TL-24-ALMY2X4KMV RNA -- identical content, different md5 sidecars because they were hashed after renaming. Do not count as an independent library.", + "provider": "Tempus", + "s3_folder": "vendor/tempus/TL-24-KCVBE1UI1P/RNA/FastQ", + "sample_date": "2024-06", + "sample_id": "T1_tumor", + "timepoint": "T1", + "tissue": "Tumor", + "total_size_bytes": "1377960976", + "total_size_human": "1.28 GiB" + } + ] + } + }, + "related_curation": [ + "tempus-file-labels", + "tempus-timepoint" + ], + "scope": "44 vaccine loci with 2000-base flanks and fetched mates; no whole-library identity claim", + "sources": [ + { + "id": "e5c28abdbf307d55", + "regional_bam": "e5c28abdbf307d55.bam", + "regional_bam_sha256": "c6af0965958b55954757945dbd0125eb0b452d60b1c9038bf980621852831f95", + "remote_identity": { + "content-length": "1518846497", + "etag": "\"9f88b09613aebf4c1e6e17c120b435c7-290\"", + "last-modified": "Wed, 03 Jun 2026 17:42:55 GMT" + }, + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam" + }, + { + "id": "c75479dce2b07bbf", + "regional_bam": "c75479dce2b07bbf.bam", + "regional_bam_sha256": "333b459db4357990cabe80beb361af9279c8e95cd7c9a604216dfcce47be7065", + "remote_identity": { + "content-length": "1518873721", + "etag": "\"d4b0ef9bcd9305357dbd3f4b0e79f208-290\"", + "last-modified": "Wed, 03 Jun 2026 21:50:31 GMT" + }, + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam" + } + ], + "status": "biological_identity_unresolved" + } + ], + "schema_version": 1 +} diff --git a/osteosarc/data/retrieval-cases.json b/osteosarc/data/retrieval-cases.json new file mode 100644 index 0000000..e0722c2 --- /dev/null +++ b/osteosarc/data/retrieval-cases.json @@ -0,0 +1,4142 @@ +{ + "acquisition": "osteosarc; current extraction receipts are in ../../provenance.json", + "assets": [ + { + "bundle_path": "osteosarc/shared-v1/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam", + "filename": "00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam", + "sha256": "5e95118af62ea8d000100a87d0c0ed0d571045f320d63375e58969bd4ff1fa63", + "size_bytes": 4179 + }, + { + "bundle_path": "osteosarc/shared-v1/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai", + "filename": "00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai", + "sha256": "11d1472317a1d8dac7285f71b04a777337f76397a30226097100929fc1d628f2", + "size_bytes": 75480 + }, + { + "bundle_path": "osteosarc/shared-v1/01-ADGRF5-chr6-46856758-f30f618fb76a0e49.bam", + "filename": "01-ADGRF5-chr6-46856758-f30f618fb76a0e49.bam", + "sha256": "70b0cc5d88f6e83d7efa1bd2d651ea146c3f5716208adcf3ae874e1b2a77549e", + "size_bytes": 4109 + }, + { + "bundle_path": "osteosarc/shared-v1/01-ADGRF5-chr6-46856758-f30f618fb76a0e49.bam.bai", + "filename": "01-ADGRF5-chr6-46856758-f30f618fb76a0e49.bam.bai", + "sha256": "17706bfb94da50f54cecfeaa584931bdbe70fcfc37554c6b339e4d4cacea7e98", + "size_bytes": 24520 + }, + { + "bundle_path": "osteosarc/shared-v1/02-ATRX-chrX-77599465-1b66c15da594a3ef.bam", + "filename": "02-ATRX-chrX-77599465-1b66c15da594a3ef.bam", + "sha256": "1f32b1039121f81460489676a097811084158f8a871620bdee05cef9be93163b", + "size_bytes": 30638 + }, + { + "bundle_path": "osteosarc/shared-v1/02-ATRX-chrX-77599465-1b66c15da594a3ef.bam.bai", + "filename": "02-ATRX-chrX-77599465-1b66c15da594a3ef.bam.bai", + "sha256": "9a26b1d2bb372bcf0a54b851e3cf3efba3a2a363edb9056ffdf6784e5019b09b", + "size_bytes": 60208 + }, + { + "bundle_path": "osteosarc/shared-v1/03-BMP1-chr8-22192067-53f498a544883d51.bam", + "filename": "03-BMP1-chr8-22192067-53f498a544883d51.bam", + "sha256": "03239135fe4251ba6ea6bfe7f3615b0895c5af5adb33f81e9e75f85d6a8387af", + "size_bytes": 22089 + }, + { + "bundle_path": "osteosarc/shared-v1/03-BMP1-chr8-22192067-53f498a544883d51.bam.bai", + "filename": "03-BMP1-chr8-22192067-53f498a544883d51.bam.bai", + "sha256": "dd284ca8da481b9763312582fe2715daa754fbc63e4081950911910019db204b", + "size_bytes": 12480 + }, + { + "bundle_path": "osteosarc/shared-v1/04-BTD-chr3-15645183-1120a096937e29e1.bam", + "filename": "04-BTD-chr3-15645183-1120a096937e29e1.bam", + "sha256": "57a00dbc5b18fffd104c97a52af48ec26b6448db09dcd06ca7f639d5b889c0d4", + "size_bytes": 20001 + }, + { + "bundle_path": "osteosarc/shared-v1/04-BTD-chr3-15645183-1120a096937e29e1.bam.bai", + "filename": "04-BTD-chr3-15645183-1120a096937e29e1.bam.bai", + "sha256": "7c1a315c490949dd5f3b98821041daeea83e4247bc845958a11fd8dfa848257f", + "size_bytes": 9272 + }, + { + "bundle_path": "osteosarc/shared-v1/05-CD109-chr6-73818405-1120a096937e29e1.bam", + "filename": "05-CD109-chr6-73818405-1120a096937e29e1.bam", + "sha256": "1995cc0c5be05878c379c96bf5d08278182f1d276795c2e1d3ee369787563be6", + "size_bytes": 18895 + }, + { + "bundle_path": "osteosarc/shared-v1/05-CD109-chr6-73818405-1120a096937e29e1.bam.bai", + "filename": "05-CD109-chr6-73818405-1120a096937e29e1.bam.bai", + "sha256": "dd7435cdc001f53603389c59d361a8011eccaf774c77cc8fb7e492353a7dd49c", + "size_bytes": 37680 + }, + { + "bundle_path": "osteosarc/shared-v1/06-CDC40-chr6-110228838-1b66c15da594a3ef.bam", + "filename": "06-CDC40-chr6-110228838-1b66c15da594a3ef.bam", + "sha256": "3f099843c5fc18a88027853544d86b0acb08d2143bf0502cb8b0079b2bd5cf0b", + "size_bytes": 30693 + }, + { + "bundle_path": "osteosarc/shared-v1/06-CDC40-chr6-110228838-1b66c15da594a3ef.bam.bai", + "filename": "06-CDC40-chr6-110228838-1b66c15da594a3ef.bam.bai", + "sha256": "a92f48f6875aba6b9c9acc7a779cadf9e5f1ac267a409833f6bc750db6d9d3a5", + "size_bytes": 76136 + }, + { + "bundle_path": "osteosarc/shared-v1/07-CENPL-chr1-173811223-1120a096937e29e1.bam", + "filename": "07-CENPL-chr1-173811223-1120a096937e29e1.bam", + "sha256": "7edc8e087cd8d8fea90ca4704cc7ad1fb6eb8986ec76902b8028435513e2c2e6", + "size_bytes": 18549 + }, + { + "bundle_path": "osteosarc/shared-v1/07-CENPL-chr1-173811223-1120a096937e29e1.bam.bai", + "filename": "07-CENPL-chr1-173811223-1120a096937e29e1.bam.bai", + "sha256": "16dcbd0c726eaebb1b2169e27d9d44ed00dd512c377c46fa6d93030c55baf84e", + "size_bytes": 86512 + }, + { + "bundle_path": "osteosarc/shared-v1/08-CUL9-chr6-43186384-9b42d06ca2fa2370.bam", + "filename": "08-CUL9-chr6-43186384-9b42d06ca2fa2370.bam", + "sha256": "ae2f9a279c35284f7a4f95e881b9bb9faaf09e3cb56e5cf3d393db45519a1eda", + "size_bytes": 4041 + }, + { + "bundle_path": "osteosarc/shared-v1/08-CUL9-chr6-43186384-9b42d06ca2fa2370.bam.bai", + "filename": "08-CUL9-chr6-43186384-9b42d06ca2fa2370.bam.bai", + "sha256": "a7a06c0b6a368f8b01956db7ad585ffbf06c89d43d3c5b524715da29c9be3fc0", + "size_bytes": 22728 + }, + { + "bundle_path": "osteosarc/shared-v1/09-DIAPH1-chr5-141526090-1b66c15da594a3ef.bam", + "filename": "09-DIAPH1-chr5-141526090-1b66c15da594a3ef.bam", + "sha256": "d2fc738a726216419c72aa64bc6d38b0a64cc7073e1284fddfed41395ffbb967", + "size_bytes": 30539 + }, + { + "bundle_path": "osteosarc/shared-v1/09-DIAPH1-chr5-141526090-1b66c15da594a3ef.bam.bai", + "filename": "09-DIAPH1-chr5-141526090-1b66c15da594a3ef.bam.bai", + "sha256": "3f23d8236edc00824d3776b22e23fb15700d83f6dbf2241ad0c3ccce80e92944", + "size_bytes": 91424 + }, + { + "bundle_path": "osteosarc/shared-v1/10-DYNC1H1-chr14-101980529-53f498a544883d51.bam", + "filename": "10-DYNC1H1-chr14-101980529-53f498a544883d51.bam", + "sha256": "f9ce315a0bd72baeb5c1fdc1b01dd11e7d277351aaef48ea762746ce869d404f", + "size_bytes": 22026 + }, + { + "bundle_path": "osteosarc/shared-v1/10-DYNC1H1-chr14-101980529-53f498a544883d51.bam.bai", + "filename": "10-DYNC1H1-chr14-101980529-53f498a544883d51.bam.bai", + "sha256": "76a18195ef19229d9d9ab6e2685b97b356032c5e8eb9516d04c8a564a82ab564", + "size_bytes": 51432 + }, + { + "bundle_path": "osteosarc/shared-v1/11-DYNC1H1-chr14-102030200-1b66c15da594a3ef.bam", + "filename": "11-DYNC1H1-chr14-102030200-1b66c15da594a3ef.bam", + "sha256": "7e7849420e65256d2f460b66de191456ecd609912a2403ad30b7a5fe2b9f9c01", + "size_bytes": 30540 + }, + { + "bundle_path": "osteosarc/shared-v1/11-DYNC1H1-chr14-102030200-1b66c15da594a3ef.bam.bai", + "filename": "11-DYNC1H1-chr14-102030200-1b66c15da594a3ef.bam.bai", + "sha256": "7aa57cc28c2d6b9908d77af24642bf4ee93f1cb3541a997dcd4979a2dca547a4", + "size_bytes": 72136 + }, + { + "bundle_path": "osteosarc/shared-v1/12-EPG5-chr18-45925851-fbea0bf403520431.bam", + "filename": "12-EPG5-chr18-45925851-fbea0bf403520431.bam", + "sha256": "248c2c7b00f2ebf2b10142e51085bf8f7dab381c3252f3c8470334e501237b24", + "size_bytes": 4119 + }, + { + "bundle_path": "osteosarc/shared-v1/12-EPG5-chr18-45925851-fbea0bf403520431.bam.bai", + "filename": "12-EPG5-chr18-45925851-fbea0bf403520431.bam.bai", + "sha256": "c0ea77a5e7a75dd9d4fe4b5bd6ccdda9bfd1085323e0fec8e864922875f541d7", + "size_bytes": 24072 + }, + { + "bundle_path": "osteosarc/shared-v1/13-EXOC4-chr7-133274996-53f498a544883d51.bam", + "filename": "13-EXOC4-chr7-133274996-53f498a544883d51.bam", + "sha256": "0b573c6eb0737355240069462aaef1a61cdde64545f6a1b066cfcb8fc1cecaec", + "size_bytes": 20953 + }, + { + "bundle_path": "osteosarc/shared-v1/13-EXOC4-chr7-133274996-53f498a544883d51.bam.bai", + "filename": "13-EXOC4-chr7-133274996-53f498a544883d51.bam.bai", + "sha256": "811acf25e99d1709b8d356c23bdcc895cf106c23af54c04b65306be5d8e22ffb", + "size_bytes": 66720 + }, + { + "bundle_path": "osteosarc/shared-v1/14-F8-chrX-154930861-1b66c15da594a3ef.bam", + "filename": "14-F8-chrX-154930861-1b66c15da594a3ef.bam", + "sha256": "2400959610b25e46fd433dd1b71f4ac3c25e6db40f25c6f1e961c4069896d52a", + "size_bytes": 30519 + }, + { + "bundle_path": "osteosarc/shared-v1/14-F8-chrX-154930861-1b66c15da594a3ef.bam.bai", + "filename": "14-F8-chrX-154930861-1b66c15da594a3ef.bam.bai", + "sha256": "7b6c88d88036084b1b5cc1ae00eb8451759fd8c98c3b1c16823cb8cadbb7e755", + "size_bytes": 97968 + }, + { + "bundle_path": "osteosarc/shared-v1/15-FBXO33-chr14-39431722-47b695c1a686c058.bam", + "filename": "15-FBXO33-chr14-39431722-47b695c1a686c058.bam", + "sha256": "11df00d8c119a67f3698e832bb310c2368a6e97e1382b24d90c667aca35c5e0f", + "size_bytes": 4101 + }, + { + "bundle_path": "osteosarc/shared-v1/15-FBXO33-chr14-39431722-47b695c1a686c058.bam.bai", + "filename": "15-FBXO33-chr14-39431722-47b695c1a686c058.bam.bai", + "sha256": "60b4ffb92671c2db0c0d9fcb997b1e3f8a8629986c0488216b96f0322e92a248", + "size_bytes": 20896 + }, + { + "bundle_path": "osteosarc/shared-v1/16-GLIS3-chr9-3856149-1b66c15da594a3ef.bam", + "filename": "16-GLIS3-chr9-3856149-1b66c15da594a3ef.bam", + "sha256": "2ed78819b273df7491a4f01309ce813e38176335da64aef01e695a2f0557388b", + "size_bytes": 30553 + }, + { + "bundle_path": "osteosarc/shared-v1/16-GLIS3-chr9-3856149-1b66c15da594a3ef.bam.bai", + "filename": "16-GLIS3-chr9-3856149-1b66c15da594a3ef.bam.bai", + "sha256": "a16e55fc621d396770ec866fa204a369543707a4d9a5765577e84a4d2bc6657c", + "size_bytes": 24200 + }, + { + "bundle_path": "osteosarc/shared-v1/17-H1_2-chr6-26055824-1120a096937e29e1.bam", + "filename": "17-H1_2-chr6-26055824-1120a096937e29e1.bam", + "sha256": "e5301f92413343ccc84a91e2307da475cb36db386014dce7a4510b97f5596a2e", + "size_bytes": 18876 + }, + { + "bundle_path": "osteosarc/shared-v1/17-H1_2-chr6-26055824-1120a096937e29e1.bam.bai", + "filename": "17-H1_2-chr6-26055824-1120a096937e29e1.bam.bai", + "sha256": "addcaf7e2ec1b59537d05970faa52c05f09cb621cf7c33ca355990790444958a", + "size_bytes": 14360 + }, + { + "bundle_path": "osteosarc/shared-v1/18-KDM3B-chr5-138391529-fbea0bf403520431.bam", + "filename": "18-KDM3B-chr5-138391529-fbea0bf403520431.bam", + "sha256": "b7cb6a1356006dd51eefcfeffea16f223e2c1d03cc3c88d9afec3d9dbad9e6c6", + "size_bytes": 4077 + }, + { + "bundle_path": "osteosarc/shared-v1/18-KDM3B-chr5-138391529-fbea0bf403520431.bam.bai", + "filename": "18-KDM3B-chr5-138391529-fbea0bf403520431.bam.bai", + "sha256": "9d2196599cd682bc620107b9aeaef86b4935c8bac0c8d73bab6a8ca5d0b5f1a7", + "size_bytes": 69216 + }, + { + "bundle_path": "osteosarc/shared-v1/19-KIF1C-chr17-5007293-fbea0bf403520431.bam", + "filename": "19-KIF1C-chr17-5007293-fbea0bf403520431.bam", + "sha256": "473ebe692885952abf140b0d2451ba8d3f07516fbabf9763d07e375b9750bccc", + "size_bytes": 4179 + }, + { + "bundle_path": "osteosarc/shared-v1/19-KIF1C-chr17-5007293-fbea0bf403520431.bam.bai", + "filename": "19-KIF1C-chr17-5007293-fbea0bf403520431.bam.bai", + "sha256": "59ae1cad447e9faf69461b9eb2054bb8866b8ddbce11b700c9876ea223534a8f", + "size_bytes": 4088 + }, + { + "bundle_path": "osteosarc/shared-v1/20-KRT18-chr12-52951767-fbea0bf403520431.bam", + "filename": "20-KRT18-chr12-52951767-fbea0bf403520431.bam", + "sha256": "be700eb7154173fa88271134b287a004e97500947bbb247fd96a9f7b04b8d564", + "size_bytes": 4120 + }, + { + "bundle_path": "osteosarc/shared-v1/20-KRT18-chr12-52951767-fbea0bf403520431.bam.bai", + "filename": "20-KRT18-chr12-52951767-fbea0bf403520431.bam.bai", + "sha256": "7a307dd75cc8708b60aeada7f584203338415feafda0afd5778f487d6a637a26", + "size_bytes": 27496 + }, + { + "bundle_path": "osteosarc/shared-v1/21-MAP2-chr2-209694768-2bc1fc291308debb.bam", + "filename": "21-MAP2-chr2-209694768-2bc1fc291308debb.bam", + "sha256": "bd32cc8d2f2992c51480ce66c5117d055f252415edad121fcf5e932a8d09e476", + "size_bytes": 20219 + }, + { + "bundle_path": "osteosarc/shared-v1/21-MAP2-chr2-209694768-2bc1fc291308debb.bam.bai", + "filename": "21-MAP2-chr2-209694768-2bc1fc291308debb.bam.bai", + "sha256": "07b2dcd92a5898409a6a51648dd17442c8f1af0e6fca644ffa942497e8e2bde0", + "size_bytes": 104040 + }, + { + "bundle_path": "osteosarc/shared-v1/22-MT_ND5-chrM-12994-f30f618fb76a0e49.bam", + "filename": "22-MT_ND5-chrM-12994-f30f618fb76a0e49.bam", + "sha256": "75908a48a3b0b920e785605131e443a4e46ec5c76e54b54fe00e6f7a4ffcc14d", + "size_bytes": 4066 + }, + { + "bundle_path": "osteosarc/shared-v1/22-MT_ND5-chrM-12994-f30f618fb76a0e49.bam.bai", + "filename": "22-MT_ND5-chrM-12994-f30f618fb76a0e49.bam.bai", + "sha256": "a90e48ac391a906867edc5badcbad0d0c967dbbf88f28177c2851249765aa06d", + "size_bytes": 1648 + }, + { + "bundle_path": "osteosarc/shared-v1/23-MYO15B-chr17-75589953-7010dd389c50467d.bam", + "filename": "23-MYO15B-chr17-75589953-7010dd389c50467d.bam", + "sha256": "a4dee63562665f45b7d55b3f61e154471e03edf3bd2e4ec4e4cc82d58147b551", + "size_bytes": 21317 + }, + { + "bundle_path": "osteosarc/shared-v1/23-MYO15B-chr17-75589953-7010dd389c50467d.bam.bai", + "filename": "23-MYO15B-chr17-75589953-7010dd389c50467d.bam.bai", + "sha256": "c753531f4be13618d0c8480981f9982cefd59f9c29bef95a3f2b972e04675d85", + "size_bytes": 38544 + }, + { + "bundle_path": "osteosarc/shared-v1/24-MYO9A-chr15-71994488-f30f618fb76a0e49.bam", + "filename": "24-MYO9A-chr15-71994488-f30f618fb76a0e49.bam", + "sha256": "fe6b8bd82a638c2cf6cafedeeb1fabdc51268a0956d17f1eb46051f2f9fbc111", + "size_bytes": 4160 + }, + { + "bundle_path": "osteosarc/shared-v1/24-MYO9A-chr15-71994488-f30f618fb76a0e49.bam.bai", + "filename": "24-MYO9A-chr15-71994488-f30f618fb76a0e49.bam.bai", + "sha256": "b3fb4c5ba0c996377710e8f955bca823882280ce343ccf1f86f295c5bca0f417", + "size_bytes": 36800 + }, + { + "bundle_path": "osteosarc/shared-v1/25-NAV2-chr11-20080142-8fda918141cedf55.bam", + "filename": "25-NAV2-chr11-20080142-8fda918141cedf55.bam", + "sha256": "5847527405e623631a710e7a3139938bcf4f7338707308210e12362c209efd46", + "size_bytes": 4107 + }, + { + "bundle_path": "osteosarc/shared-v1/25-NAV2-chr11-20080142-8fda918141cedf55.bam.bai", + "filename": "25-NAV2-chr11-20080142-8fda918141cedf55.bam.bai", + "sha256": "14ae323cf04df4fefd6077a9639503079112772da924b888d9b58f8860bb910d", + "size_bytes": 11448 + }, + { + "bundle_path": "osteosarc/shared-v1/26-NME1-chr17-51154443-53f498a544883d51.bam", + "filename": "26-NME1-chr17-51154443-53f498a544883d51.bam", + "sha256": "8b032c149bc50019e0881e5e26c5e7a3280902da4bfb67de15d033e0afe1f282", + "size_bytes": 21562 + }, + { + "bundle_path": "osteosarc/shared-v1/26-NME1-chr17-51154443-53f498a544883d51.bam.bai", + "filename": "26-NME1-chr17-51154443-53f498a544883d51.bam.bai", + "sha256": "90f74add1c0851297c3f96fd9821d58b0e47fbeb2bedc384d710c8cb55fe15d4", + "size_bytes": 26616 + }, + { + "bundle_path": "osteosarc/shared-v1/27-NR2F2-chr15-96332299-f30f618fb76a0e49.bam", + "filename": "27-NR2F2-chr15-96332299-f30f618fb76a0e49.bam", + "sha256": "0cd6e398331c7d17ec70e7293f4e9976d2175e92971e84a8edb22063a234692a", + "size_bytes": 4082 + }, + { + "bundle_path": "osteosarc/shared-v1/27-NR2F2-chr15-96332299-f30f618fb76a0e49.bam.bai", + "filename": "27-NR2F2-chr15-96332299-f30f618fb76a0e49.bam.bai", + "sha256": "b831d59ed8e371cb675a6fdc611ecd366e7665af7e480a43f8c4afa555775113", + "size_bytes": 48680 + }, + { + "bundle_path": "osteosarc/shared-v1/28-NTF3-chr12-5494381-53f498a544883d51.bam", + "filename": "28-NTF3-chr12-5494381-53f498a544883d51.bam", + "sha256": "2516e276aee1152672d1a1143a5c0031dcaf5ec1ff6339b1885660886d855ed6", + "size_bytes": 21780 + }, + { + "bundle_path": "osteosarc/shared-v1/28-NTF3-chr12-5494381-53f498a544883d51.bam.bai", + "filename": "28-NTF3-chr12-5494381-53f498a544883d51.bam.bai", + "sha256": "7a2b26f87f32ef7cc956411fad157516f4088a70e04a822353ddcf708ff09c00", + "size_bytes": 4320 + }, + { + "bundle_path": "osteosarc/shared-v1/29-PIP5K1A-chr1-151242178-47b695c1a686c058.bam", + "filename": "29-PIP5K1A-chr1-151242178-47b695c1a686c058.bam", + "sha256": "4b256d74c53f10bc084521ab7293ca14e4e7acca9e7dbc2d920135686bf10f48", + "size_bytes": 4101 + }, + { + "bundle_path": "osteosarc/shared-v1/29-PIP5K1A-chr1-151242178-47b695c1a686c058.bam.bai", + "filename": "29-PIP5K1A-chr1-151242178-47b695c1a686c058.bam.bai", + "sha256": "f0df05651a85601faa6227fd7cd4acbedc848564b39307176a1b7b94d271e5fe", + "size_bytes": 75496 + }, + { + "bundle_path": "osteosarc/shared-v1/30-PRICKLE2-chr3-64198863-53f498a544883d51.bam", + "filename": "30-PRICKLE2-chr3-64198863-53f498a544883d51.bam", + "sha256": "def1d777d6b163791f5f9f2e33d7f69d6053b3a5f88e5415f1868baa4bd6aef1", + "size_bytes": 21221 + }, + { + "bundle_path": "osteosarc/shared-v1/30-PRICKLE2-chr3-64198863-53f498a544883d51.bam.bai", + "filename": "30-PRICKLE2-chr3-64198863-53f498a544883d51.bam.bai", + "sha256": "ce48902c256a0d626f22954e6b40000faa2a9eac4c2ac49c98a496bd728ca8cd", + "size_bytes": 33000 + }, + { + "bundle_path": "osteosarc/shared-v1/31-PTH1R-chr3-46898732-1b66c15da594a3ef.bam", + "filename": "31-PTH1R-chr3-46898732-1b66c15da594a3ef.bam", + "sha256": "27e213d75b83cc410d4d094a3dc69be8be2bd6b2bd33ff4214ad5a401ee23e66", + "size_bytes": 30600 + }, + { + "bundle_path": "osteosarc/shared-v1/31-PTH1R-chr3-46898732-1b66c15da594a3ef.bam.bai", + "filename": "31-PTH1R-chr3-46898732-1b66c15da594a3ef.bam.bai", + "sha256": "9a750e53e6cde73af2684a3386c3cb3c1fe5ea29ec97c6f457140b73d9c638d5", + "size_bytes": 45216 + }, + { + "bundle_path": "osteosarc/shared-v1/32-RNF213-chr17-80327830-1b66c15da594a3ef.bam", + "filename": "32-RNF213-chr17-80327830-1b66c15da594a3ef.bam", + "sha256": "8b6e6d3efc7b6a24ba15a0c297029cff9905f2de999158531d1bc32ded004f53", + "size_bytes": 30550 + }, + { + "bundle_path": "osteosarc/shared-v1/32-RNF213-chr17-80327830-1b66c15da594a3ef.bam.bai", + "filename": "32-RNF213-chr17-80327830-1b66c15da594a3ef.bam.bai", + "sha256": "c613cc0727563b7340861e4fa938b8ecbc6c514f480887a2027de3bc3e75fba1", + "size_bytes": 61576 + }, + { + "bundle_path": "osteosarc/shared-v1/33-ROBO2-chr3-77607853-1b66c15da594a3ef.bam", + "filename": "33-ROBO2-chr3-77607853-1b66c15da594a3ef.bam", + "sha256": "d1fadfee8fb2adff6998c3318239267464e4d646bbfbb75fa5b83d794bf1993e", + "size_bytes": 30571 + }, + { + "bundle_path": "osteosarc/shared-v1/33-ROBO2-chr3-77607853-1b66c15da594a3ef.bam.bai", + "filename": "33-ROBO2-chr3-77607853-1b66c15da594a3ef.bam.bai", + "sha256": "c6a8876a4b70d39de49c531d0e11eba7898139197185bf15fff0633802ee07e6", + "size_bytes": 60208 + }, + { + "bundle_path": "osteosarc/shared-v1/34-SLC25A12-chr2-171813470-fbea0bf403520431.bam", + "filename": "34-SLC25A12-chr2-171813470-fbea0bf403520431.bam", + "sha256": "4590fdab145f99917291205a17f0e1a9ff0f40c45513025a4fe2ec31f13b611b", + "size_bytes": 4078 + }, + { + "bundle_path": "osteosarc/shared-v1/34-SLC25A12-chr2-171813470-fbea0bf403520431.bam.bai", + "filename": "34-SLC25A12-chr2-171813470-fbea0bf403520431.bam.bai", + "sha256": "aedf17fb87f536401a871b48a50ba363e50b54e45f844bab772301a3b3b7103a", + "size_bytes": 85536 + }, + { + "bundle_path": "osteosarc/shared-v1/35-SMC5-chr9-70298024-1120a096937e29e1.bam", + "filename": "35-SMC5-chr9-70298024-1120a096937e29e1.bam", + "sha256": "b798bf1175052776bd2407941ba9736c1a24b774ed0d821815991bb94054dff4", + "size_bytes": 19082 + }, + { + "bundle_path": "osteosarc/shared-v1/35-SMC5-chr9-70298024-1120a096937e29e1.bam.bai", + "filename": "35-SMC5-chr9-70298024-1120a096937e29e1.bam.bai", + "sha256": "023691cadaad2e61dd1d132763e1ca0645902ecc6f9a3765f2e87f7ea5add167", + "size_bytes": 35960 + }, + { + "bundle_path": "osteosarc/shared-v1/36-TECPR1-chr7-98241127-8fda918141cedf55.bam", + "filename": "36-TECPR1-chr7-98241127-8fda918141cedf55.bam", + "sha256": "f876e646d351f8c520587147cea9a1c48800b5800bb77bbabaac2e5feed26d1b", + "size_bytes": 4078 + }, + { + "bundle_path": "osteosarc/shared-v1/36-TECPR1-chr7-98241127-8fda918141cedf55.bam.bai", + "filename": "36-TECPR1-chr7-98241127-8fda918141cedf55.bam.bai", + "sha256": "daa1f3f2403f9c73d031c3a58e5d399129723ccd3aed0a90ceb5bff7fd01c5bf", + "size_bytes": 49616 + }, + { + "bundle_path": "osteosarc/shared-v1/37-TMRO-chr9-97910412-1b66c15da594a3ef.bam", + "filename": "37-TMRO-chr9-97910412-1b66c15da594a3ef.bam", + "sha256": "95c2b7c2386a058830c2a6fa7e3285254bf9dbae584b8c9c513c50c1f16ba457", + "size_bytes": 30531 + }, + { + "bundle_path": "osteosarc/shared-v1/37-TMRO-chr9-97910412-1b66c15da594a3ef.bam.bai", + "filename": "37-TMRO-chr9-97910412-1b66c15da594a3ef.bam.bai", + "sha256": "4b47b3209e33cbe86fbb4e47528034ff8988b831136edbe76e92d56041622171", + "size_bytes": 70120 + }, + { + "bundle_path": "osteosarc/shared-v1/38-VPS13B-chr8-99861923-1b66c15da594a3ef.bam", + "filename": "38-VPS13B-chr8-99861923-1b66c15da594a3ef.bam", + "sha256": "9955c8fc7a999d6fbc9aee3ac817bb805537b34325a13f3e0d88794e5f402e30", + "size_bytes": 30599 + }, + { + "bundle_path": "osteosarc/shared-v1/38-VPS13B-chr8-99861923-1b66c15da594a3ef.bam.bai", + "filename": "38-VPS13B-chr8-99861923-1b66c15da594a3ef.bam.bai", + "sha256": "d8865780b82211c50979a820e1ca57c779f2e47c8fa24351a17340615aac144d", + "size_bytes": 71080 + }, + { + "bundle_path": "osteosarc/shared-v1/39-VPS72-chr1-151185547-1120a096937e29e1.bam", + "filename": "39-VPS72-chr1-151185547-1120a096937e29e1.bam", + "sha256": "c1d12a16977876b363273599b174690aee9461c12b81c6ec7800272b077fc036", + "size_bytes": 18564 + }, + { + "bundle_path": "osteosarc/shared-v1/39-VPS72-chr1-151185547-1120a096937e29e1.bam.bai", + "filename": "39-VPS72-chr1-151185547-1120a096937e29e1.bam.bai", + "sha256": "a5321b67dddecf4b85b42f4d495079b9226cfa783763c325c260908157a7ab0a", + "size_bytes": 75456 + }, + { + "bundle_path": "osteosarc/shared-v1/40-WWC1-chr5-168399513-1b66c15da594a3ef.bam", + "filename": "40-WWC1-chr5-168399513-1b66c15da594a3ef.bam", + "sha256": "df4a6f2af08657d1806a03103c779a099a1b40b20105e6c2cb41f52601ada758", + "size_bytes": 30543 + }, + { + "bundle_path": "osteosarc/shared-v1/40-WWC1-chr5-168399513-1b66c15da594a3ef.bam.bai", + "filename": "40-WWC1-chr5-168399513-1b66c15da594a3ef.bam.bai", + "sha256": "d9a5d4d63450fbd369f710edaec17ae1bdda05b3a2b1b6448a7fe29ea83ef3b2", + "size_bytes": 104544 + }, + { + "bundle_path": "osteosarc/shared-v1/41-ZNF436-chr1-23362762-1b66c15da594a3ef.bam", + "filename": "41-ZNF436-chr1-23362762-1b66c15da594a3ef.bam", + "sha256": "7fe252baf5f7cb3adee593568e0cee38bbe69624aa65c1590bd991f895e87c80", + "size_bytes": 30573 + }, + { + "bundle_path": "osteosarc/shared-v1/41-ZNF436-chr1-23362762-1b66c15da594a3ef.bam.bai", + "filename": "41-ZNF436-chr1-23362762-1b66c15da594a3ef.bam.bai", + "sha256": "5efc2899f71ba1453e1a69c60ea8f4dd4024c5ec833db8108cc16f448c15244d", + "size_bytes": 33720 + }, + { + "bundle_path": "osteosarc/shared-v1/42-ZNF674-chrX-46501045-1b66c15da594a3ef.bam", + "filename": "42-ZNF674-chrX-46501045-1b66c15da594a3ef.bam", + "sha256": "67e072f2d58327b9b67ba1a9e52747238d955ca91cafadf98ec61ca780c6ffdd", + "size_bytes": 30536 + }, + { + "bundle_path": "osteosarc/shared-v1/42-ZNF674-chrX-46501045-1b66c15da594a3ef.bam.bai", + "filename": "42-ZNF674-chrX-46501045-1b66c15da594a3ef.bam.bai", + "sha256": "c191603060e29820449ee6a5ee2888fdeb6f12f6f7485a3d3f9116246a61145d", + "size_bytes": 45024 + }, + { + "bundle_path": "osteosarc/shared-v1/43-ZNF764-chr16-30557995-1120a096937e29e1.bam", + "filename": "43-ZNF764-chr16-30557995-1120a096937e29e1.bam", + "sha256": "fb514cf844cc4e1275291ea4a3ecfe4dff47156dafae20079d6b2012f0c064eb", + "size_bytes": 18622 + }, + { + "bundle_path": "osteosarc/shared-v1/43-ZNF764-chr16-30557995-1120a096937e29e1.bam.bai", + "filename": "43-ZNF764-chr16-30557995-1120a096937e29e1.bam.bai", + "sha256": "2962d102fe432b171d58b02f5e57079a24791889d1a9183ad3fdb2b6fc07aad3", + "size_bytes": 16560 + }, + { + "bundle_path": "osteosarc/shared-v1/44-MT_ND5-chrM-12994-238f917202dd9997.bam", + "filename": "44-MT_ND5-chrM-12994-238f917202dd9997.bam", + "sha256": "510062c3cbe9df54cf4bb15cf96ee83cf9f4f79bde8df536b3e6ee639c42bcb5", + "size_bytes": 2055 + }, + { + "bundle_path": "osteosarc/shared-v1/44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai", + "filename": "44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai", + "sha256": "fd9875ef3646a2a6a3bcaf3277d2d7c2a240f3aaf93697aae78e8c756fe268b3", + "size_bytes": 760 + }, + { + "bundle_path": "osteosarc/shared-v1/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam", + "filename": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam", + "sha256": "dbdecc9fd5fdc887667153005d300f22f0aaf55606a2d884164cc4e20d139ad2", + "size_bytes": 1257 + }, + { + "bundle_path": "osteosarc/shared-v1/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai", + "filename": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai", + "sha256": "81752c733dcd56f9cbd040ee5314c1b1868a370f4f744453eb1f3c651c80c7e9", + "size_bytes": 288 + }, + { + "bundle_path": "osteosarc/shared-v1/46-MT_ND5-chrM-12994-7010dd389c50467d.bam", + "filename": "46-MT_ND5-chrM-12994-7010dd389c50467d.bam", + "sha256": "af986886b9dc1d0c5924d574b8da6f568de173c9becbc3f9517d695d97228f4a", + "size_bytes": 21315 + }, + { + "bundle_path": "osteosarc/shared-v1/46-MT_ND5-chrM-12994-7010dd389c50467d.bam.bai", + "filename": "46-MT_ND5-chrM-12994-7010dd389c50467d.bam.bai", + "sha256": "094517f7e0856f866ce13a64d60af430189553e237a17db4cc3ae24b6579517f", + "size_bytes": 1640 + }, + { + "bundle_path": "osteosarc/shared-v1/47-MT_ND5-chrM-12994-0066232879babe83.bam", + "filename": "47-MT_ND5-chrM-12994-0066232879babe83.bam", + "sha256": "66eebf813949d64f8522c1173d9a29a1b6beb0416117003ba0471c697c902a33", + "size_bytes": 3850 + }, + { + "bundle_path": "osteosarc/shared-v1/47-MT_ND5-chrM-12994-0066232879babe83.bam.bai", + "filename": "47-MT_ND5-chrM-12994-0066232879babe83.bam.bai", + "sha256": "bb121f7768ead1652c375f6e59b897589b0c9bbd8941b55d35b7850cd62a44e1", + "size_bytes": 1640 + }, + { + "bundle_path": "osteosarc/shared-v1/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam", + "filename": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam", + "sha256": "b7fcdd4f5ed3c3f97de9e23c3e77fa10033c8a3b927ee75d4888520c99a5fcc9", + "size_bytes": 1255 + }, + { + "bundle_path": "osteosarc/shared-v1/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai", + "filename": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai", + "sha256": "3facf5d7a5eb2f86eff9feb6b45b72145f196d69a64481c98a842379ad1139a7", + "size_bytes": 47584 + } + ], + "cache_namespace": "openvax", + "cache_object_layout": "objects/sha256/{sha256}{original_suffixes}", + "cases": [ + { + "bam": "00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam", + "case_id": "00-ABCF2-chr7-151218156-f30f618fb76a0e49", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "pos": 151218156, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "16c085f81a650134624ce7675a576107bfdbac0783a05f11952382d7555d3cc5", + "source_receipt_sha256": "6dec36f21a037f16ff5b337b76c71b405d5c783d3011536f0e1b924866bdb066", + "source_region_sha256": "8c60781ff61622445c53a6d561660a9edbacfc22764048bcec28e7e175def2ca" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "coordinates": "one-based", + "pos": 151218156, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr7", + "end": 151218156, + "reference_length": null, + "start": 151218155 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 159345973, + "SN": "chr7" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "f30f618fb76a0e49", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "gene": "ABCF2", + "genomic_validation": { + "allele_offset": 30, + "end": 151218186, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "afa73fbb385f2ec436bdb3802f31da52d1296aa4d656a0ee2c7a2e62b9c5f942", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr7&start=151218125&end=151218186" + }, + "sequence": "GGGCCCTACCAGAGCCACTCGTGTGTCAAGGTCAATTCCAAATTCTAGATTATTGTAGATG", + "start": 151218125 + }, + "pos": 151218156, + "ref": "G", + "source_location": "chr7:151218156", + "source_protein_label": "\u2014", + "source_url": "https://osteosarc.com/variant/ABCF2-chr7-151218156/", + "vaccine_count": 1, + "variant_id": "ABCF2-chr7-151218156" + } + }, + { + "bam": "01-ADGRF5-chr6-46856758-f30f618fb76a0e49.bam", + "case_id": "01-ADGRF5-chr6-46856758-f30f618fb76a0e49", + "catalogue_identity": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr6", + "pos": 46856758, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "3e0f566e83af48dd353a178c9a94e169fee1661c219a53b110c4f2d1bbcb0f3c", + "source_receipt_sha256": "6dec36f21a037f16ff5b337b76c71b405d5c783d3011536f0e1b924866bdb066", + "source_region_sha256": "8c60781ff61622445c53a6d561660a9edbacfc22764048bcec28e7e175def2ca" + }, + "native_variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr6", + "coordinates": "one-based", + "pos": 46856758, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr6", + "end": 46856758, + "reference_length": null, + "start": 46856757 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 170805979, + "SN": "chr6" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "f30f618fb76a0e49", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr6", + "gene": "ADGRF5", + "genomic_validation": { + "allele_offset": 30, + "end": 46856788, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "4841aa27f950f59cfb46f63b95013af2bbcb304074c34598c1e704792511ac39", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr6&start=46856727&end=46856788" + }, + "sequence": "TGTGAAGACCATCTCGACAATGAAAACTTATTCAGCAAAGCTTCCTGTACCTGCATTGTTA", + "start": 46856727 + }, + "pos": 46856758, + "ref": "T", + "source_location": "chr6:46856758", + "source_protein_label": "p.Asn1279Ser", + "source_url": "https://osteosarc.com/variant/ADGRF5-chr6-46856758/", + "vaccine_count": 2, + "variant_id": "ADGRF5-chr6-46856758" + } + }, + { + "bam": "02-ATRX-chrX-77599465-1b66c15da594a3ef.bam", + "case_id": "02-ATRX-chrX-77599465-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chrX", + "pos": 77599465, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "671de0f8e553706f059bc4742d779d6ffd8f058b2a3f652bd0a8533611a8b2b5", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chrX", + "coordinates": "one-based", + "pos": 77599465, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chrX", + "end": 77599465, + "reference_length": null, + "start": 77599464 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 156040895, + "SN": "chrX" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chrX", + "gene": "ATRX", + "genomic_validation": { + "allele_offset": 30, + "end": 77599495, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "8faf7ecbbe97be7f7ddf53fc0b2079d5dda94e0f919ef43f53c46245ab20cbe6", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrX&start=77599434&end=77599495" + }, + "sequence": "AAGGATTGTTTCCTGTTTCATCCACATTTCCTTCACCACCTCCCCGAGATCTTGAATTCCA", + "start": 77599434 + }, + "pos": 77599465, + "ref": "C", + "source_location": "chrX:77599465", + "source_protein_label": "p.Gly1968Arg", + "source_url": "https://osteosarc.com/variant/ATRX-chrX-77599465/", + "vaccine_count": 1, + "variant_id": "ATRX-chrX-77599465" + } + }, + { + "bam": "03-BMP1-chr8-22192067-53f498a544883d51.bam", + "case_id": "03-BMP1-chr8-22192067-53f498a544883d51", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr8", + "pos": 22192067, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "70b4b661e82d58d5f8f4a1b578ae19e9ad380c93a8f9ba634f4fd31d2162f2c4", + "source_receipt_sha256": "3cb6e1de84429b8a0611dc723b44e247e828c94f8b6eee67f3c8af0813e90beb", + "source_region_sha256": "e3c2139d0afed2800e75da677a6b3238de03d000c7899780b4a0d2c061274ede" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr8", + "coordinates": "one-based", + "pos": 22192067, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr8", + "end": 22192067, + "reference_length": null, + "start": 22192066 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 145138636, + "SN": "chr8" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "53f498a544883d51", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr8", + "gene": "BMP1", + "genomic_validation": { + "allele_offset": 30, + "end": 22192097, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "6d635cc746d40e84dff59a6176249540b3c2c028ad7a40a67a398b3ee4d60996", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr8&start=22192036&end=22192097" + }, + "sequence": "CTGTTGCCCTAGATCATCCTGAACTTCACGTCCCTGGACCTGTACCGCAGCCGCCTGTGCT", + "start": 22192036 + }, + "pos": 22192067, + "ref": "T", + "source_location": "chr8:22192067", + "source_protein_label": "p.Ser366Thr", + "source_url": "https://osteosarc.com/variant/BMP1-chr8-22192067/", + "vaccine_count": 2, + "variant_id": "BMP1-chr8-22192067" + } + }, + { + "bam": "04-BTD-chr3-15645183-1120a096937e29e1.bam", + "case_id": "04-BTD-chr3-15645183-1120a096937e29e1", + "catalogue_identity": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr3", + "pos": 15645183, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "da7f235d9934bf6ad17e9ce0952c4a42ad5400770039a0cce8877b2d4c839078", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr3", + "coordinates": "one-based", + "pos": 15645183, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr3", + "end": 15645183, + "reference_length": null, + "start": 15645182 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 198295559, + "SN": "chr3" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr3", + "gene": "BTD", + "genomic_validation": { + "allele_offset": 30, + "end": 15645213, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "17f62bb240d4c20ed1fbcb775863451ab627782b4e7a05cf01cf9bd64e51a04b", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr3&start=15645152&end=15645213" + }, + "sequence": "TTATCCAAAGAGCTGTATGCCCTGGGGGTCTTTGATGGGCTTCACACAGTACATGGCACTT", + "start": 15645152 + }, + "pos": 15645183, + "ref": "T", + "source_location": "chr3:15645183", + "source_protein_label": "p.Phe445Val", + "source_url": "https://osteosarc.com/variant/BTD-chr3-15645183/", + "vaccine_count": 3, + "variant_id": "BTD-chr3-15645183" + } + }, + { + "bam": "05-CD109-chr6-73818405-1120a096937e29e1.bam", + "case_id": "05-CD109-chr6-73818405-1120a096937e29e1", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr6", + "pos": 73818405, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "e77bf07974ea1fdc5dcacfb08978e400bc2cb2b11d6488eeeeb1e68491da6657", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr6", + "coordinates": "one-based", + "pos": 73818405, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr6", + "end": 73818405, + "reference_length": null, + "start": 73818404 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 170805979, + "SN": "chr6" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr6", + "gene": "CD109", + "genomic_validation": { + "allele_offset": 30, + "end": 73818435, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "96162359984bb5e8083092897637e058b26b4afadf7e9dabe520e3f835d25e85", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr6&start=73818374&end=73818435" + }, + "sequence": "CTCTTTGATTTAGCTTTTCGGGCCCGGGTAGGAGTGGCATGGCTCTTATGGAAGTTAACCT", + "start": 73818374 + }, + "pos": 73818405, + "ref": "G", + "source_location": "chr6:73818405", + "source_protein_label": "p.Arg1310Met", + "source_url": "https://osteosarc.com/variant/CD109-chr6-73818405/", + "vaccine_count": 1, + "variant_id": "CD109-chr6-73818405" + } + }, + { + "bam": "06-CDC40-chr6-110228838-1b66c15da594a3ef.bam", + "case_id": "06-CDC40-chr6-110228838-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr6", + "pos": 110228838, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "365a70cf3545ff14a4f40a4c70d947d610730ef1920c4066c5eccbf037b557e4", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr6", + "coordinates": "one-based", + "pos": 110228838, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr6", + "end": 110228838, + "reference_length": null, + "start": 110228837 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 170805979, + "SN": "chr6" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr6", + "gene": "CDC40", + "genomic_validation": { + "allele_offset": 30, + "end": 110228868, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "6f2f8faa4b84a6b05194de7e1ddcd88355371b9de1585fb2afc27307591b41b7", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr6&start=110228807&end=110228868" + }, + "sequence": "ATACCTCATTTATTGAATTTACAGGAAAATGGCTAGCATGCCAATCAATGGACAACCAAAT", + "start": 110228807 + }, + "pos": 110228838, + "ref": "G", + "source_location": "chr6:110228838", + "source_protein_label": "p.Trp475Ser", + "source_url": "https://osteosarc.com/variant/CDC40-chr6-110228838/", + "vaccine_count": 2, + "variant_id": "CDC40-chr6-110228838" + } + }, + { + "bam": "07-CENPL-chr1-173811223-1120a096937e29e1.bam", + "case_id": "07-CENPL-chr1-173811223-1120a096937e29e1", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr1", + "pos": 173811223, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "9b4f9489a35a3afbb317ef062147634df166c5c043471e4c8631ca2a439ff09a", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr1", + "coordinates": "one-based", + "pos": 173811223, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr1", + "end": 173811223, + "reference_length": null, + "start": 173811222 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 248956422, + "SN": "chr1" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr1", + "gene": "CENPL", + "genomic_validation": { + "allele_offset": 30, + "end": 173811253, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "7d2b62e383e339a32853b6cb47881cc9f7dc76ba0dfd0bf0134e9b6d87a61952", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr1&start=173811192&end=173811253" + }, + "sequence": "TTCCTGACCGATTCTAATCGTTTCTGCAGAGGAGTGGCACCTATAAAGTAATCTTCAGGTC", + "start": 173811192 + }, + "pos": 173811223, + "ref": "G", + "source_location": "chr1:173811223", + "source_protein_label": "p.Pro26His", + "source_url": "https://osteosarc.com/variant/CENPL-chr1-173811223/", + "vaccine_count": 1, + "variant_id": "CENPL-chr1-173811223" + } + }, + { + "bam": "08-CUL9-chr6-43186384-9b42d06ca2fa2370.bam", + "case_id": "08-CUL9-chr6-43186384-9b42d06ca2fa2370", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr6", + "pos": 43186384, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "3b8df22babcf5136635b9033d10d557d45baa19efa1b4d4a356fb7a4477de96e", + "source_receipt_sha256": "75ccabe6e4228fcdd7b8f354703b8ed2753e1732db95237e1fb6d04a93232d32", + "source_region_sha256": "518608dfd9ab395fb3cb121832b28fba2ba29078bd3c08726957888e0d03119e" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr6", + "coordinates": "one-based", + "pos": 43186384, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr6", + "end": 43186384, + "reference_length": null, + "start": 43186383 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 170805979, + "SN": "chr6" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "9b42d06ca2fa2370", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr6", + "gene": "CUL9", + "genomic_validation": { + "allele_offset": 30, + "end": 43186414, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "d5aca6e6f01ffb0e3fdb98af2464f7492e262c63bd6c3b1be9608798ef856214", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr6&start=43186353&end=43186414" + }, + "sequence": "CAGCCAGGGATGCGAGTGCGGATGCTGGATGATTATGAGGAGATCAGTGCTGGGGACGAGG", + "start": 43186353 + }, + "pos": 43186384, + "ref": "G", + "source_location": "chr6:43186384", + "source_protein_label": "p.Asp403Tyr", + "source_url": "https://osteosarc.com/variant/CUL9-chr6-43186384/", + "vaccine_count": 2, + "variant_id": "CUL9-chr6-43186384" + } + }, + { + "bam": "09-DIAPH1-chr5-141526090-1b66c15da594a3ef.bam", + "case_id": "09-DIAPH1-chr5-141526090-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr5", + "pos": 141526090, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "37e0e652ba72e45dcc18412ee831aa4cfe8c9e368955719cc71e5e66b93cab3a", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr5", + "coordinates": "one-based", + "pos": 141526090, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr5", + "end": 141526090, + "reference_length": null, + "start": 141526089 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 181538259, + "SN": "chr5" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr5", + "gene": "DIAPH1", + "genomic_validation": { + "allele_offset": 30, + "end": 141526120, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "66cf731e0a70f5053fd807a418c1456ceb7d3df8efcc49aec392d29bf9191700", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr5&start=141526059&end=141526120" + }, + "sequence": "CTCTCTCTTCTGCTGCTTCTCTAGCCGCTCCTTCTCTGCCTTCTCCTTGGCTAGTTTTGCT", + "start": 141526059 + }, + "pos": 141526090, + "ref": "C", + "source_location": "chr5:141526090", + "source_protein_label": "p.Lys1174Asn", + "source_url": "https://osteosarc.com/variant/DIAPH1-chr5-141526090/", + "vaccine_count": 1, + "variant_id": "DIAPH1-chr5-141526090" + } + }, + { + "bam": "10-DYNC1H1-chr14-101980529-53f498a544883d51.bam", + "case_id": "10-DYNC1H1-chr14-101980529-53f498a544883d51", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr14", + "pos": 101980529, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "4f63dcf825ab6c64ac542a1172f036c259e1984a40d487b6c01fbd3456d45fee", + "source_receipt_sha256": "3cb6e1de84429b8a0611dc723b44e247e828c94f8b6eee67f3c8af0813e90beb", + "source_region_sha256": "e3c2139d0afed2800e75da677a6b3238de03d000c7899780b4a0d2c061274ede" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr14", + "coordinates": "one-based", + "pos": 101980529, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr14", + "end": 101980529, + "reference_length": null, + "start": 101980528 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 107043718, + "SN": "chr14" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "53f498a544883d51", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr14", + "gene": "DYNC1H1", + "genomic_validation": { + "allele_offset": 30, + "end": 101980559, + "genome": "hg38", + "receipt": { + "bytes": 222, + "sha256": "f9f1d6627fac3c82e2e4e4835b9ee10bf21b0ae007ab1e7d98e93c1bdc3f7287", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr14&start=101980498&end=101980559" + }, + "sequence": "TTGAAACATGGCAAGCGCTTCCATGCCACCGTCAGTTTTGACACTGACACAGGTAACAACT", + "start": 101980498 + }, + "pos": 101980529, + "ref": "G", + "source_location": "chr14:101980529", + "source_protein_label": "p.Val314Ile", + "source_url": "https://osteosarc.com/variant/DYNC1H1-chr14-101980529/", + "vaccine_count": 5, + "variant_id": "DYNC1H1-chr14-101980529" + } + }, + { + "bam": "11-DYNC1H1-chr14-102030200-1b66c15da594a3ef.bam", + "case_id": "11-DYNC1H1-chr14-102030200-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr14", + "pos": 102030200, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "773631ead8abda3a89c4e673d04df167d958bc56ce0140656eeae2aa55ec9347", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr14", + "coordinates": "one-based", + "pos": 102030200, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr14", + "end": 102030200, + "reference_length": null, + "start": 102030199 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 107043718, + "SN": "chr14" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr14", + "gene": "DYNC1H1", + "genomic_validation": { + "allele_offset": 30, + "end": 102030230, + "genome": "hg38", + "receipt": { + "bytes": 222, + "sha256": "d19de824ae54c17b8e77ad53f2906c39da55d3b6f0ad6e5a6ffa57164a205117", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr14&start=102030169&end=102030230" + }, + "sequence": "CCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGT", + "start": 102030169 + }, + "pos": 102030200, + "ref": "G", + "source_location": "chr14:102030200", + "source_protein_label": "p.Gln3267His", + "source_url": "https://osteosarc.com/variant/DYNC1H1-chr14-102030200/", + "vaccine_count": 1, + "variant_id": "DYNC1H1-chr14-102030200" + } + }, + { + "bam": "12-EPG5-chr18-45925851-fbea0bf403520431.bam", + "case_id": "12-EPG5-chr18-45925851-fbea0bf403520431", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr18", + "pos": 45925851, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "8e1dce95bdbe17410002e04d469c9fd4c1e7545dfa4a424231182c1e3b30f2e8", + "source_receipt_sha256": "fbe025821fd451564e74db573e5a25b1e096d8d4d3961624e7d9e479d835c593", + "source_region_sha256": "5bb135a407066e26e862aaeaffdda22cfbfe3667e09ab0bae376e014fc8592c8" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr18", + "coordinates": "one-based", + "pos": 45925851, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr18", + "end": 45925851, + "reference_length": null, + "start": 45925850 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 80373285, + "SN": "chr18" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbea0bf403520431", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr18", + "gene": "EPG5", + "genomic_validation": { + "allele_offset": 30, + "end": 45925881, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "4d0576525bf1344d6262a98af63e079c92d300c4bfc4f32cf4c88dcc04b07c88", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr18&start=45925820&end=45925881" + }, + "sequence": "ACCAATCCCGAATCACCGCTATCTCAGATGCAGAAGGTTGCCAAAGATACAAAGGCAGTTC", + "start": 45925820 + }, + "pos": 45925851, + "ref": "C", + "source_location": "chr18:45925851", + "source_protein_label": "p.Ala869Thr", + "source_url": "https://osteosarc.com/variant/EPG5-chr18-45925851/", + "vaccine_count": 3, + "variant_id": "EPG5-chr18-45925851" + } + }, + { + "bam": "13-EXOC4-chr7-133274996-53f498a544883d51.bam", + "case_id": "13-EXOC4-chr7-133274996-53f498a544883d51", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "pos": 133274996, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "80a6b4fc12c7a44635abe13c3f551886a62ab39cce91a32dd0c824c2e97894b3", + "source_receipt_sha256": "3cb6e1de84429b8a0611dc723b44e247e828c94f8b6eee67f3c8af0813e90beb", + "source_region_sha256": "e3c2139d0afed2800e75da677a6b3238de03d000c7899780b4a0d2c061274ede" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "coordinates": "one-based", + "pos": 133274996, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr7", + "end": 133274996, + "reference_length": null, + "start": 133274995 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 159345973, + "SN": "chr7" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "53f498a544883d51", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "gene": "EXOC4", + "genomic_validation": { + "allele_offset": 30, + "end": 133275026, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "97c89eac456b62241e7831fcc86c5aa569e6092b6c70be3e66badc5f663b5214", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr7&start=133274965&end=133275026" + }, + "sequence": "TCTCTGCCTTCACCAGGACTCTGTCTACTAGTGACGATGTCGAAGACAGGGAAAATGAAAA", + "start": 133274965 + }, + "pos": 133274996, + "ref": "G", + "source_location": "chr7:133274996", + "source_protein_label": "p.Ser34Ile", + "source_url": "https://osteosarc.com/variant/EXOC4-chr7-133274996/", + "vaccine_count": 4, + "variant_id": "EXOC4-chr7-133274996" + } + }, + { + "bam": "14-F8-chrX-154930861-1b66c15da594a3ef.bam", + "case_id": "14-F8-chrX-154930861-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chrX", + "pos": 154930861, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "6a3419e058b98c65ec5ca792ab51df8dc5c080fca7d5a1208e3dc5c26597fb8e", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chrX", + "coordinates": "one-based", + "pos": 154930861, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chrX", + "end": 154930861, + "reference_length": null, + "start": 154930860 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 156040895, + "SN": "chrX" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chrX", + "gene": "F8", + "genomic_validation": { + "allele_offset": 30, + "end": 154930891, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "8c24d56d68b349891b2c4a7cb89fefb00e2667034324565b47a30d49b9869863", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrX&start=154930830&end=154930891" + }, + "sequence": "CTGTTGACGATACATTTTTTCCCCATGAACTTTCTTGGCTATTCATTAAACCTGATTCTAA", + "start": 154930830 + }, + "pos": 154930861, + "ref": "T", + "source_location": "chrX:154930861", + "source_protein_label": "p.Ser977Arg", + "source_url": "https://osteosarc.com/variant/F8-chrX-154930861/", + "vaccine_count": 1, + "variant_id": "F8-chrX-154930861" + } + }, + { + "bam": "15-FBXO33-chr14-39431722-47b695c1a686c058.bam", + "case_id": "15-FBXO33-chr14-39431722-47b695c1a686c058", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr14", + "pos": 39431722, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "90a6765b38f249af2d4da2506114a1c3d57dafd6b49340b0ce9869395d51310c", + "source_receipt_sha256": "f3f9429f9101a919f27d6981718492bf96ee0b5b8294b7e773ba896f931694b6", + "source_region_sha256": "66b18af31d3961ae74a71936e7fcfc66d508aecfd7c5f179c244ec1d10b8da15" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr14", + "coordinates": "one-based", + "pos": 39431722, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr14", + "end": 39431722, + "reference_length": null, + "start": 39431721 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 107043718, + "SN": "chr14" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "47b695c1a686c058", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr14", + "gene": "FBXO33", + "genomic_validation": { + "allele_offset": 30, + "end": 39431752, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "173545f69d9c5deb816908d6996b2ebead039e2f55af1db81c13b6f9f6131856", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr14&start=39431691&end=39431752" + }, + "sequence": "TCCGTCCCCTGGGCCACCGCCGCTCAGATAGTTCTCGGCGGCGAATTCAACACGCAGCTCT", + "start": 39431691 + }, + "pos": 39431722, + "ref": "G", + "source_location": "chr14:39431722", + "source_protein_label": "p.Asn147Lys", + "source_url": "https://osteosarc.com/variant/FBXO33-chr14-39431722/", + "vaccine_count": 2, + "variant_id": "FBXO33-chr14-39431722" + } + }, + { + "bam": "16-GLIS3-chr9-3856149-1b66c15da594a3ef.bam", + "case_id": "16-GLIS3-chr9-3856149-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr9", + "pos": 3856149, + "ref": "CTGATGTGG" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "d54e63a77cd4f9c2257e7002225dd3503bc7a8ba678c8e4c1dc87961b8f6ca3d", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr9", + "coordinates": "one-based", + "pos": 3856149, + "ref": "CTGATGTGG" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr9", + "end": 3856157, + "reference_length": null, + "start": 3856148 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 138394717, + "SN": "chr9" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr9", + "gene": "GLIS3", + "genomic_validation": { + "allele_offset": 30, + "end": 3856187, + "genome": "hg38", + "receipt": { + "bytes": 225, + "sha256": "1e6933e2decd4bd2f6057527283a880b78d80afd4cb45fa650a5cb95d08fbc48", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr9&start=3856118&end=3856187" + }, + "sequence": "ATTGAAGAAGGAGCTGGAACTCTCCGGGGGCTGATGTGGTGAGGAGATGGAGCAGAAGGTGCAAACCTG", + "start": 3856118 + }, + "pos": 3856149, + "ref": "CTGATGTGG", + "source_location": "chr9:3856149", + "source_protein_label": "p.Ser775fs", + "source_url": "https://osteosarc.com/variant/GLIS3-chr9-3856149/", + "vaccine_count": 1, + "variant_id": "GLIS3-chr9-3856149" + } + }, + { + "bam": "17-H1_2-chr6-26055824-1120a096937e29e1.bam", + "case_id": "17-H1_2-chr6-26055824-1120a096937e29e1", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr6", + "pos": 26055824, + "ref": "ACCTTGGGCTTAGCGG" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "75ae2849a963572a615de3534c1e5f4b99d266752b1e710390153f3543737b9c", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr6", + "coordinates": "one-based", + "pos": 26055824, + "ref": "ACCTTGGGCTTAGCGG" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr6", + "end": 26055839, + "reference_length": null, + "start": 26055823 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 170805979, + "SN": "chr6" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr6", + "gene": "H1-2", + "genomic_validation": { + "allele_offset": 30, + "end": 26055869, + "genome": "hg38", + "receipt": { + "bytes": 234, + "sha256": "a2d25ee0fe96a434409ee0a20a4ab6353f0cd490ff44243879bfdc9c85e1373b", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr6&start=26055793&end=26055869" + }, + "sequence": "TTCTTGGGCGCCGCCTTCTTAGGCTTGACAACCTTGGGCTTAGCGGCCTTGGGCTTCACAGCCTTAGCAGCACTTT", + "start": 26055793 + }, + "pos": 26055824, + "ref": "ACCTTGGGCTTAGCGG", + "source_location": "chr6:26055824", + "source_protein_label": "p.Ala197_Lys201del", + "source_url": "https://osteosarc.com/variant/H1_2-chr6-26055824/", + "vaccine_count": 1, + "variant_id": "H1_2-chr6-26055824" + } + }, + { + "bam": "18-KDM3B-chr5-138391529-fbea0bf403520431.bam", + "case_id": "18-KDM3B-chr5-138391529-fbea0bf403520431", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr5", + "pos": 138391529, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "b590d9d5a42b42739bbae8ca87e6fbd9857d9903a6524f4275845d94a0284315", + "source_receipt_sha256": "fbe025821fd451564e74db573e5a25b1e096d8d4d3961624e7d9e479d835c593", + "source_region_sha256": "5bb135a407066e26e862aaeaffdda22cfbfe3667e09ab0bae376e014fc8592c8" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr5", + "coordinates": "one-based", + "pos": 138391529, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr5", + "end": 138391529, + "reference_length": null, + "start": 138391528 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 181538259, + "SN": "chr5" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbea0bf403520431", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr5", + "gene": "KDM3B", + "genomic_validation": { + "allele_offset": 30, + "end": 138391559, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "4495cab7e9727ce73a5e1ab8f4a60a48b41e97bed0b13e545406b049c2697c21", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr5&start=138391498&end=138391559" + }, + "sequence": "TTACAGCCCCCCAAATTGTCCCGAGAAGAGCCTTCTAATCCTTTCCTGGCATTTGTGGAGA", + "start": 138391498 + }, + "pos": 138391529, + "ref": "C", + "source_location": "chr5:138391529", + "source_protein_label": "p.Pro633Ser", + "source_url": "https://osteosarc.com/variant/KDM3B-chr5-138391529/", + "vaccine_count": 3, + "variant_id": "KDM3B-chr5-138391529" + } + }, + { + "bam": "19-KIF1C-chr17-5007293-fbea0bf403520431.bam", + "case_id": "19-KIF1C-chr17-5007293-fbea0bf403520431", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "pos": 5007293, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "0e92fd2e16f00ed555980035452595e72a81c973bf8a2718524d57d4ed4aa46f", + "source_receipt_sha256": "fbe025821fd451564e74db573e5a25b1e096d8d4d3961624e7d9e479d835c593", + "source_region_sha256": "5bb135a407066e26e862aaeaffdda22cfbfe3667e09ab0bae376e014fc8592c8" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "coordinates": "one-based", + "pos": 5007293, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr17", + "end": 5007293, + "reference_length": null, + "start": 5007292 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 83257441, + "SN": "chr17" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbea0bf403520431", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "gene": "KIF1C", + "genomic_validation": { + "allele_offset": 30, + "end": 5007323, + "genome": "hg38", + "receipt": { + "bytes": 218, + "sha256": "d9255e223520deca72c485698f1291f37e70aed998a4503513d1511ec8df14c9", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr17&start=5007262&end=5007323" + }, + "sequence": "GAGACAGAGAAGATTATAGCTGAGCTGAACGAGACATGGGAGGAGAAGCTACGCAAGACAG", + "start": 5007262 + }, + "pos": 5007293, + "ref": "G", + "source_location": "chr17:5007293", + "source_protein_label": "p.Glu456Lys", + "source_url": "https://osteosarc.com/variant/KIF1C-chr17-5007293/", + "vaccine_count": 3, + "variant_id": "KIF1C-chr17-5007293" + } + }, + { + "bam": "20-KRT18-chr12-52951767-fbea0bf403520431.bam", + "case_id": "20-KRT18-chr12-52951767-fbea0bf403520431", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr12", + "pos": 52951767, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "2a780929ce5b0dd4fc191a1241498e57d9162648f1bbe4583f36cdefa01d79df", + "source_receipt_sha256": "fbe025821fd451564e74db573e5a25b1e096d8d4d3961624e7d9e479d835c593", + "source_region_sha256": "5bb135a407066e26e862aaeaffdda22cfbfe3667e09ab0bae376e014fc8592c8" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr12", + "coordinates": "one-based", + "pos": 52951767, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr12", + "end": 52951767, + "reference_length": null, + "start": 52951766 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 133275309, + "SN": "chr12" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbea0bf403520431", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr12", + "gene": "KRT18", + "genomic_validation": { + "allele_offset": 30, + "end": 52951797, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "04062badf97a2de41fac209f9c905c4ccf30864d5dfadb4f85ab545d03235596", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr12&start=52951736&end=52951797" + }, + "sequence": "GAGAGCACCACAGTGGTCACCACACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCA", + "start": 52951736 + }, + "pos": 52951767, + "ref": "G", + "source_location": "chr12:52951767", + "source_protein_label": "p.Ala287Ser", + "source_url": "https://osteosarc.com/variant/KRT18-chr12-52951767/", + "vaccine_count": 1, + "variant_id": "KRT18-chr12-52951767" + } + }, + { + "bam": "21-MAP2-chr2-209694768-2bc1fc291308debb.bam", + "case_id": "21-MAP2-chr2-209694768-2bc1fc291308debb", + "catalogue_identity": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr2", + "pos": 209694768, + "ref": "CCTGGGCTACTGTGTGTTCAATA" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "fcc9110bdd4741f351cad9086bab2fffd918c1aebdc5a1dccd4c0ad3eca0d2e9", + "source_receipt_sha256": "f86c55c088ad941104512bc91aa25c3e94520743a8821c6cc89323366e9d096a", + "source_region_sha256": "8ef655163d11c1d6354f02944d8e9503be33bd2ef0c3d764ab662709435dfaaa" + }, + "native_variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr2", + "coordinates": "one-based", + "pos": 209694768, + "ref": "CCTGGGCTACTGTGTGTTCAATA" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr2", + "end": 209694790, + "reference_length": null, + "start": 209694767 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 242193529, + "SN": "chr2" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "2bc1fc291308debb", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr2", + "gene": "MAP2", + "genomic_validation": { + "allele_offset": 30, + "end": 209694820, + "genome": "hg38", + "receipt": { + "bytes": 243, + "sha256": "4d098b9a04c70e6d81ee19685735f7415fbd50b8e7c92569aa783d59343e55bc", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr2&start=209694737&end=209694820" + }, + "sequence": "CATTGTAAAAACGGACAGTCAGCTCGAAGACCTGGGCTACTGTGTGTTCAATAAGTACACAGTCCCATTGCCATCACCTGTTC", + "start": 209694737 + }, + "pos": 209694768, + "ref": "CCTGGGCTACTGTGTGTTCAATA", + "source_location": "chr2:209694768", + "source_protein_label": "p.Leu867fs", + "source_url": "https://osteosarc.com/variant/MAP2-chr2-209694768/", + "vaccine_count": 3, + "variant_id": "MAP2-chr2-209694768" + } + }, + { + "bam": "22-MT_ND5-chrM-12994-f30f618fb76a0e49.bam", + "case_id": "22-MT_ND5-chrM-12994-f30f618fb76a0e49", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "historical_selection": { + "selection": "complete expanded locus", + "selection_row_sha256": "5fb1d3dc9abc02c670f1b7b6dfbe42274b24164738b8a04acc9e2f208ec3dc24", + "source_receipt_sha256": "6dec36f21a037f16ff5b337b76c71b405d5c783d3011536f0e1b924866bdb066", + "source_region_sha256": "8c60781ff61622445c53a6d561660a9edbacfc22764048bcec28e7e175def2ca" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "coordinates": "one-based", + "pos": 12994, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chrM", + "end": 12994, + "reference_length": 16569, + "start": 12993 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": "rCRS", + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 16569, + "SN": "chrM" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "f30f618fb76a0e49", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13024, + "genome": "hg38", + "receipt": { + "bytes": 213, + "sha256": "f36b6b5a1172d89c0f2b801232b8c1993b280019e4f9035acf006562bc92f38c", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrM&start=12963&end=13024" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12963 + }, + "pos": 12994, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "23-MYO15B-chr17-75589953-7010dd389c50467d.bam", + "case_id": "23-MYO15B-chr17-75589953-7010dd389c50467d", + "catalogue_identity": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr17", + "pos": 75589953, + "ref": "GC" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "5214a9678f90a7ccb0efdf90c94f9ec5476bb7ba3569a4d995b17b0123f2516b", + "source_receipt_sha256": "ecdd7f46a717fd76b016de877cb015142e64d237b81e25ba7fb697a28e32676a", + "source_region_sha256": "8abef7f0013d238bd68340fefdc19230c03f1dd0d8849a34c2c794ae030a6dcf" + }, + "native_variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr17", + "coordinates": "one-based", + "pos": 75589953, + "ref": "GC" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr17", + "end": 75589954, + "reference_length": null, + "start": 75589952 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 83257441, + "SN": "chr17" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "7010dd389c50467d", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr17", + "gene": "MYO15B", + "genomic_validation": { + "allele_offset": 30, + "end": 75589984, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "623c14e4de067e1e02c15fbd51adc47a98936d45e785580be2e9b33fc55efc21", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr17&start=75589922&end=75589984" + }, + "sequence": "TGAGGCGGAGTTGGAGACCCTCAATGACGAGCCCCCGGTGCGCTGGGCGCAGGGCTCAGGCC", + "start": 75589922 + }, + "pos": 75589953, + "ref": "GC", + "source_location": "chr17:75589953", + "source_protein_label": "fs", + "source_url": "https://osteosarc.com/variant/MYO15B-chr17-75589953/", + "vaccine_count": 2, + "variant_id": "MYO15B-chr17-75589953" + } + }, + { + "bam": "24-MYO9A-chr15-71994488-f30f618fb76a0e49.bam", + "case_id": "24-MYO9A-chr15-71994488-f30f618fb76a0e49", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr15", + "pos": 71994488, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "1b5269bbef196950511d0a167859b2ca65389ae13967efa9bcb3e95846e133ee", + "source_receipt_sha256": "6dec36f21a037f16ff5b337b76c71b405d5c783d3011536f0e1b924866bdb066", + "source_region_sha256": "8c60781ff61622445c53a6d561660a9edbacfc22764048bcec28e7e175def2ca" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr15", + "coordinates": "one-based", + "pos": 71994488, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr15", + "end": 71994488, + "reference_length": null, + "start": 71994487 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 101991189, + "SN": "chr15" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "f30f618fb76a0e49", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr15", + "gene": "MYO9A", + "genomic_validation": { + "allele_offset": 30, + "end": 71994518, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "dfac41e3fd1a9ba86ecb71d4ab268d902cef1b76fb801df4896bb6d2a9677235", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr15&start=71994457&end=71994518" + }, + "sequence": "TATATCATTACCTTGGTATTATGCTCTAAATCTTTACTATTCAGAAGTGCATGATTAATTC", + "start": 71994457 + }, + "pos": 71994488, + "ref": "T", + "source_location": "chr15:71994488", + "source_protein_label": "p.Asp523Val", + "source_url": "https://osteosarc.com/variant/MYO9A-chr15-71994488/", + "vaccine_count": 2, + "variant_id": "MYO9A-chr15-71994488" + } + }, + { + "bam": "25-NAV2-chr11-20080142-8fda918141cedf55.bam", + "case_id": "25-NAV2-chr11-20080142-8fda918141cedf55", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr11", + "pos": 20080142, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "04fba71c808c0542778af73fced521308a99dfa09a092b5701374a224990a692", + "source_receipt_sha256": "b940e9530429f936e84934ce89bebbebf95d6f1ab99c8af59039ce0809954a32", + "source_region_sha256": "3fe0a4d9d47532b9469c114a7c915521659116d4468f3973ec1c6c1e2f350836" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr11", + "coordinates": "one-based", + "pos": 20080142, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr11", + "end": 20080142, + "reference_length": null, + "start": 20080141 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 135086622, + "SN": "chr11" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "8fda918141cedf55", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/SARC0277/SARC0277.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr11", + "gene": "NAV2", + "genomic_validation": { + "allele_offset": 30, + "end": 20080172, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "ac0b38c89d6ffa9d3f60394c5e29814d2ffb167a90d0e4dfa603e41a9ed25038", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr11&start=20080111&end=20080172" + }, + "sequence": "CCTCAGACAGCGTCTCCAGCATCAACAGTGCCACCAGCCACTCCAGCGTGGGCAGCAACAT", + "start": 20080111 + }, + "pos": 20080142, + "ref": "C", + "source_location": "chr11:20080142", + "source_protein_label": "p.Ala1809Val", + "source_url": "https://osteosarc.com/variant/NAV2-chr11-20080142/", + "vaccine_count": 1, + "variant_id": "NAV2-chr11-20080142" + } + }, + { + "bam": "26-NME1-chr17-51154443-53f498a544883d51.bam", + "case_id": "26-NME1-chr17-51154443-53f498a544883d51", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "pos": 51154443, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "17448010d62548e49839b7ca208d2732be991b1e9392a2f1ccda1bcdf2db8745", + "source_receipt_sha256": "3cb6e1de84429b8a0611dc723b44e247e828c94f8b6eee67f3c8af0813e90beb", + "source_region_sha256": "e3c2139d0afed2800e75da677a6b3238de03d000c7899780b4a0d2c061274ede" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "coordinates": "one-based", + "pos": 51154443, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr17", + "end": 51154443, + "reference_length": null, + "start": 51154442 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 83257441, + "SN": "chr17" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "53f498a544883d51", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "gene": "NME1", + "genomic_validation": { + "allele_offset": 30, + "end": 51154473, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "08580db1a73042c10a45eded09bfa61f7da551ebf1ff55c4465520d3d529e79e", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr17&start=51154412&end=51154473" + }, + "sequence": "GAGGGGCCTCCTATCTCAAGCTGTGATACAGGGTAGGTCATGAGCGCAGTCTTCTGTAAAA", + "start": 51154412 + }, + "pos": 51154443, + "ref": "G", + "source_location": "chr17:51154443", + "source_protein_label": "p.Gly24Arg", + "source_url": "https://osteosarc.com/variant/NME1-chr17-51154443/", + "vaccine_count": 1, + "variant_id": "NME1-chr17-51154443" + } + }, + { + "bam": "27-NR2F2-chr15-96332299-f30f618fb76a0e49.bam", + "case_id": "27-NR2F2-chr15-96332299-f30f618fb76a0e49", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr15", + "pos": 96332299, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "c36352d9a9de4f8e5a3d32dd1813b6e7fc4ed8f065a736245d4d5c0dfd32ab69", + "source_receipt_sha256": "6dec36f21a037f16ff5b337b76c71b405d5c783d3011536f0e1b924866bdb066", + "source_region_sha256": "8c60781ff61622445c53a6d561660a9edbacfc22764048bcec28e7e175def2ca" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr15", + "coordinates": "one-based", + "pos": 96332299, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr15", + "end": 96332299, + "reference_length": null, + "start": 96332298 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 101991189, + "SN": "chr15" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "f30f618fb76a0e49", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr15", + "gene": "NR2F2", + "genomic_validation": { + "allele_offset": 30, + "end": 96332329, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "13d91e07828b8169eed764c0164f50a2d19dc12869c611353ca2792fb771465f", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr15&start=96332268&end=96332329" + }, + "sequence": "CGGCGGCCGGTGGCCAGGGCGGCCCTGGCGGCCCGGGTAGCGACAAGCAGCAGCAGCAGCA", + "start": 96332268 + }, + "pos": 96332299, + "ref": "G", + "source_location": "chr15:96332299", + "source_protein_label": "p.Gly65Val", + "source_url": "https://osteosarc.com/variant/NR2F2-chr15-96332299/", + "vaccine_count": 3, + "variant_id": "NR2F2-chr15-96332299" + } + }, + { + "bam": "28-NTF3-chr12-5494381-53f498a544883d51.bam", + "case_id": "28-NTF3-chr12-5494381-53f498a544883d51", + "catalogue_identity": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr12", + "pos": 5494381, + "ref": "A" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "ae07e376b4d49964b8b6cd602a1b96e0399e781fbdf224eef8254ef1afeba429", + "source_receipt_sha256": "3cb6e1de84429b8a0611dc723b44e247e828c94f8b6eee67f3c8af0813e90beb", + "source_region_sha256": "e3c2139d0afed2800e75da677a6b3238de03d000c7899780b4a0d2c061274ede" + }, + "native_variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr12", + "coordinates": "one-based", + "pos": 5494381, + "ref": "A" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr12", + "end": 5494381, + "reference_length": null, + "start": 5494380 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 133275309, + "SN": "chr12" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "53f498a544883d51", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr12", + "gene": "NTF3", + "genomic_validation": { + "allele_offset": 30, + "end": 5494411, + "genome": "hg38", + "receipt": { + "bytes": 218, + "sha256": "4cca357f71eb8a871ffc63fc9dfd3507596e645803fbecade0ee12ca40bdd316", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr12&start=5494350&end=5494411" + }, + "sequence": "ACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGC", + "start": 5494350 + }, + "pos": 5494381, + "ref": "A", + "source_location": "chr12:5494381", + "source_protein_label": "p.Lys69Ser", + "source_url": "https://osteosarc.com/variant/NTF3-chr12-5494381/", + "vaccine_count": 1, + "variant_id": "NTF3-chr12-5494381" + } + }, + { + "bam": "29-PIP5K1A-chr1-151242178-47b695c1a686c058.bam", + "case_id": "29-PIP5K1A-chr1-151242178-47b695c1a686c058", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr1", + "pos": 151242178, + "ref": "AG" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "ad560e1173a6e422b5ba5fe7dcfc5d541402c61b1991f4f160c5b00c21c03204", + "source_receipt_sha256": "f3f9429f9101a919f27d6981718492bf96ee0b5b8294b7e773ba896f931694b6", + "source_region_sha256": "66b18af31d3961ae74a71936e7fcfc66d508aecfd7c5f179c244ec1d10b8da15" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr1", + "coordinates": "one-based", + "pos": 151242178, + "ref": "AG" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151242179, + "reference_length": null, + "start": 151242177 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 248956422, + "SN": "chr1" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "47b695c1a686c058", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr1", + "gene": "PIP5K1A", + "genomic_validation": { + "allele_offset": 30, + "end": 151242209, + "genome": "hg38", + "receipt": { + "bytes": 222, + "sha256": "afb69812dce63ec6829968ea811341370518bab627cc7af44c3952af6f865818", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr1&start=151242147&end=151242209" + }, + "sequence": "TCGGTCTGGCTCATCTTTCTCTCGGCGAGCAGGCTCCAGTGGCAACTCCTGCATTACTTACC", + "start": 151242147 + }, + "pos": 151242178, + "ref": "AG", + "source_location": "chr1:151242178", + "source_protein_label": "p.Gly474fs", + "source_url": "https://osteosarc.com/variant/PIP5K1A-chr1-151242178/", + "vaccine_count": 3, + "variant_id": "PIP5K1A-chr1-151242178" + } + }, + { + "bam": "30-PRICKLE2-chr3-64198863-53f498a544883d51.bam", + "case_id": "30-PRICKLE2-chr3-64198863-53f498a544883d51", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr3", + "pos": 64198863, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "6f098dd0098d906535d8fd5ff8583fd9afc69b8dfe7fd37919a6e462cf149700", + "source_receipt_sha256": "3cb6e1de84429b8a0611dc723b44e247e828c94f8b6eee67f3c8af0813e90beb", + "source_region_sha256": "e3c2139d0afed2800e75da677a6b3238de03d000c7899780b4a0d2c061274ede" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr3", + "coordinates": "one-based", + "pos": 64198863, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr3", + "end": 64198863, + "reference_length": null, + "start": 64198862 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 198295559, + "SN": "chr3" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "53f498a544883d51", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr3", + "gene": "PRICKLE2", + "genomic_validation": { + "allele_offset": 30, + "end": 64198893, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "0be2d26cb46912157e399330317732da9e4bd8f0da356da249886bd7375bf38c", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr3&start=64198832&end=64198893" + }, + "sequence": "CAGCCTGAGTCATCATCTGAGGTCGAGTTCCTCTGAAAGTCAAACATGAGTTTGCTGATGG", + "start": 64198832 + }, + "pos": 64198863, + "ref": "C", + "source_location": "chr3:64198863", + "source_protein_label": "p.Arg22Lys", + "source_url": "https://osteosarc.com/variant/PRICKLE2-chr3-64198863/", + "vaccine_count": 1, + "variant_id": "PRICKLE2-chr3-64198863" + } + }, + { + "bam": "31-PTH1R-chr3-46898732-1b66c15da594a3ef.bam", + "case_id": "31-PTH1R-chr3-46898732-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr3", + "pos": 46898732, + "ref": "A" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "f5ab571d34c43d1f36c9dbcc9a1a39e1acfe0edc8d1dbbdfc0cf7b55596b6052", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr3", + "coordinates": "one-based", + "pos": 46898732, + "ref": "A" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr3", + "end": 46898732, + "reference_length": null, + "start": 46898731 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 198295559, + "SN": "chr3" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr3", + "gene": "PTH1R", + "genomic_validation": { + "allele_offset": 30, + "end": 46898762, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "76e1c7e5c03e9d8aa5fdcdc58d6bfd0acb49aee61fe1db90fa9b2d922f284702", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr3&start=46898701&end=46898762" + }, + "sequence": "TTCCTGTCCTTCATGCTGCGCGCCGTGAGCATCTTCGTCAAGGACGCTGTGCTCTACTCTG", + "start": 46898701 + }, + "pos": 46898732, + "ref": "A", + "source_location": "chr3:46898732", + "source_protein_label": "p.Ile237Phe", + "source_url": "https://osteosarc.com/variant/PTH1R-chr3-46898732/", + "vaccine_count": 1, + "variant_id": "PTH1R-chr3-46898732" + } + }, + { + "bam": "32-RNF213-chr17-80327830-1b66c15da594a3ef.bam", + "case_id": "32-RNF213-chr17-80327830-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "pos": 80327830, + "ref": "ATAC" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "3f25b30bd5e2fe8981fd6a662743f6dfc19acfea34497b7d67ef595c852d313c", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "coordinates": "one-based", + "pos": 80327830, + "ref": "ATAC" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr17", + "end": 80327833, + "reference_length": null, + "start": 80327829 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 83257441, + "SN": "chr17" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr17", + "gene": "RNF213", + "genomic_validation": { + "allele_offset": 30, + "end": 80327863, + "genome": "hg38", + "receipt": { + "bytes": 223, + "sha256": "c411d1b466e5eae165f2749c1c0af753a95e6a13e387a818d4364d852c4ca5b4", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr17&start=80327799&end=80327863" + }, + "sequence": "TTCTTCATCTATTCAGGAACCGACGAGAAAATACTAGCAAATGTCACAGAGGATGCCAAGAGGC", + "start": 80327799 + }, + "pos": 80327830, + "ref": "ATAC", + "source_location": "chr17:80327830", + "source_protein_label": "p.Ile1070Ile (del Leu)", + "source_url": "https://osteosarc.com/variant/RNF213-chr17-80327830/", + "vaccine_count": 1, + "variant_id": "RNF213-chr17-80327830" + } + }, + { + "bam": "33-ROBO2-chr3-77607853-1b66c15da594a3ef.bam", + "case_id": "33-ROBO2-chr3-77607853-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr3", + "pos": 77607853, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "9aac431596890dec8745bf0d2034b72257814afb0395468e77c5b3d24550820c", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr3", + "coordinates": "one-based", + "pos": 77607853, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr3", + "end": 77607853, + "reference_length": null, + "start": 77607852 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 198295559, + "SN": "chr3" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr3", + "gene": "ROBO2", + "genomic_validation": { + "allele_offset": 30, + "end": 77607883, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "1e42a16d04c03a8f53946bd240925b5c6b7737b53160ed25b3582442fd4d50e2", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr3&start=77607822&end=77607883" + }, + "sequence": "AAATAAAAACTCTTCTAAACCACAGAAAAACAATGGATCCACTTGGGCCAATGTCCCTCTA", + "start": 77607822 + }, + "pos": 77607853, + "ref": "C", + "source_location": "chr3:77607853", + "source_protein_label": "p.Asn1080Lys", + "source_url": "https://osteosarc.com/variant/ROBO2-chr3-77607853/", + "vaccine_count": 1, + "variant_id": "ROBO2-chr3-77607853" + } + }, + { + "bam": "34-SLC25A12-chr2-171813470-fbea0bf403520431.bam", + "case_id": "34-SLC25A12-chr2-171813470-fbea0bf403520431", + "catalogue_identity": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr2", + "pos": 171813470, + "ref": "A" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "7b5b7f00194dcd05d417afc08787f3d2b37b6ecb17750dd37bafa1dca3ee2b95", + "source_receipt_sha256": "fbe025821fd451564e74db573e5a25b1e096d8d4d3961624e7d9e479d835c593", + "source_region_sha256": "5bb135a407066e26e862aaeaffdda22cfbfe3667e09ab0bae376e014fc8592c8" + }, + "native_variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr2", + "coordinates": "one-based", + "pos": 171813470, + "ref": "A" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr2", + "end": 171813470, + "reference_length": null, + "start": 171813469 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 242193529, + "SN": "chr2" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbea0bf403520431", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr2", + "gene": "SLC25A12", + "genomic_validation": { + "allele_offset": 30, + "end": 171813500, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "b449821cea8625dc7d80d7aff0d68649c4d5bb87ba0618e010b8367ae5619c0b", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr2&start=171813439&end=171813500" + }, + "sequence": "TGGTTTTGCATTCGGGTCTTCACCAGATCTATAGGATACACTGCAGTGGCTCCCACAGCTA", + "start": 171813439 + }, + "pos": 171813470, + "ref": "A", + "source_location": "chr2:171813470", + "source_protein_label": "p.Ile347Thr", + "source_url": "https://osteosarc.com/variant/SLC25A12-chr2-171813470/", + "vaccine_count": 4, + "variant_id": "SLC25A12-chr2-171813470" + } + }, + { + "bam": "35-SMC5-chr9-70298024-1120a096937e29e1.bam", + "case_id": "35-SMC5-chr9-70298024-1120a096937e29e1", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr9", + "pos": 70298024, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "4e54b57114b87c869295328e3525c65759e5bbf888c4254e5e1ba63dc6a7a3d1", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr9", + "coordinates": "one-based", + "pos": 70298024, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr9", + "end": 70298024, + "reference_length": null, + "start": 70298023 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 138394717, + "SN": "chr9" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chr9", + "gene": "SMC5", + "genomic_validation": { + "allele_offset": 30, + "end": 70298054, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "eb06be23ed9702974b2343b4512c44ef6863f01282a2c7c9bf37923741b3a554", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr9&start=70297993&end=70298054" + }, + "sequence": "TAAAGCAAAATGAAGAGCTTGACCGACAGAGGAGAATAGGTAATACCCGCAAAATGATAGA", + "start": 70297993 + }, + "pos": 70298024, + "ref": "G", + "source_location": "chr9:70298024", + "source_protein_label": "p.Arg371Lys", + "source_url": "https://osteosarc.com/variant/SMC5-chr9-70298024/", + "vaccine_count": 1, + "variant_id": "SMC5-chr9-70298024" + } + }, + { + "bam": "36-TECPR1-chr7-98241127-8fda918141cedf55.bam", + "case_id": "36-TECPR1-chr7-98241127-8fda918141cedf55", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "pos": 98241127, + "ref": "TG" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "87d3cbc477a55930e3c237d00ae653c8e0af6bd0c5f000d51661727d856b2501", + "source_receipt_sha256": "b940e9530429f936e84934ce89bebbebf95d6f1ab99c8af59039ce0809954a32", + "source_region_sha256": "3fe0a4d9d47532b9469c114a7c915521659116d4468f3973ec1c6c1e2f350836" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "coordinates": "one-based", + "pos": 98241127, + "ref": "TG" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr7", + "end": 98241128, + "reference_length": null, + "start": 98241126 + }, + "reference": { + "dictionary_sha256": "04d5a351c0c1fa55212c1c3e24068badf755a1289fbdf4ed17a3bf8890b3611f", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 159345973, + "SN": "chr7" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "8fda918141cedf55", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/SARC0277/SARC0277.Aligned.sortedByCoord.out.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "gene": "TECPR1", + "genomic_validation": { + "allele_offset": 30, + "end": 98241158, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "e054af6eb5e8b8ebc96a8a08513e89f473b2e0583b5fc470d6dae841d31942c7", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr7&start=98241096&end=98241158" + }, + "sequence": "CCCGGACCAGGGCCTGTCCCTCCCAGAGTGTGGCCCACAGGAGGTCGTGGGGCCCACAGCTG", + "start": 98241096 + }, + "pos": 98241127, + "ref": "TG", + "source_location": "chr7:98241127", + "source_protein_label": "p.Thr259fs", + "source_url": "https://osteosarc.com/variant/TECPR1-chr7-98241127/", + "vaccine_count": 4, + "variant_id": "TECPR1-chr7-98241127" + } + }, + { + "bam": "37-TMRO-chr9-97910412-1b66c15da594a3ef.bam", + "case_id": "37-TMRO-chr9-97910412-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr9", + "pos": 97910412, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "39aabcf7b3d70eb84c4ee9183e621b0419b5ddbf51e90b6221ec8f3e38d82f16", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr9", + "coordinates": "one-based", + "pos": 97910412, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr9", + "end": 97910412, + "reference_length": null, + "start": 97910411 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 138394717, + "SN": "chr9" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr9", + "gene": "TMRO", + "genomic_validation": { + "allele_offset": 30, + "end": 97910442, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "e15d2f95ee709df85e2b487acc03e20723337ed2d97da505ea0c48c2053dbada", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr9&start=97910381&end=97910442" + }, + "sequence": "GTGCTATGGTGGGGTTGTGGCTCATCACACCCTGAGAGCTGTCGCTGGTCACAGCTGTCAG", + "start": 97910381 + }, + "pos": 97910412, + "ref": "C", + "source_location": "chr9:97910412", + "source_protein_label": "p.Gly205Glu", + "source_url": "https://osteosarc.com/variant/TMRO-chr9-97910412/", + "vaccine_count": 1, + "variant_id": "TMRO-chr9-97910412" + } + }, + { + "bam": "38-VPS13B-chr8-99861923-1b66c15da594a3ef.bam", + "case_id": "38-VPS13B-chr8-99861923-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr8", + "pos": 99861923, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "5bc5b239dc6ec868f9d6c7c471a90572ad6890fc2c093bb4b8d7277dc3b4796a", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr8", + "coordinates": "one-based", + "pos": 99861923, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr8", + "end": 99861923, + "reference_length": null, + "start": 99861922 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 145138636, + "SN": "chr8" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr8", + "gene": "VPS13B", + "genomic_validation": { + "allele_offset": 30, + "end": 99861953, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "7cfed7df2f71be43a150907ca9384ae50ab22eae9587268bfd256dde2e717aaa", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr8&start=99861892&end=99861953" + }, + "sequence": "GCCTGGGCGAGGGGCTTCGACAGGGCCTGTCCCGGCTGGGCATCAGCCTGCTTGGTAAGGG", + "start": 99861892 + }, + "pos": 99861923, + "ref": "C", + "source_location": "chr8:99861923", + "source_protein_label": "p.Ser3756Phe", + "source_url": "https://osteosarc.com/variant/VPS13B-chr8-99861923/", + "vaccine_count": 5, + "variant_id": "VPS13B-chr8-99861923" + } + }, + { + "bam": "39-VPS72-chr1-151185547-1120a096937e29e1.bam", + "case_id": "39-VPS72-chr1-151185547-1120a096937e29e1", + "catalogue_identity": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr1", + "pos": 151185547, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "34ba1d9f51452f6f01f938530b1e17bb50a1546347d3e27ef2e5b119a815e54e", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr1", + "coordinates": "one-based", + "pos": 151185547, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151185547, + "reference_length": null, + "start": 151185546 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 248956422, + "SN": "chr1" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr1", + "gene": "VPS72", + "genomic_validation": { + "allele_offset": 30, + "end": 151185577, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "71a1c30ac450054288ce616eafeb8fb7fa4ab618aa7400c1eb2f24c5ea60dc8f", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr1&start=151185516&end=151185577" + }, + "sequence": "TCATCTTGTAGTTCTAATGGCAGTAGTGCCTTCTCTTCTCGCGCCTTCTGAGAGCTACCAG", + "start": 151185516 + }, + "pos": 151185547, + "ref": "T", + "source_location": "chr1:151185547", + "source_protein_label": "p.Lys115Arg", + "source_url": "https://osteosarc.com/variant/VPS72-chr1-151185547/", + "vaccine_count": 1, + "variant_id": "VPS72-chr1-151185547" + } + }, + { + "bam": "40-WWC1-chr5-168399513-1b66c15da594a3ef.bam", + "case_id": "40-WWC1-chr5-168399513-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr5", + "pos": 168399513, + "ref": "T" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "189a161ee968c25ddbbf013c7639b6b1d17596df09c52d224bade0f60c4bc669", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr5", + "coordinates": "one-based", + "pos": 168399513, + "ref": "T" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr5", + "end": 168399513, + "reference_length": null, + "start": 168399512 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 181538259, + "SN": "chr5" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "G", + "assembly": "GRCh38", + "chrom": "chr5", + "gene": "WWC1", + "genomic_validation": { + "allele_offset": 30, + "end": 168399543, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "715d3806a47ada81c7d4ec4a96c1c1cfa79c72e7aecef1d4ad3d14f19965e1ef", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr5&start=168399482&end=168399543" + }, + "sequence": "TCCAGGTCAACAAGCTGAAGAGAGAGATGGTTCACCTCCAGCACGAGCTGCAGTTCAAAGA", + "start": 168399482 + }, + "pos": 168399513, + "ref": "T", + "source_location": "chr5:168399513", + "source_protein_label": "p.Val179Gly", + "source_url": "https://osteosarc.com/variant/WWC1-chr5-168399513/", + "vaccine_count": 1, + "variant_id": "WWC1-chr5-168399513" + } + }, + { + "bam": "41-ZNF436-chr1-23362762-1b66c15da594a3ef.bam", + "case_id": "41-ZNF436-chr1-23362762-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr1", + "pos": 23362762, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "72cfdb710227e4929b8e2d3edb267216c90c8a50049c851a21e00ab3bd45ce4a", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr1", + "coordinates": "one-based", + "pos": 23362762, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr1", + "end": 23362762, + "reference_length": null, + "start": 23362761 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 248956422, + "SN": "chr1" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "C", + "assembly": "GRCh38", + "chrom": "chr1", + "gene": "ZNF436", + "genomic_validation": { + "allele_offset": 30, + "end": 23362792, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "07fdb7e85cdd07f899651fec269ca8a53c96488b5dc9fce3308775c9b24018ba", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr1&start=23362731&end=23362792" + }, + "sequence": "GTGTGGATTGTCTGATGCTGAATCAGGTGAGAACTTCTTCCAAAACTTTTCCCACACTCGT", + "start": 23362731 + }, + "pos": 23362762, + "ref": "G", + "source_location": "chr1:23362762", + "source_protein_label": "p.Ser207Cys", + "source_url": "https://osteosarc.com/variant/ZNF436-chr1-23362762/", + "vaccine_count": 2, + "variant_id": "ZNF436-chr1-23362762" + } + }, + { + "bam": "42-ZNF674-chrX-46501045-1b66c15da594a3ef.bam", + "case_id": "42-ZNF674-chrX-46501045-1b66c15da594a3ef", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrX", + "pos": 46501045, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "fbc296acea0525c6bf47a7552b67db61cd86ee383ebf61e38e41c4e6daa37766", + "source_receipt_sha256": "ed45205f69a9df114a0eb1a86f775de3c8b3242340a581833d4fc1ef37a92819", + "source_region_sha256": "79da2651c583352e3e1f50987a01389a19798a90f005cbc2fde5ea802c28f378" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrX", + "coordinates": "one-based", + "pos": 46501045, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chrX", + "end": 46501045, + "reference_length": null, + "start": 46501044 + }, + "reference": { + "dictionary_sha256": "e0b0ac4aadccc2a33d5e9a982085745a586cc574875b2551bb2d3862803db324", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 156040895, + "SN": "chrX" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1b66c15da594a3ef", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrX", + "gene": "ZNF674", + "genomic_validation": { + "allele_offset": 30, + "end": 46501075, + "genome": "hg38", + "receipt": { + "bytes": 219, + "sha256": "b037066aaf863812f54724ae2af11a0772f340fad6d74b005eee5337393bb49d", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrX&start=46501014&end=46501075" + }, + "sequence": "CAGGTTGAGCTTTATGAAGATTATAATGGAGGCATACTTTCCAATATGCCTTACATCCATC", + "start": 46501014 + }, + "pos": 46501045, + "ref": "G", + "source_location": "chrX:46501045", + "source_protein_label": "p.Leu182Phe", + "source_url": "https://osteosarc.com/variant/ZNF674-chrX-46501045/", + "vaccine_count": 1, + "variant_id": "ZNF674-chrX-46501045" + } + }, + { + "bam": "43-ZNF764-chr16-30557995-1120a096937e29e1.bam", + "case_id": "43-ZNF764-chr16-30557995-1120a096937e29e1", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr16", + "pos": 30557995, + "ref": "C" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "3ac19b7aa48e1d12feb41404f7d5c2a57a84ee13310406c883075d3f2e3284d1", + "source_receipt_sha256": "4d60946567542a5cf7dadf53287dd588f8c75862bbac3fd2e44023bfcb0e2d74", + "source_region_sha256": "eb0eebd5ac4736114873f20f3aea7ecda1b670195dd5fd1bd8c1e365e620064c" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr16", + "coordinates": "one-based", + "pos": 30557995, + "ref": "C" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chr16", + "end": 30557995, + "reference_length": null, + "start": 30557994 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 90338345, + "SN": "chr16" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "1120a096937e29e1", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr16", + "gene": "ZNF764", + "genomic_validation": { + "allele_offset": 30, + "end": 30558025, + "genome": "hg38", + "receipt": { + "bytes": 220, + "sha256": "d2e8ba2a62cd6ee14f55e933660ec36acc3941536d8bef802e987a86e7cdf701", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr16&start=30557964&end=30558025" + }, + "sequence": "GGCGAGCAGGTGGGGCTCTCACCGAGAGCGCTCAGGTGGCCGTAGGTCTCCCGCATCACGT", + "start": 30557964 + }, + "pos": 30557995, + "ref": "C", + "source_location": "chr16:30557995", + "source_protein_label": "p.Ser63Asn", + "source_url": "https://osteosarc.com/variant/ZNF764-chr16-30557995/", + "vaccine_count": 1, + "variant_id": "ZNF764-chr16-30557995" + } + }, + { + "bam": "44-MT_ND5-chrM-12994-238f917202dd9997.bam", + "case_id": "44-MT_ND5-chrM-12994-238f917202dd9997", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "681adc14fb73f60564ed8b59616f72f5f0add573c23b3a22f0867df9ad3be861", + "source_region_sha256": "bf1166ecd0a642c301191ff19675b4412fb3f12d11da171353f6d2c624829d49" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh37", + "chrom": "MT", + "coordinates": "one-based", + "pos": 12994, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh37", + "contig": "MT", + "end": 12994, + "reference_length": 16569, + "start": 12993 + }, + "reference": { + "dictionary_sha256": "9ba2f9111e9295daeeb307200b47f69ae34e41e7178c644063846086acb654a1", + "mitochondrial_reference": "rCRS", + "nuclear_assembly": "GRCh37", + "sequence": { + "LN": 16569, + "SN": "MT" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "238f917202dd9997", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/tempus/TL-24-ALMY2X4KMV/RNA/TL-24-ALMY2X4KMV_T_sorted.bam", + "variant": { + "alt": "A", + "assembly": "GRCh37", + "chrom": "chrM", + "coordinate_mapping": { + "method": "rCRS MT, not UCSC hg19 chrM", + "reference_length": 16569 + }, + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13024, + "genome": "hg38", + "receipt": { + "bytes": 213, + "sha256": "f36b6b5a1172d89c0f2b801232b8c1993b280019e4f9035acf006562bc92f38c", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrM&start=12963&end=13024" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12963 + }, + "original_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "pos": 12994, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam", + "case_id": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "771bc1d14258b99f336f6ce18a58528fe5831130a25b0c04a4903da8fafe0ac6", + "source_region_sha256": "7066148b3a84af932d23ca18097a279fd7ddb40c2aaaeb4bb6a9341c12d227ef" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh37", + "chrom": "chrM", + "coordinates": "one-based", + "pos": 12995, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh37", + "contig": "chrM", + "end": 12995, + "reference_length": 16571, + "start": 12994 + }, + "reference": { + "dictionary_sha256": "a5f39d7840f60d9213611cf7a79de5d6c0d825b6c54292f0dcc3e1695000811a", + "mitochondrial_reference": "UCSC-hg19-chrM", + "nuclear_assembly": "GRCh37", + "sequence": { + "LN": 16571, + "SN": "chrM" + }, + "validation_genome": "hg19" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbeb5d8a415e4d18", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/cegat/P116686_2_S000048/P116686_3.bam", + "variant": { + "alt": "A", + "assembly": "GRCh37", + "chrom": "chrM", + "coordinate_mapping": { + "chain_id": "2406", + "chrom": "chrM", + "end": 12995, + "start": 12994, + "strand": "+" + }, + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13025, + "genome": "hg19", + "receipt": { + "bytes": 213, + "sha256": "644822d1d8988e2adde299255f7a1edfbb90fc515305d50dde42a37459355b26", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg19&chrom=chrM&start=12964&end=13025" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12964 + }, + "original_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "pos": 12995, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "46-MT_ND5-chrM-12994-7010dd389c50467d.bam", + "case_id": "46-MT_ND5-chrM-12994-7010dd389c50467d", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "ecdd7f46a717fd76b016de877cb015142e64d237b81e25ba7fb697a28e32676a", + "source_region_sha256": "8abef7f0013d238bd68340fefdc19230c03f1dd0d8849a34c2c794ae030a6dcf" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "coordinates": "one-based", + "pos": 12994, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chrM", + "end": 12994, + "reference_length": 16569, + "start": 12993 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": "rCRS", + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 16569, + "SN": "chrM" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "7010dd389c50467d", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13024, + "genome": "hg38", + "receipt": { + "bytes": 213, + "sha256": "f36b6b5a1172d89c0f2b801232b8c1993b280019e4f9035acf006562bc92f38c", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrM&start=12963&end=13024" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12963 + }, + "pos": 12994, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "47-MT_ND5-chrM-12994-0066232879babe83.bam", + "case_id": "47-MT_ND5-chrM-12994-0066232879babe83", + "catalogue_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "7ef5077008c4b5a0076e2f0beae74db392c3214eaf7a38a5116f8437141d1695", + "source_region_sha256": "64420d3daab9ebe2f416d546ca162841be632a6b930499f68591517707b7788d" + }, + "native_variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "coordinates": "one-based", + "pos": 12994, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh38", + "contig": "chrM", + "end": 12994, + "reference_length": 16569, + "start": 12993 + }, + "reference": { + "dictionary_sha256": "74d8a55146f406d696a5f4278e8950403e13cc4ad0792b41d62a51fe8e56920a", + "mitochondrial_reference": "rCRS", + "nuclear_assembly": "GRCh38", + "sequence": { + "LN": 16569, + "SN": "chrM" + }, + "validation_genome": "hg38" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "0066232879babe83", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "variant": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13024, + "genome": "hg38", + "receipt": { + "bytes": 213, + "sha256": "f36b6b5a1172d89c0f2b801232b8c1993b280019e4f9035acf006562bc92f38c", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrM&start=12963&end=13024" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12963 + }, + "pos": 12994, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam", + "case_id": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18", + "catalogue_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr15", + "pos": 96332299, + "ref": "G" + }, + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "771bc1d14258b99f336f6ce18a58528fe5831130a25b0c04a4903da8fafe0ac6", + "source_region_sha256": "7066148b3a84af932d23ca18097a279fd7ddb40c2aaaeb4bb6a9341c12d227ef" + }, + "native_variant": { + "alt": "T", + "assembly": "GRCh37", + "chrom": "chr15", + "coordinates": "one-based", + "pos": 96875528, + "ref": "G" + }, + "query_region": { + "assembly": "GRCh37", + "contig": "chr15", + "end": 96875528, + "reference_length": null, + "start": 96875527 + }, + "reference": { + "dictionary_sha256": "a5f39d7840f60d9213611cf7a79de5d6c0d825b6c54292f0dcc3e1695000811a", + "mitochondrial_reference": null, + "nuclear_assembly": "GRCh37", + "sequence": { + "LN": 102531392, + "SN": "chr15" + }, + "validation_genome": "hg19" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbeb5d8a415e4d18", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/cegat/P116686_2_S000048/P116686_3.bam", + "variant": { + "alt": "T", + "assembly": "GRCh37", + "chrom": "chr15", + "coordinate_mapping": { + "chain_id": "16", + "chrom": "chr15", + "end": 96875528, + "start": 96875527, + "strand": "+" + }, + "gene": "NR2F2", + "genomic_validation": { + "allele_offset": 30, + "end": 96875558, + "genome": "hg19", + "receipt": { + "bytes": 220, + "sha256": "1c930cf48c5e8f56d9a0baa0d8b22b9691cd4e4d4bc038dc952526a789e269f4", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg19&chrom=chr15&start=96875497&end=96875558" + }, + "sequence": "CGGCGGCCGGTGGCCAGGGCGGCCCTGGCGGCCCGGGTAGCGACAAGCAGCAGCAGCAGCA", + "start": 96875497 + }, + "original_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr15", + "pos": 96332299, + "ref": "G" + }, + "pos": 96875528, + "ref": "G", + "source_location": "chr15:96332299", + "source_protein_label": "p.Gly65Val", + "source_url": "https://osteosarc.com/variant/NR2F2-chr15-96332299/", + "vaccine_count": 3, + "variant_id": "NR2F2-chr15-96332299" + } + } + ], + "data_version": "native-retrieval-v1", + "dataset": "osteosarc", + "historical_import": { + "commit": "0cad5b275c852263a1c77722aa463fe5568b2c76", + "generator_path": "tests/data/osteosarc/expansion/fixtures.py", + "manifest_sha256": "d656e10c4c2a859e9d7a108e2df68a7bed04189074ae185cba2f1aaddd958e86", + "manifest_url": "https://raw.githubusercontent.com/openvax/isovar/0cad5b275c852263a1c77722aa463fe5568b2c76/tests/data/osteosarc/expansion/corpus/manifest.json", + "repository": "https://github.com/openvax/isovar" + }, + "interpretation": "Deliberately selected regression reads, not full-source coverage, independent platform samples, somatic truth or validated vaccine targets.", + "license_source": "https://registry.opendata.aws/sid-osteosarc/", + "merge_policy": "Check reference dictionaries before merging; query native coordinates, never variant_id.", + "original_vaccine_loci": 44, + "parent": { + "archive_sha256": "6b2d5877d3065d3ca9bdc3cccedb50c7c533d1a5d7237fdbb4fe92b5e2340146", + "data_version": "minimal-vaccine-rna-v2", + "manifest_content_sha256": "905afa11690e9d971052bea2d50167d6fa98528da059cd39c59a78c9cfa66861", + "member_sha256": "570d271ccf6d5f7c12b82af4524a9bc07a5518714975941adeabf74df53ed3ce", + "path": "vaxrank/data/sid-test-data.zip::osteosarc/shared-v1/manifest.json", + "repository": "https://github.com/openvax/vaxrank", + "revision": "0565cf15754fa3ac45b82fa5fc7fd5ddfbe06cfa" + }, + "schema_version": 1, + "scope": "49 indexed-retrieval cases; one explicit template per case; not coverage or VAF", + "source_data_license": "CC0-1.0", + "species": "Homo sapiens", + "taxon_id": 9606 +} diff --git a/osteosarc/fixtures.py b/osteosarc/fixtures.py index e4aaeec..5d016d4 100644 --- a/osteosarc/fixtures.py +++ b/osteosarc/fixtures.py @@ -152,8 +152,22 @@ def load_panel(name): return load_sv_candidates()["targets"] path = Path(__file__).with_name("data") / "panels.json" panels = json.loads(path.read_text()) + if name == "sv-regressions-v2": + panel = copy.deepcopy(panels["sv-regressions-v1"]) + # These are reviewed Isovar fusion traversal conventions, not a generic + # conversion of caller orientation into retained genomic sides. + sides = {"GABBR1-SLC29A1": ("right", "right"), + "OTUD7A-FMN1": ("right", "right"), + "PARD3B-CDKN2B": ("left", "right")} + for key, values in sides.items(): + for end, side in zip(panel[key]["breakends"], values): + end["retained_side"] = side + panel[key]["retained_side_provenance"] = { + "issue": "https://github.com/iskandr/osteosarc/issues/96", + "convention": "Isovar fusion traversal: donor +=left/-=right; acceptor +=right/-=left"} + return panel if name not in panels: - raise KeyError(f"Unknown panel {name!r}; available: {', '.join(sorted([*panels, 'sv-candidates-v1']))}") + raise KeyError(f"Unknown panel {name!r}; available: {', '.join(sorted([*panels, 'sv-candidates-v1', 'sv-regressions-v2']))}") return copy.deepcopy(panels[name]) diff --git a/osteosarc/models.py b/osteosarc/models.py index 10a343e..4ebf3ec 100644 --- a/osteosarc/models.py +++ b/osteosarc/models.py @@ -106,6 +106,12 @@ def conflicts(self): ("timepoint", "date", "assay", "platform", "tissue", "provider", "library") if len(self.values(name)) > 1} + @property + def evidence_overlaps(self): + """Reviewed regional overlaps for this product; sample claims stay unchanged.""" + from .provenance import evidence_overlaps + return evidence_overlaps(self.url) + @dataclass(frozen=True) class Variant: @@ -196,6 +202,22 @@ def __getitem__(self, key): def _names(self): return _NameIndex(self) + @property + def overlap_groups(self): + """Known overlapping evidence products in this selection.""" + from .provenance import overlap_groups + return overlap_groups(self) + + def require_no_known_overlaps(self): + """Raise if this selection would double-count a reviewed overlap group.""" + from .provenance import require_no_known_overlaps + return require_no_known_overlaps(self) + + def without_known_overlaps(self, *, prefer=()): + """Select one explicit preference per overlap group, recording exclusions.""" + from .provenance import without_known_overlaps + return without_known_overlaps(self, prefer=prefer) + def select(self, *, kind=None, format=None, prefix=None, contains=None, sample=None, timepoint=None, assay=None, platform=None, tissue=None, provider=None, library=None, include_conflicts=False, include_inferred=False): diff --git a/osteosarc/provenance.py b/osteosarc/provenance.py new file mode 100644 index 0000000..46827b3 --- /dev/null +++ b/osteosarc/provenance.py @@ -0,0 +1,98 @@ +"""Reviewed evidence overlap, distinct from biological sample identity.""" + +import copy +import json +from collections import Counter +from functools import lru_cache +from pathlib import Path + +import pysam + +from .errors import IntegrityError + + +@lru_cache(maxsize=1) +def _registry(): + return json.loads((Path(__file__).with_name("data") / "evidence-overlaps.json").read_text()) + +def evidence_overlaps(url): + """Known regional overlaps for this exact processing-product URL. + + No sample ID is rewritten. Empty results mean no reviewed overlap is listed, + not that this source is biologically independent of every other source. + """ + return copy.deepcopy([group for group in _registry()["groups"] + if any(s["url"] == url for s in group["sources"])]) + + +def overlap_groups(files): + urls = {file.url for file in files} + return copy.deepcopy([dict(group, selected_urls=sorted(urls & {s["url"] for s in group["sources"]})) + for group in _registry()["groups"] + if len(urls & {s["url"] for s in group["sources"]}) > 1]) + + +def require_no_known_overlaps(files): + """Fail before counting known overlapping products as separate evidence.""" + groups = overlap_groups(files) + if groups: + raise IntegrityError("Sources have known overlapping evidence: " + ", ".join(g["id"] for g in groups) + + ". Keep their labels and receipts; select one explicitly with " + "files.without_known_overlaps(prefer=[URL]). See Osteosarc #100.") + return files + + +def without_known_overlaps(files, *, prefer=()): + """Keep explicitly preferred products from overlap groups; report exclusions. + + Preference selects evidence for an analysis, not the correct biological label. + Both underlying source objects and all their original metadata remain intact. + """ + prefer = (prefer,) if isinstance(prefer, str) else prefer + preferred = {files[name].url for name in prefer} + excluded = [] + for group in overlap_groups(files): + chosen = preferred & set(group["selected_urls"]) + if len(chosen) != 1: + raise ValueError(f"Choose exactly one preferred source in overlap group {group['id']}") + kept, = chosen + excluded += [dict(url=url, kept_url=kept, evidence_overlap=group["id"], issue=group["issue"]) + for url in group["selected_urls"] if url != kept] + removed = {entry["url"] for entry in excluded} + result = type(files)((file for file in files if file.url not in removed), source=dict(files.source, + excluded_evidence_overlaps=[*files.source.get("excluded_evidence_overlaps", []), *excluded])) + return require_no_known_overlaps(result) + + +def audit_alignment_overlap(path_a, path_b): + """Compare regional BAMs by record multiset, including base qualities. + + Ignore all optional tags (including RG), but keep QNAME, flags, mapping + quality, sequence, qualities, CIGAR, positions, mate positions and TLEN. + Normalize chr prefixes and M/MT for comparison only; do not rewrite files. + This describes these BAM subsets, not the complete source libraries. + """ + def contig(name): + name = name.removeprefix("chr") if name else None + return "MT" if name in ("M", "MT") else name + + def read(path): + records, names = Counter(), set() + with pysam.AlignmentFile(path) as bam: + groups = bam.header.to_dict().get("RG", []) + for r in bam: + names.add(r.query_name) + key = (r.query_name, r.flag, contig(r.reference_name), r.reference_start, + r.mapping_quality, r.cigarstring, contig(r.next_reference_name), + r.next_reference_start, r.template_length, r.query_sequence, + tuple(r.query_qualities) if r.query_qualities is not None else None) + records[key] += 1 + return records, names, groups + + a, an, ag = read(path_a) + b, bn, bg = read(path_b) + return dict(records_a=sum(a.values()), records_b=sum(b.values()), + names_a=len(an), names_b=len(bn), shared_names=len(an & bn), union_names=len(an | bn), + shared_records_excluding_tags=sum((a & b).values()), + different_a=sum((a - b).values()), different_b=sum((b - a).values()), + read_groups_a=ag, read_groups_b=bg) diff --git a/osteosarc/retrieval.py b/osteosarc/retrieval.py new file mode 100644 index 0000000..030ea4f --- /dev/null +++ b/osteosarc/retrieval.py @@ -0,0 +1,90 @@ +"""Native coordinates for historical retrieval fixtures; no implicit liftover.""" + +import copy +import json +from dataclasses import asdict +from pathlib import Path + +import pysam + +from .bundles import safe_path, verify_manifest_files +from .cache import stable_id +from .errors import CoordinateError, IntegrityError +from .models import Region +from .reads import assembly_from_header, normalize_assembly, resolve_regions + + +def annotate_retrieval_case(case, bam_path): + """Copy a historical case with a verified native query and reference identity. + + ``variant_id`` is a catalogue label, never a coordinate to parse. The original + variant and its reference-validation receipt survive unchanged. The BAM must + have an index and contain at least one alignment overlapping the native locus. + """ + result = copy.deepcopy(case) + variant = case["variant"] + with pysam.AlignmentFile(bam_path) as bam: + header = bam.header.to_dict() + assembly = assembly_from_header(header) + if assembly is None or assembly != normalize_assembly(variant["assembly"]): + raise CoordinateError(f"Case/header assembly differs: {case['case_id']}") + validation = variant["genomic_validation"] + genome = validation["genome"] + mitochondrial = variant["chrom"].removeprefix("chr") in ("M", "MT") + # hg19's 16,571-base chrM is not the 16,569-base rCRS used by hg38 + # and some GRCh37 alignments. The frozen reference validation determines + # this choice; nuclear assembly and name aliases cannot determine it. + length = {"hg19": 16571, "hg38": 16569}.get(genome) if mitochondrial else None + if mitochondrial and length is None: + raise CoordinateError("Unknown mitochondrial validation reference") + if not mitochondrial and normalize_assembly(genome) != assembly: + raise CoordinateError("Nuclear validation reference differs from the BAM assembly") + pos, ref = variant["pos"], variant["ref"] + offset = pos - 1 - validation["start"] + if offset < 0 or validation["sequence"][offset:offset + len(ref)].upper() != ref.upper(): + raise IntegrityError(f"Reference validation does not match the native allele: {case['case_id']}") + region, = resolve_regions([Region(variant["chrom"], pos - 1, pos - 1 + len(ref), + assembly, length)], header) + if not any(bam.fetch(region.contig, region.start, region.end)): + raise IntegrityError(f"No indexed reads at the native locus: {case['case_id']}") + sq = next(row for row in header["SQ"] if row["SN"] == region.contig) + dictionary = [{k: row[k] for k in ("SN", "LN", "M5") if k in row} for row in header["SQ"]] + result["catalogue_identity"] = copy.deepcopy(variant.get("original_identity", { + k: variant[k] for k in ("assembly", "chrom", "pos", "ref", "alt")})) + result["native_variant"] = dict(assembly=assembly, chrom=region.contig, pos=pos, + ref=ref, alt=variant["alt"], coordinates="one-based") + result["query_region"] = asdict(region) + result["reference"] = dict(nuclear_assembly=assembly, validation_genome=genome, sequence=sq, + mitochondrial_reference=("rCRS" if length == 16569 else "UCSC-hg19-chrM") if mitochondrial else None, + dictionary_sha256=stable_id(dictionary)) + return result + + +def annotate_retrieval_manifest(manifest, directory): + """Verify original assets, then return a new, separately versioned manifest.""" + directory = Path(directory) + verify_manifest_files(directory, {a["filename"]: a for a in manifest["assets"]}) + result = copy.deepcopy(manifest) + result["parent"] = dict(data_version=manifest["data_version"], manifest_content_sha256=stable_id(manifest)) + result["data_version"] = "native-retrieval-v1" + result["cases"] = [annotate_retrieval_case(case, safe_path(directory, case["bam"])) + for case in manifest["cases"]] + result["merge_policy"] = "Check reference dictionaries before merging; query native coordinates, never variant_id." + return result + + +def assert_compatible_retrieval_cases(cases): + """Refuse a raw BAM merge across differing builds, contig names or references. + + Matching dictionaries only establish coordinate compatibility. They do not + establish biological independence or make balanced fixtures quantitative. + """ + identities = {(c["reference"]["nuclear_assembly"], c["reference"]["dictionary_sha256"]) for c in cases} + if len(identities) > 1: + raise CoordinateError("Retrieval cases use different reference dictionaries; query each BAM with its " + "query_region, or explicitly harmonize references and coordinates before merging") + + +def load_retrieval_cases(): + """Reviewed native metadata for the 49 historical shared-v1 retrieval cases.""" + return json.loads((Path(__file__).with_name("data") / "retrieval-cases.json").read_text()) diff --git a/osteosarc/shared.py b/osteosarc/shared.py index f705860..67b6cbe 100644 --- a/osteosarc/shared.py +++ b/osteosarc/shared.py @@ -380,7 +380,7 @@ def select_breakend_templates(templates, breakends, *, pad=1000, cap=50): return {t: "joins the breakends (hash order)" for t in chosen}, len(joined) -def bundle_fixtures(bundle): +def bundle_fixtures(bundle, *, compact_regions=False): """A bundle's library fixtures as required subsets pinned by checksum, so the next bundle keeps exactly their records once libraries no longer keep their own copies: {name: dict(consumer, source, records, regions, description, @@ -388,6 +388,10 @@ def bundle_fixtures(bundle): Each fixture is planned from the regions its target records; bundles built before targets recorded them (openvax-v1) use the spans of their records. + With compact_regions, positioned records (including placed-unmapped ones) + are queried at their first reference base instead. This avoids fetching entire + introns of spliced RNA records; exact record checksums and multiplicities + still determine what is kept. """ from .bundles import verify_bundle bundle = Path(bundle) @@ -414,11 +418,12 @@ def bundle_fixtures(bundle): if r.digest in wanted: if r.read.reference_id < 0 or r.read.reference_start < 0: unplaced.add(r.digest) - elif not r.read.is_unmapped: - spans[r.digest] = (r.read.reference_name, r.read.reference_start, r.read.reference_end) + elif compact_regions or not r.read.is_unmapped: + spans[r.digest] = (r.read.reference_name, r.read.reference_start, + r.read.reference_start + 1 if compact_regions else r.read.reference_end) for name in names: subsets[name]["unplaced_mates"] = any(key in unplaced for key in subsets[name]["records"]) - if "regions" not in subsets[name]: + if "regions" not in subsets[name] or compact_regions: subsets[name]["regions"] = merge_spans(spans[key] for key in subsets[name]["records"] if key in spans) return subsets @@ -669,12 +674,15 @@ def _uncovered(target): return f"none of them is on its genome build, {target['assembly']}" -def build_shared_recipe(spec, dataset, *, required=(), log=print, workers=6, required_targets=()): +def build_shared_recipe(spec, dataset, *, required=(), log=print, workers=6, required_targets=(), checkpoint=None): """Select the spec's records and return its frozen recipe (see the module docs). Sources are extracted in parallel (workers at a time). Each name in required_targets must be covered by some source, which is checked before any - reads are fetched. dataset must be opened with offline=False the first time, + reads are fetched. An optional checkpoint directory saves completed source + selections, keyed by their spec, source plan and required records; packing + still verifies every selected record against the source. dataset must be + opened with offline=False the first time, to stream reads; extractions are cached, so rebuilding is quick and offline. """ from concurrent.futures import ThreadPoolExecutor, as_completed @@ -698,6 +706,12 @@ def build_shared_recipe(spec, dataset, *, required=(), log=print, workers=6, req if spec.get("sources", {}).get("observed", True) else set()) urls = sorted(everywhere | sv_everywhere | {s["source"] for s in subsets.values()} | observed) split = selection.get("supplementary", False) + split_depth = selection.get("split_depth", SPLIT_DEPTH) + if type(split_depth) is not int or split_depth <= 0: + raise SchemaError("selection.split_depth must be a positive integer") + split_regions = selection.get("split_regions", SPLIT_REGIONS) + if type(split_regions) is not int or split_regions <= 0: + raise SchemaError("selection.split_regions must be a positive integer") recipe = dict(schema_version=1, id=spec["id"], kind="shared", snapshot=dict(name=dataset.name, id=dataset.id), selection=dict(classifier="osteosarc.alleles v1", caps=caps, low_quality_alt=low_quality_alt, @@ -705,6 +719,10 @@ def build_shared_recipe(spec, dataset, *, required=(), log=print, workers=6, req **({"supplementary": True} if split else {})), aliases=spec["targets"].get("renamed", {}), targets=targets, sources={}, members={}, redistribution=spec.get("redistribution", {"license": "unresolved"})) + if "split_depth" in selection: + recipe["selection"]["split_depth"] = split_depth + if "split_regions" in selection: + recipe["selection"]["split_regions"] = split_regions plans = [] for url in urls: mine = {n: s for n, s in subsets.items() if s["source"] == url} @@ -739,6 +757,21 @@ def select(plan): kept templates' alignments elsewhere (SA tags) join the regions, unless in a pileup, and the source is read and selected again: the same templates, now with those records too.""" + checkpoint_path = None + if checkpoint is not None: + from .cache import stable_id, write_json + key = stable_id(dict(version=1, spec=spec, source=plan["source"], required=plan["mine"], + targets=targets, caps=caps, structural=structural, + low_quality_alt=low_quality_alt, split_depth=split_depth, + split_regions=split_regions)) + checkpoint_path = Path(checkpoint) / (key + ".json") + if checkpoint_path.exists(): + state = read_json(checkpoint_path) + if state.get("key") != key or state.get("sha256") != stable_id(state.get("result")): + raise IntegrityError(f"Invalid source-selection checkpoint: {checkpoint_path}") + result = state["result"] + plan["source"] = result["source"] + return plan, result["records"], result["added"], result["crowded"], result["skipped"], result["selected"] subset = dataset.extract_reads(plan["file"], [Region(**r) for r in plan["source"]["regions"]], **plan["source"]["acquisition"]) index = _source_index(subset.path, plan, windows) @@ -747,15 +780,15 @@ def select(plan): lengths = {row["SN"]: row["LN"] for row in header.get("SQ", [])} elsewhere, skipped = (_split_alignments(index, selected[0], plan["source"]["regions"], lengths) if split else ([], Counter())) - if len(elsewhere) > SPLIT_REGIONS: + if len(elsewhere) > split_regions: raise IntegrityError(f"{plan['file'].key}: the kept templates' split alignments lie in " - f"{len(elsewhere)} more regions, over the limit of {SPLIT_REGIONS}") + f"{len(elsewhere)} more regions, over the limit of {split_regions}") assembly = plan["source"]["assembly"] added, crowded = [], 0 for contig, start, end in elsewhere: region = Region(contig, start, end, assembly, lengths[contig] if contig in MITOCHONDRIA else None) try: # a region in a pileup (a repeat that draws millions of reads) costs more than it's worth - dataset.extract_reads(plan["file"], [region], max_records=SPLIT_DEPTH) + dataset.extract_reads(plan["file"], [region], max_records=split_depth) added.append(region) except RecordLimitError: crowded += 1 @@ -766,20 +799,32 @@ def select(plan): **plan["source"]["acquisition"]) index = _source_index(subset.path, plan, windows) selected = _select_source(plan, index, windows, targets, caps, low_quality_alt, structural["cap"]) - return plan, subset, added, crowded, skipped, selected + if checkpoint_path is not None: + result = dict(source=plan["source"], records=subset.receipt["records"], added=_region_dicts(added), + crowded=crowded, skipped=dict(skipped), selected=selected) + write_json(checkpoint_path, dict(key=key, sha256=stable_id(result), result=result)) + return plan, subset.receipt["records"], added, crowded, skipped, selected - problems, results = [], {} + problems, results, failures = [], {}, [] with ThreadPoolExecutor(max_workers=workers) as pool: - for future in as_completed([pool.submit(select, plan) for plan in plans]): - plan, subset, added, crowded, skipped, (members, fixtures, missing) = future.result() + futures = {pool.submit(select, plan): plan for plan in plans} + for future in as_completed(futures): + try: + plan, record_count, added, crowded, skipped, (members, fixtures, missing) = future.result() + except Exception as error: + log(f"FAILED {futures[future]['file'].key}: {error}") + failures.append(error) + continue results[plan["label"]] = (plan, members, fixtures) problems += missing - log(f"{plan['file'].key}: read {plural(subset.receipt['records'], 'record')}, " + log(f"{plan['file'].key}: read {plural(record_count, 'record')}, " f"kept {plural(len(members) + len(fixtures), 'member')}" + (f", with split alignments in {plural(len(added), 'more region')}" if added else "") + (f"; left out {plural(crowded, 'region')} of split alignments in a pileup" if crowded else "") + (f"; passed over {plural(sum(skipped.values()), 'split alignment')} (" + ", ".join(f"{n} {why}" for why, n in sorted(skipped.items())) + ")" if skipped else "")) + if failures: + raise failures[0] if problems: # Every source was read (and its extraction cached), so a rerun after fixing these is quick. raise IntegrityError(f"{len(problems)} required fixtures couldn't be matched:\n" + "\n".join(problems)) @@ -956,11 +1001,11 @@ def _sv_entry(sv, candidates): from .fixtures import load_panel if sv in candidates: base, origin = candidates[sv], {"sv_candidates": sv} - elif sv in (regressions := load_panel("sv-regressions-v1")): - base, origin = regressions[sv], {"panel": "sv-regressions-v1", "id": sv} + elif sv in (regressions := load_panel("sv-regressions-v2")): + base, origin = regressions[sv], {"panel": "sv-regressions-v2", "id": sv} else: raise ValueError(f"No SV {sv}: give an SV candidate ID, from load_sv_candidates() (see the SV candidates " - "docs), or a regression target from load_panel('sv-regressions-v1')") + "docs), or a regression target from load_panel('sv-regressions-v2')") if base.get("kind") == "unresolved" or len(base.get("breakends", ())) < 2: raise ValueError(f"{sv} has no two resolved breakends to take reads between" + (f" ({base['reason']})" if base.get("reason") else "")) diff --git a/pyproject.toml b/pyproject.toml index 828f86e..06af2a4 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -4,7 +4,7 @@ build-backend = "setuptools.build_meta" [project] name = "osteosarc" -version = "0.14.4" +version = "0.15.0" description = "Reproducible access to the public osteosarc.com dataset" readme = "README.md" requires-python = ">=3.9" diff --git a/scripts/shared_test_data/audit_comprehensive.py b/scripts/shared_test_data/audit_comprehensive.py new file mode 100644 index 0000000..9c2f581 --- /dev/null +++ b/scripts/shared_test_data/audit_comprehensive.py @@ -0,0 +1,179 @@ +"""Verify the built corpus and recount negative-control SNVs before sampling. + +python scripts/shared_test_data/audit_comprehensive.py build/comprehensive + +Recounts the unsampled control extracts, not the balanced fixture BAMs. No +network is used. Run controls_comprehensive.py first to preserve those extracts. +""" + +import argparse +import copy +import gzip +import hashlib +import json +import sys +from collections import Counter +from pathlib import Path + +sys.path.insert(0, str(Path(__file__).resolve().parents[2])) + +from osteosarc import Dataset, Region, verify_bundle # noqa: E402 +from osteosarc.cache import digest, stable_id # noqa: E402 +from osteosarc.corpus import ( # noqa: E402 + AUDIT_SNVS, + NEGATIVE_CONTROLS, + RNA_ASSAYS, + snv_read_support, + verify_control_extracts, +) +from osteosarc.reads import resolve_regions # noqa: E402 +from osteosarc.reference import reference_sequence # noqa: E402 +from osteosarc.shared import bundle_fixtures, bundle_folder, read_json # noqa: E402 + +ROOT = Path(__file__).resolve().parents[2] +INPUT = ROOT / "tests/data/comprehensive" + + +def audit(output, cache=None): + spec = read_json(INPUT / "spec.json") + catalog = read_json(INPUT / "catalog.json.gz") + control_data = read_json(output / "controls/audit.json") + if control_data["snapshot"] != spec["snapshot"] or control_data["catalog_sha256"] != digest(INPUT / "catalog.json.gz"): + raise ValueError("Control extracts refer to other inputs") + verify_control_extracts(output, control_data) + bundle = output / spec["id"] + manifest = verify_bundle(bundle) + recipe = read_json(bundle / "recipe.json") + if recipe["snapshot"] != spec["snapshot"] or stable_id(recipe) != manifest["recipe_sha256"]: + raise ValueError("Bundle snapshot or recipe changed") + data = Dataset.open(spec["snapshot"]["name"], cache=cache, offline=True) + if data.id != recipe["snapshot"]["id"]: + raise ValueError("Audit snapshot differs") + previous_bundle = bundle_folder("openvax-v2", cache=data.cache) + previous_recipe = read_json(previous_bundle / "recipe.json") + carried = bundle_fixtures(previous_bundle) + for name, required in carried.items(): + if manifest["members"][name]["records"] != required["records"]: + raise ValueError(f"Historical library records changed: {name}") + targets = recipe["targets"] + # Exact-record rebuilding needs no website snapshot when the public index + # URLs accompany the frozen source identities. The original recipe stays intact. + portable = copy.deepcopy(recipe) + for source in portable["sources"].values(): + file = data.file(source["identity"]["key"]) + if not file.index_urls: + raise ValueError(f"No public index for {file.key}") + source["identity"].update(index_urls=list(file.index_urls), format=file.format) + (output / "portable-recipe.json").write_text(json.dumps(portable, sort_keys=True, indent=1) + "\n") + contexts = {} + for name, target in targets.items(): + context = target.get("window", {}).get("context") + if context is None: + continue + sequence = reference_sequence(target["contig"], context["start"], context["end"], target["assembly"], + cache=data.cache, reference_length=target.get("reference_length")) + if hashlib.sha256(sequence.encode()).hexdigest() != context["sha256"]: + raise ValueError(f"Reference context changed: {name}") + offset = target["position"] - 1 - context["start"] + if sequence[offset:offset + len(target["ref"])] != target["ref"]: + raise ValueError(f"REF mismatch: {name}") + contexts[name] = dict(contig=target["contig"], assembly=target["assembly"], **context, sequence=sequence) + (output / "reference-contexts.json.gz").write_bytes(gzip.compress( + (json.dumps(contexts, sort_keys=True, separators=(",", ":")) + "\n").encode(), mtime=0)) + vaccinated = {vid for vid, v in catalog["variants"].items() if v["vaccine"]["included"]} + by_pair = {(m["source"], m["target"]): (name, m) for name, m in recipe["members"].items()} + expected_sources = set(spec["sources"]["all_targets"]) + actual_sources = {s["identity"]["url"] for s in recipe["sources"].values()} + if expected_sources - actual_sources: + raise ValueError("An all-target source is absent") + for sid, source in recipe["sources"].items(): + if source["identity"]["url"] not in expected_sources: + continue + for vid in vaccinated: + if (sid, vid) not in by_pair: + raise ValueError(f"Vaccine allele not covered in source plan: {sid} / {vid}") + if targets[vid]["kind"] != "small_variant" or "unavailable" in targets[vid]["window"]: + raise ValueError(f"Vaccine allele is not reference validated: {vid}") + members = [] + for name, member in recipe["members"].items(): + target = targets[member["target"]] + members.append(dict(name=name, target=member["target"], source=member["source"], + target_kind=target["kind"], observed_before_sampling=member.get("observed"), + selected_record_count=manifest["members"][name]["record_count"], + selected_record_sha256=stable_id(manifest["members"][name]["records"]), + status=manifest["members"][name]["status"], + interpretation="Geometric joining templates, not exact DNA-allele confirmation." + if target["kind"] == "sv" else "Balanced fixtures are not abundance estimates.")) + audits = [] + import pysam + if {a["source_url"] for a in control_data["audits"]} != expected_sources: + raise ValueError("Control extracts do not cover every all-target source") + for sid, source in recipe["sources"].items(): + if source["identity"]["url"] not in expected_sources: + continue + saved = [a for a in control_data["audits"] if a["source_url"] == source["identity"]["url"]] + if len(saved) != len(AUDIT_SNVS) or {a["variant_id"] for a in saved} != set(AUDIT_SNVS): + raise ValueError(f"Control audit has missing/duplicate rows: {sid}") + with pysam.AlignmentFile(str(output / saved[0]["extract_file"])) as bam: + for vid in AUDIT_SNVS: + chrom, pos, ref, alt = catalog["variants"][vid]["allele"] + region = resolve_regions([Region(chrom, pos - 1, pos, "GRCh38")], bam.header.to_dict())[0] + evidence = snv_read_support(bam.fetch(region.contig, region.start, region.end), pos, ref, alt) + original = next(a for a in saved if a["variant_id"] == vid) + if any(original[k] != v for k, v in evidence.items()): + raise ValueError(f"Independent control counts changed: {sid} / {vid}") + audits.append(original) + print(f"Audited {sid}", flush=True) + # Prove that every reported tumor RNA product was independently checked. + expected_rna = {f["url"] for s in catalog["count_sources"].values() if s["assay_type"] in RNA_ASSAYS + for f in s["files"]} + # Do not certify controls across two labels for the reviewed Tempus overlap. + from osteosarc.models import Files + Files(data.file(url) for url in expected_rna).require_no_known_overlaps() + for vid in NEGATIVE_CONTROLS: + if expected_rna - {a["source_url"] for a in audits if a["variant_id"] == vid}: + raise ValueError(f"Negative control RNA audit incomplete: {vid}") + discrepancies = [dict(variant_id=a["variant_id"], source=a["source"], alt_templates=a["templates"]["alt"]) + for a in audits if a["source_url"] in expected_rna and a["templates"]["alt"] > 0] + historical = [] + for row in catalog["known_rna_disagreements"]: + original = previous_recipe["members"][row["member"]]["policy"]["records"] + current = [name for name, member in recipe["members"].items() + if recipe["sources"][member["source"]]["identity"]["url"] == row["source_url"] + and all(manifest["members"][name]["records"].get(key, 0) >= count + for key, count in original.items())] + if not current: + raise ValueError(f"Historical RNA disagreement records were lost: {row['member']}") + historical.append(dict(row, current_read_members=sorted(current), + historical_selected_records_preserved=sum(original.values()))) + report = dict(schema_version=1, snapshot=spec["snapshot"], manifest_sha256=digest(bundle / "manifest.json"), + catalog_sha256=digest(INPUT / "catalog.json.gz"), suitable_for_abundance=False, + controls_audit_sha256=digest(output / "controls/audit.json"), + portable_recipe_sha256=digest(output / "portable-recipe.json"), + reference_contexts_sha256=digest(output / "reference-contexts.json.gz"), + library_fixtures_preserved=len(carried), vaccine_variants=len(vaccinated), + verified_reference_contexts=len(contexts), + all_target_sources=len(expected_sources), source_count=len(recipe["sources"]), + member_count=len(members), statuses=dict(Counter(m["status"] for m in members)), + unresolved_targets={k: t for k, t in targets.items() if t["kind"] == "unresolved"}, + unavailable_allele_windows={k: t["window"] for k, t in targets.items() if "unavailable" in t.get("window", {})}, + sources=recipe["sources"], members=members, snv_control_audit=audits, + published_zero_rna_discrepancies=discrepancies, + known_historical_rna_disagreements=historical, + supplementary_policy=spec["selection"], + supplementary_limitations="MAPQ-zero, malformed, absent-contig SA entries and regions exceeding split_depth are excluded; see acquisition log.") + (output / "read-audit.json.gz").write_bytes(gzip.compress( + (json.dumps(report, sort_keys=True, separators=(",", ":")) + "\n").encode(), mtime=0)) + summary = {k: report[k] for k in ("vaccine_variants", "all_target_sources", "source_count", "member_count", "statuses", + "library_fixtures_preserved", "unresolved_targets", "unavailable_allele_windows", + "published_zero_rna_discrepancies", "known_historical_rna_disagreements")} + (output / "audit-summary.json").write_text(json.dumps(summary, indent=2, sort_keys=True) + "\n") + print(json.dumps(summary, indent=2)) + + +if __name__ == "__main__": + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument("output", type=Path) + parser.add_argument("--cache") + args = parser.parse_args() + audit(args.output, args.cache) diff --git a/scripts/shared_test_data/build_comprehensive.py b/scripts/shared_test_data/build_comprehensive.py new file mode 100644 index 0000000..8b24d33 --- /dev/null +++ b/scripts/shared_test_data/build_comprehensive.py @@ -0,0 +1,77 @@ +"""Build the unpublished comprehensive corpus without changing release records. + +python scripts/shared_test_data/build_comprehensive.py build/comprehensive + +The recipe is checkpointed before packing. Interrupted read acquisition is cached; +rerunning reuses it. --offline proves that a completed build is reproducible locally. +""" + +import argparse +import json +import sys +from pathlib import Path + +sys.path.insert(0, str(Path(__file__).resolve().parents[2])) + +from osteosarc import Dataset, generate_bundle, verify_bundle # noqa: E402 +from osteosarc.cache import digest, stable_id # noqa: E402 +from osteosarc.provenance import evidence_overlaps # noqa: E402 +from osteosarc.shared import ( # noqa: E402 + build_shared_recipe, + bundle_fixtures, + bundle_folder, + pack_release, + read_json, +) + +ROOT = Path(__file__).resolve().parents[2] +INPUT = ROOT / "tests/data/comprehensive" + + +def main(): + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument("output", type=Path) + parser.add_argument("--cache") + parser.add_argument("--offline", action="store_true") + parser.add_argument("--workers", type=int, default=6) + args = parser.parse_args() + spec = read_json(INPUT / "spec.json") + data = Dataset.open(spec["snapshot"]["name"], cache=args.cache, offline=args.offline) + args.output.mkdir(parents=True, exist_ok=True) + recipe_path = args.output / "recipe.json" + stamp_path = args.output / "inputs.json" + stamp = dict(spec_sha256=stable_id(spec), snapshot_id=data.id, carry="openvax-v2", + carry_regions="record_starts", + evidence_overlaps_sha256=digest(ROOT / "osteosarc/data/evidence-overlaps.json")) + carried = bundle_fixtures(bundle_folder("openvax-v2", cache=data.cache), compact_regions=True) + if recipe_path.exists(): + if read_json(stamp_path) != stamp: + raise ValueError("Checkpoint inputs changed; choose a new output folder") + recipe = read_json(recipe_path) + else: + recipe = build_shared_recipe(spec, data, required=carried, workers=args.workers, + checkpoint=args.output / "selections", + log=lambda message: print(message, flush=True)) + for source in recipe["sources"].values(): + if overlaps := evidence_overlaps(source["identity"]["url"]): + source["evidence_overlaps"] = overlaps + stamp_path.write_text(json.dumps(stamp, indent=2) + "\n") + recipe_path.write_text(json.dumps(recipe, sort_keys=True, indent=1) + "\n") + bundle = args.output / spec["id"] + if not bundle.exists(): + generate_bundle(recipe, bundle, dataset=data, size_budget=1024**3) + manifest = verify_bundle(bundle) + if manifest["recipe_sha256"] != stable_id(recipe): + raise ValueError("Existing bundle differs from the checkpoint") + for name, subset in carried.items(): + if manifest["members"][name]["records"] != subset["records"]: + raise ValueError(f"Carried fixture changed: {name}") + archive = args.output / (spec["id"] + ".tar.gz") + record = dict(pack_release(bundle, archive), **stamp, published=False, + library_fixtures_preserved=len(carried)) + (args.output / "build.json").write_text(json.dumps(record, indent=2) + "\n") + print(json.dumps(dict(bundle=str(bundle), archive=str(archive), **record), indent=2)) + + +if __name__ == "__main__": + main() diff --git a/scripts/shared_test_data/catalog_comprehensive.py b/scripts/shared_test_data/catalog_comprehensive.py new file mode 100644 index 0000000..d718cba --- /dev/null +++ b/scripts/shared_test_data/catalog_comprehensive.py @@ -0,0 +1,85 @@ +"""Freeze/rebuild the comprehensive evidence catalogue, independently of read sampling. + +python scripts/shared_test_data/catalog_comprehensive.py --freeze +python scripts/shared_test_data/catalog_comprehensive.py # deterministic, offline +""" + +import argparse +import gzip +import json +import sys +from collections import defaultdict +from pathlib import Path + +sys.path.insert(0, str(Path(__file__).resolve().parents[2])) + +from osteosarc import Dataset # noqa: E402 +from osteosarc.cache import digest # noqa: E402 +from osteosarc.corpus import evidence_catalog # noqa: E402 +from osteosarc.shared import read_json # noqa: E402 +from osteosarc.sv_candidates import load_sv_candidates # noqa: E402 + +ROOT = Path(__file__).resolve().parents[2] +FOLDER = ROOT / "tests/data/comprehensive" + + +def write_gzip(path, value): + raw = (json.dumps(value, sort_keys=True, separators=(",", ":"), ensure_ascii=False) + "\n").encode() + path.write_bytes(gzip.compress(raw, mtime=0)) + + +def freeze(folder): + spec = read_json(folder / "spec.json") + data = Dataset.open(spec["snapshot"]["name"]) + if data.id != spec["snapshot"]["id"]: + raise ValueError("Snapshot ID differs from the pinned spec") + aliases = read_json(folder / "count-source-aliases.json") + bams = [f for f in data.files if f.format == "bam"] + by_name = defaultdict(list) + for file in bams: + by_name[file.key.rsplit("/", 1)[-1]].append(file) + count_sources = {} + for name in sorted({r["bam_file"] for r in data.vafs}): + files = [data.file(aliases[name])] if name in aliases else by_name[name] + count_sources[name] = dict( + identity_status="sample_catalog_alias" if name in aliases else + "unique_basename" if len(files) == 1 else "ambiguous" if files else "unresolved", + files=[dict(id=f.id, key=f.key, url=f.url, samples=list(f.samples), + conflicts=f.conflicts) for f in files]) + samples = [{key: row[key] for key in ("id", "timepoint", "date", "tissue", "site", "description", "sequencing")} + for row in data.samples.to_records()] + source_files = ("variant_index", "source_variants", "vaccine_overlap", "vafs", "vaf_columns", "bams", + "bam_metadata", "specimens") + inputs = dict(snapshot=spec["snapshot"], variants=data.variants("all").to_records(), + vaccine_rows=list(data.vaccines), counts=list(data.vafs), count_sources=count_sources, + samples=samples, structural_candidates=load_sv_candidates(), + historical_rna=read_json(folder / "historical-rna.json"), + evidence_overlap_registry=read_json(ROOT / "osteosarc/data/evidence-overlaps.json"), + provenance=dict(sources={k: {f: data.manifest["sources"][k].get(f) for f in + ("url", "sha256", "size", "retrieved_at")} + for k in source_files}, + corrections="osteosarc curated snapshot; corrections retained per row/variant", + aliases=aliases, aliases_basis="Explicit T1/T2/T3/CD45neg CellRanger sample paths in bams.json", + curation_sha256=digest(ROOT / "osteosarc/curation.py"), + allele_resolutions_sha256=digest(ROOT / "osteosarc/data/allele_resolutions.json"))) + write_gzip(folder / "inputs.json.gz", inputs) + + +def main(): + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument("--freeze", action="store_true") + parser.add_argument("--folder", type=Path, default=FOLDER) + args = parser.parse_args() + if args.freeze: + freeze(args.folder) + catalog = evidence_catalog(read_json(args.folder / "inputs.json.gz")) + write_gzip(args.folder / "catalog.json.gz", catalog) + checksums = {name: digest(args.folder / name) for name in + ("inputs.json.gz", "catalog.json.gz", "spec.json", "count-source-aliases.json", "historical-rna.json")} + (args.folder / "checksums.json").write_text(json.dumps(checksums, indent=2, sort_keys=True) + "\n") + (args.folder / "summary.json").write_text(json.dumps(catalog["summary"], indent=2, sort_keys=True) + "\n") + print(json.dumps(catalog["summary"], indent=2)) + + +if __name__ == "__main__": + main() diff --git a/scripts/shared_test_data/controls_comprehensive.py b/scripts/shared_test_data/controls_comprehensive.py new file mode 100644 index 0000000..f8a51cc --- /dev/null +++ b/scripts/shared_test_data/controls_comprehensive.py @@ -0,0 +1,79 @@ +"""Recount and preserve all reads at the negative and discordant control SNVs. + +python scripts/shared_test_data/controls_comprehensive.py build/comprehensive + +These unsampled one-base extracts make the independent count audit reproducible +from the delivered data, without the much larger cached regional extracts. +""" + +import argparse +import json +import shutil +import sys +from concurrent.futures import ThreadPoolExecutor, as_completed +from pathlib import Path + +sys.path.insert(0, str(Path(__file__).resolve().parents[2])) + +from osteosarc import Dataset, Region # noqa: E402 +from osteosarc.cache import digest # noqa: E402 +from osteosarc.corpus import AUDIT_SNVS, snv_read_support # noqa: E402 +from osteosarc.reads import resolve_regions # noqa: E402 +from osteosarc.shared import read_json # noqa: E402 + +ROOT = Path(__file__).resolve().parents[2] +INPUT = ROOT / "tests/data/comprehensive" + + +def recount(output, cache=None, offline=False): + spec = read_json(INPUT / "spec.json") + catalog = read_json(INPUT / "catalog.json.gz") + data = Dataset.open(spec["snapshot"]["name"], cache=cache, offline=offline) + if data.id != spec["snapshot"]["id"]: + raise ValueError("Snapshot differs from the spec") + destination = output / "controls" + destination.mkdir(parents=True, exist_ok=True) + regions = [Region(catalog["variants"][vid]["allele"][0], catalog["variants"][vid]["allele"][1] - 1, + catalog["variants"][vid]["allele"][1], "GRCh38") for vid in AUDIT_SNVS] + + def one(url): + file = data.file(url) + label = data.short_name(file) + subset = data.extract_reads(file, regions, fetch_pairs=False, timeout=600) + bam_path = destination / (label + ".bam") + shutil.copyfile(subset.path, bam_path) + shutil.copyfile(str(subset.path) + ".bai", str(bam_path) + ".bai") + sha256 = digest(bam_path) + rows = [] + with subset.open() as bam: + for vid in AUDIT_SNVS: + chrom, pos, ref, alt = catalog["variants"][vid]["allele"] + region = resolve_regions([Region(chrom, pos - 1, pos, "GRCh38")], bam.header.to_dict())[0] + evidence = snv_read_support(bam.fetch(region.contig, region.start, region.end), pos, ref, alt) + rows.append(dict(variant_id=vid, source=label, source_url=file.url, samples=list(file.samples), + assay=file.resolved("assay"), source_extract_sha256=sha256, + extract_file=bam_path.relative_to(output).as_posix(), **evidence)) + return label, rows, subset.receipt + + rows, receipts = [], {} + with ThreadPoolExecutor(max_workers=4) as pool: + for future in as_completed([pool.submit(one, url) for url in spec["sources"]["all_targets"]]): + label, found, receipt = future.result() + rows.extend(found) + receipts[label] = receipt + print(f"Recounted {label}: " + ", ".join(f"{r['variant_id'].split('-chr')[0]} " + f"alt={r['templates']['alt']} ref={r['templates']['ref']}" for r in found), flush=True) + result = dict(snapshot=spec["snapshot"], catalog_sha256=digest(INPUT / "catalog.json.gz"), + audits=sorted(rows, key=lambda r: (r["source"], r["variant_id"])), + acquisition=receipts, files={p.name: digest(p) for p in sorted(destination.glob("*.bam*"))}, + interpretation="Unsampled regional reads; quality-filtered template counts, not transcript abundance.") + (destination / "audit.json").write_text(json.dumps(result, sort_keys=True, indent=2) + "\n") + + +if __name__ == "__main__": + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument("output", type=Path) + parser.add_argument("--cache") + parser.add_argument("--offline", action="store_true") + args = parser.parse_args() + recount(args.output, args.cache, args.offline) diff --git a/scripts/shared_test_data/package_comprehensive.py b/scripts/shared_test_data/package_comprehensive.py new file mode 100644 index 0000000..a2a8626 --- /dev/null +++ b/scripts/shared_test_data/package_comprehensive.py @@ -0,0 +1,119 @@ +"""Pack the evidence, verified reads, audit and reproduction code in one archive.""" + +import argparse +import gzip +import io +import json +import subprocess +import sys +import tarfile +from pathlib import Path + +sys.path.insert(0, str(Path(__file__).resolve().parents[2])) + +from osteosarc import verify_bundle # noqa: E402 +from osteosarc.cache import digest # noqa: E402 +from osteosarc.shared import read_json # noqa: E402 + +ROOT = Path(__file__).resolve().parents[2] +INPUT = ROOT / "tests/data/comprehensive" + + +def package(output, *, evidence_only=False): + from scripts.shared_test_data.verify_evidence_comprehensive import verify + evidence_audit = verify(output) + spec = read_json(INPUT / "spec.json") + bundle = output / spec["id"] + if not evidence_only: + verify_bundle(bundle) + audit = read_json(output / "read-audit.json.gz") + if audit["manifest_sha256"] != digest(bundle / "manifest.json"): + raise ValueError("Audit is for another read bundle") + if audit["catalog_sha256"] != digest(INPUT / "catalog.json.gz"): + raise ValueError("Audit is for another evidence catalogue") + for name, field in (("controls/audit.json", "controls_audit_sha256"), + ("portable-recipe.json", "portable_recipe_sha256"), + ("reference-contexts.json.gz", "reference_contexts_sha256")): + if audit[field] != digest(output / name): + raise ValueError(f"Audited artifact changed: {name}") + for name, checksum in read_json(output / "controls/audit.json")["files"].items(): + if digest(output / "controls" / name) != checksum: + raise ValueError(f"Audited control extract changed: {name}") + for name, checksum in read_json(INPUT / "checksums.json").items(): + if digest(INPUT / name) != checksum: + raise ValueError(f"Evidence input changed: {name}") + files = {"evidence/" + p.name: p for p in INPUT.iterdir() if p.is_file()} + discrepancies = evidence_audit["published_zero_rna_discrepancies"] + if discrepancies: + rna_result = ( + f"Independent recounts found high-quality ALT templates in {len(discrepancies)} " + "control/source comparisons despite published zero RNA ALT counts. " + "These controls are not uniformly RNA-negative; see published_zero_rna_discrepancies " + "in audit/evidence-audit.json for the affected variants, sources and counts. ") + else: + rna_result = ( + f"The {len(evidence_audit['negative_controls'])} controls have zero high-quality ALT templates " + f"in all {evidence_audit['tumor_rna_products_checked']} tested tumor RNA products. ") + readme_path = output / ("README-evidence.md" if evidence_only else "README-dataset.md") + readme_path.write_text( + "# Osteosarc comprehensive test dataset\n\n" + + ("This archive contains the complete evidence catalogue and independently verified, unsampled control BAMs. " + "The larger balanced openvax-v3 read bundle is not included. Its build specification and code are included.\n\n" + if evidence_only else "This archive contains the evidence catalogue, unsampled controls, and verified balanced read bundle.\n\n") + + "See evidence/README.md for provenance, counting units, known exceptions and reproduction details. " + "manifest.json pins every delivered file by SHA-256. Dataset: CC0-1.0; code: Apache-2.0.\n\n" + "From this extracted directory, with Python and the dependencies in reproduction/pyproject.toml installed:\n\n" + "```sh\npython reproduction/scripts/shared_test_data/verify_evidence_comprehensive.py .\n```\n\n" + f"This reproduces the catalogue and all {evidence_audit['control_recounts_verified']} control recounts offline. " + "It needs no source BAM downloads or website snapshot. " + + rna_result + + "Coverage limitations, BTN3A3's blood-RNA summary exception, and NR2F2's historical RNA evidence are preserved explicitly.\n") + files["README.md"] = readme_path + if not evidence_only: + files.update({"reads/" + str(p.relative_to(bundle)): p for p in bundle.rglob("*") if p.is_file()}) + files.update({"controls/" + p.name: p for p in (output / "controls").iterdir() if p.is_file()}) + files["audit/evidence-audit.json"] = output / "evidence-audit.json" + if not evidence_only: + files.update({"audit/" + name: output / name for name in + ("read-audit.json.gz", "audit-summary.json", "build.json", "portable-recipe.json", + "reference-contexts.json.gz")}) + files.update({"reproduction/" + str(p.relative_to(ROOT)): p for p in + [*sorted((ROOT / "osteosarc").glob("*.py")), + *sorted((ROOT / "scripts/shared_test_data").glob("*comprehensive.py")), + ROOT / "pyproject.toml", ROOT / "README.md", ROOT / "LICENSE", ROOT / "MANIFEST.in"]}) + for folder in (ROOT / "osteosarc/data", ROOT / "tests"): + files.update({"reproduction/" + str(p.relative_to(ROOT)): p for p in folder.rglob("*") + if p.is_file() and "__pycache__" not in p.parts}) + suffix = "-evidence" if evidence_only else "" + manifest = dict(schema_version=1, id="osteosarc-comprehensive-2026-09-28" + suffix, published=False, + component="evidence-and-unsampled-controls" if evidence_only else "evidence-controls-and-balanced-reads", + snapshot=spec["snapshot"], redistribution=spec["redistribution"], + git_base=subprocess.check_output(["git", "rev-parse", "HEAD"], cwd=ROOT, text=True).strip(), + files={name: dict(sha256=digest(path), size_bytes=path.stat().st_size) + for name, path in sorted(files.items())}) + raw_manifest = (json.dumps(manifest, sort_keys=True, indent=2) + "\n").encode() + manifest_path = output / ("dataset" + suffix + "-manifest.json") + manifest_path.write_bytes(raw_manifest) + archive = output / (manifest["id"] + ".tar.gz") + with archive.open("wb") as raw, gzip.GzipFile(filename="", fileobj=raw, mode="wb", mtime=0) as compressed, \ + tarfile.open(fileobj=compressed, mode="w", format=tarfile.PAX_FORMAT) as tar: + info = tarfile.TarInfo("manifest.json") + info.size, info.mode = len(raw_manifest), 0o644 + tar.addfile(info, io.BytesIO(raw_manifest)) + for name, path in sorted(files.items()): + info = tarfile.TarInfo(name) + info.size, info.mode = path.stat().st_size, 0o644 + with path.open("rb") as handle: + tar.addfile(info, handle) + record = dict(archive=archive.name, sha256=digest(archive), size_bytes=archive.stat().st_size, + manifest_sha256=digest(manifest_path), published=False) + (output / ("dataset" + suffix + "-archive.json")).write_text(json.dumps(record, indent=2) + "\n") + print(json.dumps(record, indent=2)) + + +if __name__ == "__main__": + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument("output", type=Path) + parser.add_argument("--evidence-only", action="store_true", help="Package the completed evidence and unsampled controls independently of the larger read build") + args = parser.parse_args() + package(args.output, evidence_only=args.evidence_only) diff --git a/scripts/shared_test_data/verify_evidence_comprehensive.py b/scripts/shared_test_data/verify_evidence_comprehensive.py new file mode 100644 index 0000000..a2eeaee --- /dev/null +++ b/scripts/shared_test_data/verify_evidence_comprehensive.py @@ -0,0 +1,81 @@ +"""Verify the complete evidence catalogue and unsampled controls offline. + +python scripts/shared_test_data/verify_evidence_comprehensive.py build/comprehensive + +This check needs neither the source BAMs nor the larger balanced read bundle. +""" + +import argparse +import json +import sys +from pathlib import Path + +sys.path.insert(0, str(Path(__file__).resolve().parents[2])) + +import pysam # noqa: E402 + +from osteosarc import Region # noqa: E402 +from osteosarc.cache import digest # noqa: E402 +from osteosarc.corpus import ( # noqa: E402 + AUDIT_SNVS, + NEGATIVE_CONTROLS, + RNA_ASSAYS, + evidence_catalog, + snv_read_support, + verify_control_extracts, +) +from osteosarc.reads import resolve_regions # noqa: E402 +from osteosarc.shared import read_json # noqa: E402 + +INPUT = Path(__file__).resolve().parents[2] / "tests/data/comprehensive" + + +def verify(output): + for name, checksum in read_json(INPUT / "checksums.json").items(): + if digest(INPUT / name) != checksum: + raise ValueError(f"Evidence input changed: {name}") + catalog = read_json(INPUT / "catalog.json.gz") + if evidence_catalog(read_json(INPUT / "inputs.json.gz")) != catalog: + raise ValueError("Catalogue is not reproducible from the frozen inputs") + spec = read_json(INPUT / "spec.json") + control = read_json(output / "controls/audit.json") + if control["snapshot"] != spec["snapshot"] or control["catalog_sha256"] != digest(INPUT / "catalog.json.gz"): + raise ValueError("Controls refer to different evidence inputs") + verify_control_extracts(output, control) + expected = {(url, vid) for url in spec["sources"]["all_targets"] for vid in AUDIT_SNVS} + rows = control["audits"] + if len(rows) != len(expected) or {(r["source_url"], r["variant_id"]) for r in rows} != expected: + raise ValueError("Control audit is missing or duplicates variant/source pairs") + for row in rows: + chrom, pos, ref, alt = catalog["variants"][row["variant_id"]]["allele"] + path = output / row["extract_file"] + if digest(path) != row["source_extract_sha256"]: + raise ValueError(f"Wrong source extract: {path}") + with pysam.AlignmentFile(str(path)) as bam: + region = resolve_regions([Region(chrom, pos - 1, pos, "GRCh38")], bam.header.to_dict())[0] + actual = snv_read_support(bam.fetch(region.contig, region.start, region.end), pos, ref, alt) + if any(row[k] != value for k, value in actual.items()): + raise ValueError(f"Control recount differs: {row['source']} / {row['variant_id']}") + rna = {f["url"] for s in catalog["count_sources"].values() if s["assay_type"] in RNA_ASSAYS for f in s["files"]} + negative = [r for r in rows if r["source_url"] in rna and r["variant_id"] in NEGATIVE_CONTROLS] + if len(negative) != len(rna) * len(NEGATIVE_CONTROLS): + raise ValueError("Not all reported RNA sources were independently recounted") + discrepancies = [r for r in negative if r["templates"]["alt"] > 0] + report = dict(schema_version=1, component="evidence-and-unsampled-controls", snapshot=spec["snapshot"], + catalog_sha256=digest(INPUT / "catalog.json.gz"), controls_audit_sha256=digest(output / "controls/audit.json"), + catalogue_rebuilt_exactly=True, control_recounts_verified=len(rows), + tumor_rna_products_checked=len(rna), + tumor_rna_negative_recounts=len(negative), published_zero_rna_discrepancies=discrepancies, + negative_controls=catalog["negative_controls"], known_rna_disagreements=catalog["known_rna_disagreements"], + summary=catalog["summary"], + broader_read_bundle="Verified separately by audit_comprehensive.py; not certified by this report.") + (output / "evidence-audit.json").write_text(json.dumps(report, sort_keys=True, indent=2) + "\n") + print(json.dumps({k: report[k] for k in ("catalogue_rebuilt_exactly", "control_recounts_verified", + "tumor_rna_negative_recounts", "published_zero_rna_discrepancies")}, indent=2)) + return report + + +if __name__ == "__main__": + parser = argparse.ArgumentParser(description=__doc__) + parser.add_argument("output", type=Path) + verify(parser.parse_args().output) diff --git a/tests/data/comprehensive/README.md b/tests/data/comprehensive/README.md new file mode 100644 index 0000000..29d4d81 --- /dev/null +++ b/tests/data/comprehensive/README.md @@ -0,0 +1,202 @@ +# Comprehensive vaccine / RNA regression corpus + +Pinned to osteosarc snapshot **2026-09-28**, ID +`efb65d4b683bda162879c86c0ea889afcc64704b5228224c061109f306503b91`. +Dataset license: CC0-1.0. Code: Apache-2.0. + +This corpus contains every vaccine-associated small variant found in any of the +site's three membership sources, longitudinal RNA evidence, DNA evidence and +matched-normal controls, frameshifts, and structural-variant regressions. +`openvax-v3` is a local candidate; it has not been published or made the default. + +## Contents + +| File | Contents | +| --- | --- | +| `catalog.json.gz` | Evidence catalogue; ordinary gzip-compressed JSON | +| `inputs.json.gz` | Frozen corrected inputs, original annotations, and source checksums; sufficient to rebuild the catalogue offline | +| `spec.json` | Reproducible read-selection specification; carries every library fixture from openvax-v2 | +| `count-source-aliases.json` | Explicit CellRanger count-table aliases and public sample paths | +| `historical-rna.json` | 293 pre-sampling RNA observations from the verified openvax-v2 recipe, with source and assembly identities | +| `checksums.json` | SHA-256 of the frozen inputs and derived catalogue | +| `summary.json` | Checked catalogue totals | + +The catalogue has **202 small-variant entries**, including **51 vaccine +variants** and **12 annotated frameshifts**. It retains unresolved entries and +additional count-table alleles. A genomic length change modulo three is recorded +separately: that alone does not establish a coding frameshift. + +The website's index marks only 44 variants as vaccinated. Seven further mRNA +targets appear in its vaccine-overlap table: ABI3BP, ANKRD17, ASPM, EXD3, PPP1R3F, +PRRC2C and SPG11. All **38 overlap rows** are preserved, including the two TECPR1 +rows. Membership assertions from the index, source-variant flags and overlap +table stay separate; the inclusion policy is their union. Peptides and ELISPOT +annotations remain source assertions, with unknowns intact. + +`allele_support` is a complete **202 × 37 = 7,474** matrix of variant × reported +BAM. This includes **15 tumor RNA products across T0–T3**, spanning bulk RNA, +short-read single-cell RNA and ONT, as well as tumor, organoid and normal DNA. +The 21-sample registry is included. `source_reported_support` additionally +preserves the site's depth/rounded-VAF summaries, including longitudinal blood +GEX/CITE-seq. These summaries are not independently recounted raw allele counts. +Samples without a measurement remain without a measurement. + +`evidence_overlaps` preserves the reviewed Tempus ALMY/KCV relationship, its raw +regional audit and published duplicate-delivery evidence. The affected KCV count +source links to that group and flags its unresolved biological specimen/timepoint. +The published T1 label is retained as a source assertion. ALMY's reprocessed BAM +is not a second independent RNA product in this count matrix. + +`structural_candidates` preserves **all 637 candidates**, their original calls, +breakends, adjacency-group IDs, expression annotations and sample-specific RNA +evidence. The read specification covers **28 structural targets**, including +the seven existing fusion regressions and additional MAP4, TENM1, CNOT3/LENG1, +RUNX1, TGFBR2 and TFDP2 cases. Unresolved breakends remain explicit. Ordinary +splicing, nearby geometry and exact DNA-allele evidence are separate fields; +joining reads alone do not validate a rearrangement or neoantigen. + +## RNA-negative SNV controls + +Four SNVs have strong DNA evidence and zero reported alternate reads in +**all 15 tumor RNA products**. Their RNA coverage is explicitly distinguished: + +| Variant | Example tumor DNA alt/depth | Timepoint | RNA control class | +| --- | --- | --- | --- | +| ACE chr17:63497361 | 12/90, BostonGene WES | T1 | Covered, no ALT | +| BTN3A3 chr6:26448446 | 11/71, Personalis WGS | T0 | Covered, no ALT | +| CTSE chr1:206022947 | 47/381, BostonGene WES | T1 | Insufficient coverage | +| DBH chr9:133652279 | 181/603, BostonGene WES | T0 | Insufficient coverage | + +Each comparison requires tumor DNA depth ≥50, alternate reads ≥10 and VAF ≥10%; +normal DNA from the same provider, assay and timepoint with depth ≥30 and VAF +≤1%. The covered controls additionally require RNA reference reads ≥20 at that +timepoint. CTSE and DBH have fewer than 20 reference reads in every reported +RNA product; they test the distinction between absent alternate support and +insufficient coverage. The catalogue records every qualifying comparison and +its BAM identities. These criteria do not establish conclusively somatic status. + +The negative-control scope is **tumor RNA**, not every tissue. BTN3A3 has a +separate blood CITE-seq summary (December 2025) reporting VAF 0.0023 at depth +435. This is preserved in `nonzero_rna_summary_exceptions`, without inferring +an integer ALT count or treating the small signal as independently validated. +ACE, CTSE and DBH have no nonzero RNA summary exceptions in the frozen inputs. + +**NR2F2 chr15:96332299 is a disagreement case, not a negative control.** The +current count table reports zero RNA ALT, but the historical GRCh37 CeGaT +P116686_3 fixture records **7 alternate templates** before sampling. Its original +allele, assembly, source and observed counts remain in `known_rna_disagreements`. +Historical RNA support is checked before admitting a negative control. +The read audit also verifies preservation of every selected historical NR2F2 +record and identifies the current library members containing them. Its seven +historical ALT templates use the original, unfiltered classifier; they are not +claimed to pass the independent MAPQ/NH/base-quality policy below. + +The read audit independently recounts these loci from **full regional extracts +before fixture sampling**. It collapses RG/QNAME templates, excludes duplicate, +secondary, supplementary, unmapped and QC-failed records, and requires MAPQ ≥20 +and base quality ≥20. MAPQ 255 is accepted only with NH=1; missing base qualities +are unknown. Overlapping mates with conflicting bases count as `other`. +Any alternate reads contradicting the published zeros are reported in +`published_zero_rna_discrepancies`, not hidden by changing thresholds. +The packaged README reports these discrepancies when present; it claims zero +high-quality RNA ALT only when the independent recounts confirm that result. +Both audit paths bind every count source and delivered BAM/index checksum to +the original acquisition receipt and snapshot before attributing its reads. + +## Meaning of a support cell + +| Status | Meaning | +| --- | --- | +| `alt_observed` | At least one alternate read reported; not a confidence threshold | +| `covered_no_alt` | Measured reference support and zero alternate reads | +| `no_coverage` | Measured depth is zero | +| `other_only` | Coverage exists, but neither REF nor ALT was observed | +| `not_measured` | Missing row, missing count, or counts invalidated by a correction | +| `unresolved_allele` | No usable literal allele; never a negative observation | + +Do not sum processing products as independent biological replicates. The +catalogue reports ambiguous BAM basenames instead of guessing a public file. +Neither a rounded VAF of zero nor an absent RNA record proves absent expression. +Published counts retain their original counting units and unspecified filtering; +the independently recounted template counts have their own explicit filters. + +## Build and verify + +From the repository root, with the pinned snapshot in the cache: + +```sh +python scripts/shared_test_data/catalog_comprehensive.py +python scripts/shared_test_data/controls_comprehensive.py build/comprehensive +python scripts/shared_test_data/verify_evidence_comprehensive.py build/comprehensive +python scripts/shared_test_data/build_comprehensive.py build/comprehensive +python scripts/shared_test_data/audit_comprehensive.py build/comprehensive +python scripts/shared_test_data/package_comprehensive.py build/comprehensive +python -m pytest tests/test_corpus.py tests/test_shared.py -q +``` + +The read build streams bounded regions, never whole remote BAMs. It writes +`build/comprehensive/openvax-v3/`, its `.tar.gz`, `recipe.json` and `build.json`. +It does not write a published release record. The audit writes +`read-audit.json.gz` and `audit-summary.json`. Reruns reuse cached extractions; +`--offline` on the build proves cached inputs suffice. +`reference-contexts.json.gz` contains the reference windows and sequence hashes +used for allele validation, including repeat-expanded indel windows. +The audit also writes `portable-recipe.json` with the public index URLs. This +can rebuild the exact selected records without the website snapshot: +`osteosarc.generate_bundle(recipe, destination, cache=osteosarc.Cache(...))`, +using an online cache for first acquisition. The portable recipe has a different +recipe checksum because it adds index metadata; selected record identities stay +the same. Reading the supplied bundle itself requires no source BAMs or snapshot. +The packaging command writes `osteosarc-comprehensive-2026-09-28.tar.gz`, +containing `evidence/`, `reads/`, `audit/`, reproduction source code and a +per-file checksum manifest. Its checksum is in `dataset-archive.json`. +The evidence and unsampled controls can also be verified and packaged separately: +`python scripts/shared_test_data/package_comprehensive.py build/comprehensive --evidence-only`. +That archive is explicitly labeled `-evidence`; it does not contain or certify the +larger balanced read bundle. Its checksum is in `dataset-evidence-archive.json`. +`controls/` contains unsampled, indexed BAMs at the four negative-control +positions and the NR2F2 disagreement position, with acquisition receipts, so the independent recount can be +repeated from the delivered files without downloading any BAMs. + +Every selected record is pinned with its binary BAM identity and multiplicity. +All openvax-v2 library members are checked for exact preservation. Vaccine +coverage is checked against every all-target source, including empty members. +Carry-forward acquisition queries known record starts, including placed-unmapped +records, avoiding the long +introns spanned by historical fixture windows; every required binary record and +its multiplicity must still be recovered. +The new recipe gives the GABBR1/SLC29A1, OTUD7A/FMN1 and PARD3B/CDKN2B fusions +explicit retained sides, per issue #96, without changing published panels. +The comprehensive selection permits up to 2,000 supplementary regions per source +(the expanded ONT selection exceeds the old 100-region limit). +Supplementary-alignment retrieval permits up to 1,000,000 records per queried +region; MAPQ-zero/invalid SA entries, absent contigs and over-limit regions are +excluded and reported by the acquisition log. + +Read fixtures are deliberately balanced and capped, and are **unsuitable for +abundance or VAF estimation**. Use the published support matrix or pre-sampling +observations for their respective measurements. Use fixture BAMs for testing +read handling, allele extraction, translation and downstream ranking behavior. + +```python +import gzip +import json +import osteosarc + +with gzip.open("tests/data/comprehensive/catalog.json.gz", "rt") as handle: + catalogue = json.load(handle) +vaccine_ids = [vid for vid, v in catalogue["variants"].items() + if v["vaccine"]["included"]] +rna = [r for r in catalogue["allele_support"] + if r["variant_id"] in vaccine_ids and r["assay_type"] == "RNA"] + +bam = osteosarc.bundle_file( + "build/comprehensive/openvax-v3", + "BG003082.Aligned.sortedByCoord.out.md.DYNC1H1-chr14-101980529", +) +``` + +Tests prove exact offline catalogue reproduction, all vaccine joins, complete +matrix coverage, separation of missing/zero/other-only evidence, same-timepoint +negative-control comparisons, and failure on conflicting alleles, duplicate +rows, missing RNA counts or newly positive RNA evidence. diff --git a/tests/data/comprehensive/catalog.json.gz b/tests/data/comprehensive/catalog.json.gz new file mode 100644 index 0000000..fcbfea9 Binary files /dev/null and b/tests/data/comprehensive/catalog.json.gz differ diff --git a/tests/data/comprehensive/checksums.json b/tests/data/comprehensive/checksums.json new file mode 100644 index 0000000..e08d271 --- /dev/null +++ b/tests/data/comprehensive/checksums.json @@ -0,0 +1,7 @@ +{ + "catalog.json.gz": "945bd2003253747f7eafdd9363654cccaac2cb579c0adac473722868caed82e6", + "count-source-aliases.json": "5d9c94a275340cacac95ae410bc0674f05fab8aa747769114eace2781b5fd84f", + "historical-rna.json": "9fa6cc78bb86623d1c06fe7431645c482b28e1cda143866fc2beba430507eb65", + "inputs.json.gz": "e5f23d61a1c515dbd1b35e4ccd5cde94b58b116ab0375cf045d464a99fe9b946", + "spec.json": "716d79b3a4ce88f31f7337b7d5375dff8819e6a50bfa289cfcbdeadeca901331" +} diff --git a/tests/data/comprehensive/count-source-aliases.json b/tests/data/comprehensive/count-source-aliases.json new file mode 100644 index 0000000..3202727 --- /dev/null +++ b/tests/data/comprehensive/count-source-aliases.json @@ -0,0 +1,6 @@ +{ + "tumor_scrnaseq_T1.bam": "kamil/tumor/output/T1/outs/per_sample_outs/T1/sample_alignments.bam", + "tumor_scrnaseq_T2.bam": "kamil/tumor/output/T2/outs/per_sample_outs/T2/sample_alignments.bam", + "tumor_scrnaseq_T3.bam": "kamil/tumor/output/T3/outs/per_sample_outs/T3/sample_alignments.bam", + "tumor_scrnaseq_T3_CD45neg.bam": "kamil/tumor/output/T3_CD45neg/outs/per_sample_outs/T3_CD45neg/sample_alignments.bam" +} diff --git a/tests/data/comprehensive/historical-rna.json b/tests/data/comprehensive/historical-rna.json new file mode 100644 index 0000000..7e1d148 --- /dev/null +++ b/tests/data/comprehensive/historical-rna.json @@ -0,0 +1,7241 @@ +[ + { + "allele": [ + "chrX", + 77599465, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.ATRX-chrX-77599465", + "observed_before_sampling": { + "alt": 16, + "other": 0, + "ref": 198, + "uncallable": 9 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ATRX-chrX-77599465" + }, + { + "allele": [ + "chr6", + 110228838, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.CDC40-chr6-110228838", + "observed_before_sampling": { + "alt": 52, + "other": 1, + "ref": 196, + "uncallable": 5 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CDC40-chr6-110228838" + }, + { + "allele": [ + "chr5", + 141526090, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.DIAPH1-chr5-141526090", + "observed_before_sampling": { + "alt": 18, + "other": 0, + "ref": 73, + "uncallable": 4 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DIAPH1-chr5-141526090" + }, + { + "allele": [ + "chr14", + 102030200, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.DYNC1H1-chr14-102030200", + "observed_before_sampling": { + "alt": 40, + "other": 3, + "ref": 405, + "uncallable": 9 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-102030200" + }, + { + "allele": [ + "chrX", + 154930861, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.F8-chrX-154930861", + "observed_before_sampling": { + "alt": 11, + "other": 0, + "ref": 19, + "uncallable": 0 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "F8-chrX-154930861" + }, + { + "allele": [ + "chr9", + 3856149, + "CTGATGTGG", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.GLIS3-chr9-3856149", + "observed_before_sampling": { + "alt": 0, + "other": 13, + "ref": 36, + "uncallable": 16 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GLIS3-chr9-3856149" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 0, + "other": 7, + "ref": 1115, + "uncallable": 8 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr12", + 5494381, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.NTF3-chr12-5494381", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 3, + "uncallable": 0 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr12", + 5494381, + "AG", + "GT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.NTF3-chr12-5494381-compound", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 3, + "uncallable": 0 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr3", + 46898732, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.PTH1R-chr3-46898732", + "observed_before_sampling": { + "alt": 41, + "other": 5, + "ref": 734, + "uncallable": 18 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PTH1R-chr3-46898732" + }, + { + "allele": [ + "chr17", + 80327830, + "ATAC", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.RNF213-chr17-80327830", + "observed_before_sampling": { + "alt": 61, + "other": 18, + "ref": 495, + "uncallable": 125 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RNF213-chr17-80327830" + }, + { + "allele": [ + "chr3", + 77607853, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.ROBO2-chr3-77607853", + "observed_before_sampling": { + "alt": 63, + "other": 1, + "ref": 8, + "uncallable": 0 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ROBO2-chr3-77607853" + }, + { + "allele": [ + "chr9", + 97910412, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.TMRO-chr9-97910412", + "observed_before_sampling": { + "alt": 56, + "other": 0, + "ref": 253, + "uncallable": 22 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TMRO-chr9-97910412" + }, + { + "allele": [ + "chr8", + 99861923, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.VPS13B-chr8-99861923", + "observed_before_sampling": { + "alt": 11, + "other": 0, + "ref": 37, + "uncallable": 1 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "VPS13B-chr8-99861923" + }, + { + "allele": [ + "chr5", + 168399513, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.WWC1-chr5-168399513", + "observed_before_sampling": { + "alt": 5, + "other": 1, + "ref": 30, + "uncallable": 0 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "WWC1-chr5-168399513" + }, + { + "allele": [ + "chr1", + 23362762, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.ZNF436-chr1-23362762", + "observed_before_sampling": { + "alt": 43, + "other": 0, + "ref": 32, + "uncallable": 23 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF436-chr1-23362762" + }, + { + "allele": [ + "chrX", + 46501045, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.ZNF674-chrX-46501045", + "observed_before_sampling": { + "alt": 22, + "other": 0, + "ref": 57, + "uncallable": 8 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed/2024.06.11.bostongene.align.tcga.protocol.dr32Aligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF674-chrX-46501045" + }, + { + "allele": [ + "chr7", + 48410588, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ABCA13-chr7-48410588", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ABCA13-chr7-48410588" + }, + { + "allele": [ + "chr19", + 1065339, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ABCA7-chr19-1065339", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 111, + "uncallable": 29 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ABCA7-chr19-1065339" + }, + { + "allele": [ + "chr7", + 151218156, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ABCF2-chr7-151218156", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 57, + "uncallable": 8 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ABCF2-chr7-151218156" + }, + { + "allele": [ + "chr3", + 100850671, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ABI3BP-chr3-100850671", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 5, + "uncallable": 2 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ABI3BP-chr3-100850671" + }, + { + "allele": [ + "chr17", + 63497361, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ACE-chr17-63497361", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 15, + "uncallable": 2 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ACE-chr17-63497361" + }, + { + "allele": [ + "chr5", + 131988563, + "G", + "GTA" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ACSL6-chr5-131988563", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 16 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ACSL6-chr5-131988563" + }, + { + "allele": [ + "chr12", + 51913344, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ACVRL1-chr12-51913344", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 24, + "uncallable": 4 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ACVRL1-chr12-51913344" + }, + { + "allele": [ + "chr2", + 9521241, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ADAM17-chr2-9521241", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 82, + "uncallable": 23 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ADAM17-chr2-9521241" + }, + { + "allele": [ + "chr1", + 167824546, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ADCY10-chr1-167824546", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ADCY10-chr1-167824546" + }, + { + "allele": [ + "chr6", + 46856758, + "T", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ADGRF5-chr6-46856758", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 66, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ADGRF5-chr6-46856758" + }, + { + "allele": [ + "chr12", + 57732961, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.AGAP2-chr12-57732961", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 71, + "uncallable": 10 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "AGAP2-chr12-57732961" + }, + { + "allele": [ + "chr19", + 40238080, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.AKT2-chr19-40238080", + "observed_before_sampling": { + "alt": 7, + "other": 0, + "ref": 92, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "AKT2-chr19-40238080" + }, + { + "allele": [ + "chr4", + 73412066, + "C", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ALB-chr4-73412066", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ALB-chr4-73412066" + }, + { + "allele": [ + "chr15", + 64915850, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ANKDD1A-chr15-64915850", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 42, + "uncallable": 45 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ANKDD1A-chr15-64915850" + }, + { + "allele": [ + "chr4", + 73097139, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ANKRD17-chr4-73097139", + "observed_before_sampling": { + "alt": 32, + "other": 4, + "ref": 188, + "uncallable": 11 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ANKRD17-chr4-73097139" + }, + { + "allele": [ + "chr2", + 94813391, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ANKRD20A8P-chr2-94813391", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 6, + "uncallable": 86 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ANKRD20A8P-chr2-94813391" + }, + { + "allele": [ + "chr1", + 156940285, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ARHGEF11-chr1-156940285", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 96, + "uncallable": 9 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ARHGEF11-chr1-156940285" + }, + { + "allele": [ + "chr2", + 231215145, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ARMC9-chr2-231215145", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 66 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ARMC9-chr2-231215145" + }, + { + "allele": [ + "chr1", + 197102716, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ASPM-chr1-197102716", + "observed_before_sampling": { + "alt": 3, + "other": 1, + "ref": 42, + "uncallable": 34 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ASPM-chr1-197102716" + }, + { + "allele": [ + "chrX", + 77599465, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ATRX-chrX-77599465", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 111, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ATRX-chrX-77599465" + }, + { + "allele": [ + "chr9", + 33262750, + "C", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BAG1-chr9-33262750", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 148, + "uncallable": 29 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BAG1-chr9-33262750" + }, + { + "allele": [ + "chr7", + 73498699, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BAZ1B-chr7-73498699", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 80, + "uncallable": 490 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BAZ1B-chr7-73498699" + }, + { + "allele": [ + "chr8", + 22192067, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BMP1-chr8-22192067", + "observed_before_sampling": { + "alt": 39, + "other": 0, + "ref": 88, + "uncallable": 11 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BMP1-chr8-22192067" + }, + { + "allele": [ + "chr6", + 3129127, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BPHL-chr6-3129127", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 39, + "uncallable": 15 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BPHL-chr6-3129127" + }, + { + "allele": [ + "chr12", + 111644377, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BRAP-chr12-111644377", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 46, + "uncallable": 3 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BRAP-chr12-111644377" + }, + { + "allele": [ + "chr7", + 2541029, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BRAT1-chr7-2541029", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 50, + "uncallable": 3 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BRAT1-chr7-2541029" + }, + { + "allele": [ + "chr12", + 107642169, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BTBD11-chr12-107642169", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 6, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BTBD11-chr12-107642169" + }, + { + "allele": [ + "chr3", + 15645183, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BTD-chr3-15645183", + "observed_before_sampling": { + "alt": 10, + "other": 0, + "ref": 7, + "uncallable": 502 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BTD-chr3-15645183" + }, + { + "allele": [ + "chr6", + 26448446, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.BTN3A3-chr6-26448446", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 197, + "uncallable": 436 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "BTN3A3-chr6-26448446" + }, + { + "allele": [ + "chr18", + 23135764, + "T", + "TGGCGGC" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CABLES1-chr18-23135764", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 16 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CABLES1-chr18-23135764" + }, + { + "allele": [ + "chr2", + 201209100, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CASP10-chr2-201209100", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 53, + "uncallable": 15 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CASP10-chr2-201209100" + }, + { + "allele": [ + "chr11", + 125038474, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CCDC15-chr11-125038474", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 21, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CCDC15-chr11-125038474" + }, + { + "allele": [ + "chr17", + 80090148, + "A", + "AGAACAACACGGGACGCGCGCAGGCACGTGCAC" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CCDC40-chr17-80090148", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 35 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CCDC40-chr17-80090148" + }, + { + "allele": [ + "chr6", + 73818405, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CD109-chr6-73818405", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 16, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CD109-chr6-73818405" + }, + { + "allele": [ + "chr6", + 110228838, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CDC40-chr6-110228838", + "observed_before_sampling": { + "alt": 7, + "other": 1, + "ref": 75, + "uncallable": 9 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CDC40-chr6-110228838" + }, + { + "allele": [ + "chr3", + 63770421, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CDHR18P-chr3-63770421", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CDHR18P-chr3-63770421" + }, + { + "allele": [ + "chr9", + 22056251, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CDKN2B_AS1-chr9-22056251", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CDKN2B_AS1-chr9-22056251" + }, + { + "allele": [ + "chr1", + 173811223, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CENPL-chr1-173811223", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 26, + "uncallable": 28 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CENPL-chr1-173811223" + }, + { + "allele": [ + "chr15", + 57451531, + "TATTGGAACAGAAAAGCA", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CGNL1-chr15-57451531", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 17, + "uncallable": 1 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CGNL1-chr15-57451531" + }, + { + "allele": [ + "chr9", + 121115135, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CNTRL-chr9-121115135", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 68, + "uncallable": 16 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CNTRL-chr9-121115135" + }, + { + "allele": [ + "chr2", + 189010889, + "CGGTAGGAAACATTTTTCTCAATATAGGTCATAAAGCAGTCAGCATTTTAGTTTAATCATGCAAATTATTTTGAATAGAATAAATAAAATTAATAGGATGAAATAAAGATAGCATTTGGTATGAATTACATACATTGCATCTACTGATTCATTGCAGGGAATGTTAAATGCAACAAAATGGATCTTAGCCTCCAGATGAAAACCAGTTGAAATAAAAGCATTTAAAATTTAAATCCATAATGCAAACTTTATCAGATAATTGGGATAGTTACTATATGTTTTGAATAATACCTGTCACATTAACTCAGTTTGAAATATCTGTTTTTTAAAATTTTAAAGGTTAACTTCAAATCTCTCATTTGTTATTGTTATTTGTGAACAAAGGGAAAACTCACTTCTAATATTAGCGAATTTCATTGTGAGAGACCTATCCTCTTTTTAATAAACCATTTATAAACCTGTTAGCAATGGCCGGAACCAGGCCTCCTGAGGATGCACTGGTCTATAGCAATTGCCCTGCTGCATTTACTAAGAATCCTTACAAGGCATTTGTTTAAGAATATTGTTTATCAACTAAGAAGATTACAGCTTTGAAGTAGAGCAGGTCTCATATACATGAATAATAACATGGCACGATGAATGCTTCTTTAGAGTAAAAAGGTTTTCTTTAACTTGTTAAGTCAGAGTTGTCTAAGTAATTGTAATGTCATGATCATGTACATTTTGTCCTTTTTTACA", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.COL3A1-Splice", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 5581 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "COL3A1-Splice" + }, + { + "allele": [ + "chr13", + 110449715, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.COL4A2-chr13-110449715", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 664, + "uncallable": 33 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "COL4A2-chr13-110449715" + }, + { + "allele": [ + "chr17", + 63910807, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CSHL1-chr17-63910807", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 21 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CSHL1-chr17-63910807" + }, + { + "allele": [ + "chr8", + 11844219, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CTSB-chr8-11844219", + "observed_before_sampling": { + "alt": 0, + "other": 5, + "ref": 427, + "uncallable": 93 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CTSB-chr8-11844219" + }, + { + "allele": [ + "chr1", + 206022947, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CTSE-chr1-206022947", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CTSE-chr1-206022947" + }, + { + "allele": [ + "chr7", + 117791756, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CTTNBP2-chr7-117791756", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 4, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CTTNBP2-chr7-117791756" + }, + { + "allele": [ + "chr6", + 43186384, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.CUL9-chr6-43186384", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 116, + "uncallable": 11 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "CUL9-chr6-43186384" + }, + { + "allele": [ + "chr9", + 133652279, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DBH-chr9-133652279", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 1, + "uncallable": 11 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DBH-chr9-133652279" + }, + { + "allele": [ + "chr4", + 154323273, + "GTTTTTTGCACGACTGCTTCCCAAATGCTGTTTTTCCCTTCAGAGGCATAGGTCTAGCTGCC", + "TTTGCACGACTGCTTCCCAAATGCTGTTTTTCCCTACCGAGGCATATGTCTAGCTGCCAA" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DCHS2-chr4-154323273", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DCHS2-chr4-154323273" + }, + { + "allele": [ + "chr1", + 155033677, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DCST2-chr1-155033677", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 12 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DCST2-chr1-155033677" + }, + { + "allele": [ + "chr4", + 9450500, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DEFB131A-chr4-9450500", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 11 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DEFB131A-chr4-9450500" + }, + { + "allele": [ + "chr5", + 141526090, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DIAPH1-chr5-141526090", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 426, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DIAPH1-chr5-141526090" + }, + { + "allele": [ + "chr19", + 2214506, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DOT1L-chr19-2214506", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 55, + "uncallable": 17 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DOT1L-chr19-2214506" + }, + { + "allele": [ + "chr5", + 175441851, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DRD1-chr5-175441851", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DRD1-chr5-175441851" + }, + { + "allele": [ + "chr14", + 101980529, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DYNC1H1-chr14-101980529", + "observed_before_sampling": { + "alt": 76, + "other": 2, + "ref": 433, + "uncallable": 55 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-101980529" + }, + { + "allele": [ + "chr14", + 102030200, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.DYNC1H1-chr14-102030200", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 358, + "uncallable": 197 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-102030200" + }, + { + "allele": [ + "chr13", + 77918105, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EDNRB-chr13-77918105", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 8, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EDNRB-chr13-77918105" + }, + { + "allele": [ + "chr7", + 36894915, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ELMO1-chr7-36894915", + "observed_before_sampling": { + "alt": 2, + "other": 1, + "ref": 247, + "uncallable": 55 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ELMO1-chr7-36894915" + }, + { + "allele": [ + "chr14", + 88681945, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EML5-chr14-88681945", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 15 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EML5-chr14-88681945" + }, + { + "allele": [ + "chr18", + 45925851, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EPG5-chr18-45925851", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 163, + "uncallable": 4 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EPG5-chr18-45925851" + }, + { + "allele": [ + "chr8", + 143870409, + "CC", + "AA" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EPPK1-chr8-143870409", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 8 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EPPK1-chr8-143870409" + }, + { + "allele": [ + "chr9", + 137373504, + "C", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EXD3-chr9-137373504", + "observed_before_sampling": { + "alt": 4, + "other": 0, + "ref": 16, + "uncallable": 34 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EXD3-chr9-137373504" + }, + { + "allele": [ + "chr7", + 133274996, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EXOC4-chr7-133274996", + "observed_before_sampling": { + "alt": 37, + "other": 2, + "ref": 362, + "uncallable": 23 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EXOC4-chr7-133274996" + }, + { + "allele": [ + "chr6", + 65405193, + "T", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.EYS-chr6-65405193", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "EYS-chr6-65405193" + }, + { + "allele": [ + "chrX", + 154930861, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.F8-chrX-154930861", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 1, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "F8-chrX-154930861" + }, + { + "allele": [ + "chr3", + 198153259, + "G", + "GGCGGCGGCGGCGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FAM157A-p_W70_Q71ins_14", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 5 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FAM157A-p_W70_Q71ins_14" + }, + { + "allele": [ + "chr6", + 54940265, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FAM83B-chr6-54940265", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FAM83B-chr6-54940265" + }, + { + "allele": [ + "chr8", + 143728543, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FAM83H-chr8-143728543", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 7, + "uncallable": 4 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FAM83H-chr8-143728543" + }, + { + "allele": [ + "chr14", + 39431722, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FBXO33-chr14-39431722", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 20, + "uncallable": 10 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FBXO33-chr14-39431722" + }, + { + "allele": [ + "chr19", + 39876804, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FCGBP-chr19-39876804", + "observed_before_sampling": { + "alt": 7, + "other": 0, + "ref": 16, + "uncallable": 199 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FCGBP-chr19-39876804" + }, + { + "allele": [ + "chr19", + 39879706, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FCGBP-chr19-39879706", + "observed_before_sampling": { + "alt": 50, + "other": 0, + "ref": 160, + "uncallable": 298 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FCGBP-chr19-39879706" + }, + { + "allele": [ + "chr4", + 1805817, + "GC", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FGFR3-chr4-1805817", + "observed_before_sampling": { + "alt": 0, + "other": 2, + "ref": 15, + "uncallable": 23 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FGFR3-chr4-1805817" + }, + { + "allele": [ + "chr1", + 37998037, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FHL3-chr1-37998037", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 28, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FHL3-chr1-37998037" + }, + { + "allele": [ + "chr11", + 35619371, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FJX1-chr11-35619371", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 15, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FJX1-chr11-35619371" + }, + { + "allele": [ + "chrX", + 12717076, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FRMPD4-chrX-12717076", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FRMPD4-chrX-12717076" + }, + { + "allele": [ + "chr7", + 73434684, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.FZD9-chr7-73434684", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 7, + "uncallable": 29 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "FZD9-chr7-73434684" + }, + { + "allele": [ + "chr6", + 29630494, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GABBR1-chr6-29630494", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 31, + "uncallable": 14 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GABBR1-chr6-29630494" + }, + { + "allele": [ + "chr6", + 29630575, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GABBR1-chr6-29630575", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 11, + "uncallable": 14 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GABBR1-chr6-29630575" + }, + { + "allele": [ + "chr9", + 125301980, + "TAGTGC", + "ATTGG" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GAPVD1-chr9-125301980", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 139 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GAPVD1-chr9-125301980" + }, + { + "allele": [ + "chr10", + 47325480, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GDF2-chr10-47325480", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GDF2-chr10-47325480" + }, + { + "allele": [ + "chr11", + 134311149, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GLB1L3-chr11-134311149", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 1 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GLB1L3-chr11-134311149" + }, + { + "allele": [ + "chr9", + 3856149, + "CTGATGTGG", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GLIS3-chr9-3856149", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GLIS3-chr9-3856149" + }, + { + "allele": [ + "chr15", + 23440197, + "C", + "CTCCCGCATCTTCTCCACCTGCTGCCACATCTTCTGCTCCCGCATTCTCTCCTCCTTCTCCCGCAGCCTCTCGTCCTGCTCCCACATCCTCTCCTTCTGGTCCCACATCTTCTGCTCCTGA" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GOLGA6L2-chr15-23440197", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GOLGA6L2-chr15-23440197" + }, + { + "allele": [ + "chr9", + 133057893, + "GGAGGAGGAGGAA", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.GTF3C5-chr9-133057893", + "observed_before_sampling": { + "alt": 26, + "other": 13, + "ref": 33, + "uncallable": 26 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "GTF3C5-chr9-133057893" + }, + { + "allele": [ + "chr6", + 26055824, + "ACCTTGGGCTTAGCGG", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.H1_2-chr6-26055824", + "observed_before_sampling": { + "alt": 83, + "other": 124, + "ref": 674, + "uncallable": 279 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "H1_2-chr6-26055824" + }, + { + "allele": [ + "chr22", + 21446352, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.HIC2-chr22-21446352", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 26, + "uncallable": 92 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "HIC2-chr22-21446352" + }, + { + "allele": [ + "chrX", + 149548470, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.HSFX3-chrX-149548470", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 5, + "uncallable": 12 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "HSFX3-chrX-149548470" + }, + { + "allele": [ + "chr1", + 21834891, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.HSPG2-chr1-21834891", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 239, + "uncallable": 24 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "HSPG2-chr1-21834891" + }, + { + "allele": [ + "chr3", + 129502728, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.IFT122-chr3-129502728", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 62, + "uncallable": 21 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "IFT122-chr3-129502728" + }, + { + "allele": [ + "chr10", + 32911945, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ITGB1-chr10-32911945", + "observed_before_sampling": { + "alt": 1, + "other": 2, + "ref": 921, + "uncallable": 108 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ITGB1-chr10-32911945" + }, + { + "allele": [ + "chr6", + 33688135, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ITPR3-chr6-33688135", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 46, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ITPR3-chr6-33688135" + }, + { + "allele": [ + "chr19", + 17830035, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.JAK3-chr19-17830035", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 6, + "uncallable": 148 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "JAK3-chr19-17830035" + }, + { + "allele": [ + "chr5", + 138391529, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KDM3B-chr5-138391529", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 121, + "uncallable": 65 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KDM3B-chr5-138391529" + }, + { + "allele": [ + "chr17", + 5007293, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KIF1C-chr17-5007293", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 85, + "uncallable": 21 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KIF1C-chr17-5007293" + }, + { + "allele": [ + "chr14", + 20429267, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KLHL33-chr14-20429267", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KLHL33-chr14-20429267" + }, + { + "allele": [ + "chr12", + 49034200, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KMT2D-chr12-49034200", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 133, + "uncallable": 58 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KMT2D-chr12-49034200" + }, + { + "allele": [ + "chr12", + 52951767, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KRT18-chr12-52951767", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 10, + "uncallable": 6 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KRT18-chr12-52951767" + }, + { + "allele": [ + "chr17", + 41422418, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KRT37-chr17-41422418", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KRT37-chr17-41422418" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 4, + "other": 1, + "ref": 612, + "uncallable": 9 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr1", + 152812486, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.LCE1B-chr1-152812486", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "LCE1B-chr1-152812486" + }, + { + "allele": [ + "chr1", + 65636606, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.LEPR-chr1-65636606", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "LEPR-chr1-65636606" + }, + { + "allele": [ + "chr1", + 151801914, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.LINGO4-chr1-151801914", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 6 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "LINGO4-chr1-151801914" + }, + { + "allele": [ + "chr4", + 151014497, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.LRBA-chr4-151014497", + "observed_before_sampling": { + "alt": 1, + "other": 1, + "ref": 389, + "uncallable": 24 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "LRBA-chr4-151014497" + }, + { + "allele": [ + "chr2", + 159840947, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.LY75-chr2-159840947", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 31, + "uncallable": 18 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "LY75-chr2-159840947" + }, + { + "allele": [ + "chr2", + 209694768, + "CCTGGGCTACTGTGTGTTCAATAAGTACACAGT", + "CAGGG" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MAP2-chr2-209694768", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 3, + "uncallable": 14 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694768" + }, + { + "allele": [ + "chr2", + 209694772, + "GGCTACTGTGTGTTCAATAAGTACACAGT", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MAP2-chr2-209694772", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 3, + "uncallable": 14 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694772" + }, + { + "allele": [ + "chr5", + 148242907, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MARCOL-chr5-148242907", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 34 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MARCOL-chr5-148242907" + }, + { + "allele": [ + "chr3", + 129437921, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MBD4-chr3-129437921", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 149, + "uncallable": 90 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MBD4-chr3-129437921" + }, + { + "allele": [ + "chr3", + 136151340, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MSL2-chr3-136151340", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 91, + "uncallable": 32 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MSL2-chr3-136151340" + }, + { + "allele": [ + "chrM", + 12994, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MT_ND5-chrM-12994", + "observed_before_sampling": { + "alt": 2871, + "other": 19, + "ref": 8826, + "uncallable": 2663 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MT_ND5-chrM-12994" + }, + { + "allele": [ + "chr11", + 1095629, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MUC2-chr11-1095629", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 6 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MUC2-chr11-1095629" + }, + { + "allele": [ + "chr17", + 75589953, + "GC", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MYO15B-chr17-75589953", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 64, + "uncallable": 25 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MYO15B-chr17-75589953" + }, + { + "allele": [ + "chr15", + 71994488, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.MYO9A-chr15-71994488", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 85, + "uncallable": 3 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "MYO9A-chr15-71994488" + }, + { + "allele": [ + "chr11", + 20080142, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NAV2-chr11-20080142", + "observed_before_sampling": { + "alt": 16, + "other": 0, + "ref": 32, + "uncallable": 11 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NAV2-chr11-20080142" + }, + { + "allele": [ + "chr1", + 16563989, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NBPF1-chr1-16563989", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 6, + "uncallable": 177 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NBPF1-chr1-16563989" + }, + { + "allele": [ + "chr1", + 16564149, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NBPF1-chr1-16564149", + "observed_before_sampling": { + "alt": 11, + "other": 0, + "ref": 23, + "uncallable": 147 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NBPF1-chr1-16564149" + }, + { + "allele": [ + "chr4", + 114870902, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NDST4-chr4-114870902", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NDST4-chr4-114870902" + }, + { + "allele": [ + "chr19", + 5896456, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NDUFA11-chr19-5896456", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 135, + "uncallable": 10 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NDUFA11-chr19-5896456" + }, + { + "allele": [ + "chr12", + 8092892, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NECAP1-chr12-8092892", + "observed_before_sampling": { + "alt": 4, + "other": 6, + "ref": 86, + "uncallable": 53 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NECAP1-chr12-8092892" + }, + { + "allele": [ + "chr19", + 55861444, + "C", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NLRP4-chr19-55861444", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NLRP4-chr19-55861444" + }, + { + "allele": [ + "chr17", + 51154443, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NME1-chr17-51154443", + "observed_before_sampling": { + "alt": 17, + "other": 0, + "ref": 0, + "uncallable": 47 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NME1-chr17-51154443" + }, + { + "allele": [ + "chr5", + 43612993, + "TCAGAACTTGGTCAAG", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NNT-chr5-43612993", + "observed_before_sampling": { + "alt": 0, + "other": 3, + "ref": 91, + "uncallable": 83 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NNT-chr5-43612993" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 13, + "uncallable": 10 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr12", + 5494381, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NTF3-chr12-5494381", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr12", + 5494381, + "AG", + "GT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.NTF3-chr12-5494381-compound", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr8", + 102560579, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ODF1-chr8-102560579", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 18 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ODF1-chr8-102560579" + }, + { + "allele": [ + "chr19", + 15807703, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.OR10H1-chr19-15807703", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "OR10H1-chr19-15807703" + }, + { + "allele": [ + "chr12", + 55637502, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.OR10P1-chr12-55637502", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "OR10P1-chr12-55637502" + }, + { + "allele": [ + "chr1", + 248294753, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.OR2T12-chr1-248294753", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 1 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "OR2T12-chr1-248294753" + }, + { + "allele": [ + "chr10", + 54079389, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PCDH15-chr10-54079389", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PCDH15-chr10-54079389" + }, + { + "allele": [ + "chrX", + 100341898, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PCDH19-chrX-100341898", + "observed_before_sampling": { + "alt": 5, + "other": 0, + "ref": 0, + "uncallable": 16 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PCDH19-chrX-100341898" + }, + { + "allele": [ + "chr12", + 41572809, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PDZRN4-chr12-41572809", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PDZRN4-chr12-41572809" + }, + { + "allele": [ + "chr6", + 136826422, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PEX7-chr6-136826422", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 32, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PEX7-chr6-136826422" + }, + { + "allele": [ + "chr1", + 151242178, + "AG", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PIP5K1A-chr1-151242178", + "observed_before_sampling": { + "alt": 6, + "other": 0, + "ref": 102, + "uncallable": 38 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PIP5K1A-chr1-151242178" + }, + { + "allele": [ + "chr6", + 46708091, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PLA2G7-chr6-46708091", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 47, + "uncallable": 2 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PLA2G7-chr6-46708091" + }, + { + "allele": [ + "chr4", + 127886717, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PLK4-chr4-127886717", + "observed_before_sampling": { + "alt": 7, + "other": 0, + "ref": 10, + "uncallable": 4 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PLK4-chr4-127886717" + }, + { + "allele": [ + "chrX", + 49270761, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PPP1R3F-chrX-49270761", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 13, + "uncallable": 1 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PPP1R3F-chrX-49270761" + }, + { + "allele": [ + "chr11", + 68601969, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PPP6R3-chr11-68601969", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 83, + "uncallable": 198 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PPP6R3-chr11-68601969" + }, + { + "allele": [ + "chr3", + 64198863, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PRICKLE2-chr3-64198863", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 21, + "uncallable": 13 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PRICKLE2-chr3-64198863" + }, + { + "allele": [ + "chr17", + 18930658, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PRPSAP2-chr17-18930658", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 30, + "uncallable": 4 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PRPSAP2-chr17-18930658" + }, + { + "allele": [ + "chr1", + 171540477, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PRRC2C-chr1-171540477", + "observed_before_sampling": { + "alt": 59, + "other": 3, + "ref": 629, + "uncallable": 64 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PRRC2C-chr1-171540477" + }, + { + "allele": [ + "chr3", + 46898732, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PTH1R-chr3-46898732", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 103, + "uncallable": 6 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PTH1R-chr3-46898732" + }, + { + "allele": [ + "chr1", + 30995054, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.PUM1-chr1-30995054", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 38, + "uncallable": 139 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "PUM1-chr1-30995054" + }, + { + "allele": [ + "chr17", + 5350565, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RABEP1-chr17-5350565", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 266, + "uncallable": 41 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RABEP1-chr17-5350565" + }, + { + "allele": [ + "chr1", + 167685445, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RCSD1-chr1-167685445", + "observed_before_sampling": { + "alt": 0, + "other": 2, + "ref": 93, + "uncallable": 24 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RCSD1-chr1-167685445" + }, + { + "allele": [ + "chr14", + 67691154, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RDH11-chr14-67691154", + "observed_before_sampling": { + "alt": 6, + "other": 0, + "ref": 59, + "uncallable": 23 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RDH11-chr14-67691154" + }, + { + "allele": [ + "chr9", + 36087719, + "A", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RECK-chr9-36087719", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 22, + "uncallable": 12 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RECK-chr9-36087719" + }, + { + "allele": [ + "chr17", + 76161924, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RNF157-chr17-76161924", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 23, + "uncallable": 16 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RNF157-chr17-76161924" + }, + { + "allele": [ + "chr17", + 80327830, + "ATAC", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RNF213-chr17-80327830", + "observed_before_sampling": { + "alt": 20, + "other": 17, + "ref": 1260, + "uncallable": 201 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RNF213-chr17-80327830" + }, + { + "allele": [ + "chr3", + 77607853, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ROBO2-chr3-77607853", + "observed_before_sampling": { + "alt": 8, + "other": 0, + "ref": 2, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ROBO2-chr3-77607853" + }, + { + "allele": [ + "chr6", + 117301021, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ROS1-chr6-117301021", + "observed_before_sampling": { + "alt": 0, + "other": 4, + "ref": 0, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ROS1-chr6-117301021" + }, + { + "allele": [ + "chr8", + 10611724, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.RP1L1-chr8-10611724", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "RP1L1-chr8-10611724" + }, + { + "allele": [ + "chr7", + 93101611, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SAMD9-chr7-93101611", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 90, + "uncallable": 3 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SAMD9-chr7-93101611" + }, + { + "allele": [ + "chr18", + 63915540, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SERPINB10-chr18-63915540", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SERPINB10-chr18-63915540" + }, + { + "allele": [ + "chr15", + 48843429, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SHC4-chr15-48843429", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 4, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SHC4-chr15-48843429" + }, + { + "allele": [ + "chr1", + 160751438, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SLAMF7-chr1-160751438", + "observed_before_sampling": { + "alt": 0, + "other": 3, + "ref": 253, + "uncallable": 59 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SLAMF7-chr1-160751438" + }, + { + "allele": [ + "chr6", + 25769158, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SLC17A4-chr6-25769158", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 10 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SLC17A4-chr6-25769158" + }, + { + "allele": [ + "chr2", + 171813470, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SLC25A12-chr2-171813470", + "observed_before_sampling": { + "alt": 11, + "other": 0, + "ref": 27, + "uncallable": 6 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SLC25A12-chr2-171813470" + }, + { + "allele": [ + "chr3", + 136855622, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SLC35G2-chr3-136855622", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 29 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SLC35G2-chr3-136855622" + }, + { + "allele": [ + "chr13", + 29522401, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SLC7A1-chr13-29522401", + "observed_before_sampling": { + "alt": 5, + "other": 0, + "ref": 32, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SLC7A1-chr13-29522401" + }, + { + "allele": [ + "chr9", + 70298024, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SMC5-chr9-70298024", + "observed_before_sampling": { + "alt": 11, + "other": 0, + "ref": 187, + "uncallable": 30 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SMC5-chr9-70298024" + }, + { + "allele": [ + "chr8", + 100213209, + "CG", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SPAG1-chr8-100213209", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 4 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SPAG1-chr8-100213209" + }, + { + "allele": [ + "chr15", + 44660435, + "T", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SPG11-chr15-44660435", + "observed_before_sampling": { + "alt": 5, + "other": 0, + "ref": 44, + "uncallable": 26 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SPG11-chr15-44660435" + }, + { + "allele": [ + "chr3", + 9104715, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SRGAP3-chr3-9104715", + "observed_before_sampling": { + "alt": 7, + "other": 0, + "ref": 66, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SRGAP3-chr3-9104715" + }, + { + "allele": [ + "chr1", + 167126143, + "C", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.STYXL2-chr1-167126143", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 7, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "STYXL2-chr1-167126143" + }, + { + "allele": [ + "chr2", + 37171433, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.SULT6B1-chr2-37171433", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 5 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "SULT6B1-chr2-37171433" + }, + { + "allele": [ + "chrX", + 101286650, + "GT", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TAF7L-chrX-101286650", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 9 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TAF7L-chrX-101286650" + }, + { + "allele": [ + "chr7", + 98241127, + "TG", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TECPR1-chr7-98241127", + "observed_before_sampling": { + "alt": 14, + "other": 5, + "ref": 150, + "uncallable": 42 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TECPR1-chr7-98241127" + }, + { + "allele": [ + "chr7", + 143286139, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TMEM139-chr7-143286139", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 14, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TMEM139-chr7-143286139" + }, + { + "allele": [ + "chr9", + 97910412, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TMRO-chr9-97910412", + "observed_before_sampling": { + "alt": 2, + "other": 0, + "ref": 59, + "uncallable": 6 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TMRO-chr9-97910412" + }, + { + "allele": [ + "chr2", + 84880932, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TRABD2A-chr2-84880932", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TRABD2A-chr2-84880932" + }, + { + "allele": [ + "chr18", + 31874592, + "A", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TRAPPC8-chr18-31874592", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 30, + "uncallable": 8 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TRAPPC8-chr18-31874592" + }, + { + "allele": [ + "chr17", + 48816988, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.TTLL6-chr17-48816988", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 26 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "TTLL6-chr17-48816988" + }, + { + "allele": [ + "chr1", + 215650752, + "C", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.USH2A-chr1-215650752", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "USH2A-chr1-215650752" + }, + { + "allele": [ + "chr8", + 99861923, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.VPS13B-chr8-99861923", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 23, + "uncallable": 15 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "VPS13B-chr8-99861923" + }, + { + "allele": [ + "chr1", + 151185547, + "T", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.VPS72-chr1-151185547", + "observed_before_sampling": { + "alt": 10, + "other": 0, + "ref": 61, + "uncallable": 26 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "VPS72-chr1-151185547" + }, + { + "allele": [ + "chrX", + 66032555, + "T", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.VSIG4-chrX-66032555", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 191, + "uncallable": 54 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "VSIG4-chrX-66032555" + }, + { + "allele": [ + "chr5", + 168399513, + "T", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.WWC1-chr5-168399513", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 5, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "WWC1-chr5-168399513" + }, + { + "allele": [ + "chr4", + 48490989, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ZAR1-chr4-48490989", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZAR1-chr4-48490989" + }, + { + "allele": [ + "chr1", + 23362762, + "G", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ZNF436-chr1-23362762", + "observed_before_sampling": { + "alt": 4, + "other": 0, + "ref": 16, + "uncallable": 9 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF436-chr1-23362762" + }, + { + "allele": [ + "chrX", + 46501045, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ZNF674-chrX-46501045", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 1, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF674-chrX-46501045" + }, + { + "allele": [ + "chr16", + 30557995, + "C", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ZNF764-chr16-30557995", + "observed_before_sampling": { + "alt": 3, + "other": 0, + "ref": 35, + "uncallable": 161 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF764-chr16-30557995" + }, + { + "allele": [ + "chr22", + 29049913, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.ZNRF3-chr22-29049913", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 0 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNRF3-chr22-29049913" + }, + { + "allele": [ + "chr7", + 151218156, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.ABCF2-chr7-151218156", + "observed_before_sampling": { + "alt": 1, + "other": 5, + "ref": 261, + "uncallable": 23 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "ABCF2-chr7-151218156" + }, + { + "allele": [ + "chr6", + 46856758, + "T", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.ADGRF5-chr6-46856758", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 25, + "uncallable": 0 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "ADGRF5-chr6-46856758" + }, + { + "allele": [ + "chr14", + 101980529, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.DYNC1H1-chr14-101980529", + "observed_before_sampling": { + "alt": 433, + "other": 3, + "ref": 534, + "uncallable": 1105 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-101980529" + }, + { + "allele": [ + "chr7", + 133274996, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.EXOC4-chr7-133274996", + "observed_before_sampling": { + "alt": 64, + "other": 0, + "ref": 248, + "uncallable": 14 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "EXOC4-chr7-133274996" + }, + { + "allele": [ + "chr9", + 133057893, + "GGAGGAGGAGGAA", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.GTF3C5-chr9-133057893", + "observed_before_sampling": { + "alt": 15, + "other": 2, + "ref": 34, + "uncallable": 14 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "GTF3C5-chr9-133057893" + }, + { + "allele": [ + "chr6", + 26055824, + "ACCTTGGGCTTAGCGG", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.H1_2-chr6-26055824", + "observed_before_sampling": { + "alt": 57, + "other": 12, + "ref": 360, + "uncallable": 240 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "H1_2-chr6-26055824" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 0, + "other": 12, + "ref": 3050, + "uncallable": 27 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr2", + 209694768, + "CCTGGGCTACTGTGTGTTCAATAAGTACACAGT", + "CAGGG" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.MAP2-chr2-209694768", + "observed_before_sampling": { + "alt": 0, + "other": 6, + "ref": 4, + "uncallable": 92 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694768" + }, + { + "allele": [ + "chr2", + 209694772, + "GGCTACTGTGTGTTCAATAAGTACACAGT", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.MAP2-chr2-209694772", + "observed_before_sampling": { + "alt": 0, + "other": 6, + "ref": 4, + "uncallable": 83 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694772" + }, + { + "allele": [ + "chrM", + 12994, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.MT_ND5-chrM-12994", + "observed_before_sampling": { + "alt": 19, + "other": 1, + "ref": 7, + "uncallable": 1 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MT_ND5-chrM-12994" + }, + { + "allele": [ + "chr15", + 71994488, + "T", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.MYO9A-chr15-71994488", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 222, + "uncallable": 24 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MYO9A-chr15-71994488" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 11, + "uncallable": 17 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr12", + 5494381, + "A", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.NTF3-chr12-5494381", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 7, + "uncallable": 2 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr12", + 5494381, + "AG", + "GT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.NTF3-chr12-5494381-compound", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 7, + "uncallable": 2 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr1", + 151242178, + "AG", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG003082.Aligned.sortedByCoord.out.md.PIP5K1A-chr1-151242178", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 187, + "uncallable": 6 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "PIP5K1A-chr1-151242178" + }, + { + "allele": [ + "chr14", + 39431722, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG009368.Aligned.sortedByCoord.out.md.FBXO33-chr14-39431722", + "observed_before_sampling": { + "alt": 7, + "other": 0, + "ref": 33, + "uncallable": 4 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "FBXO33-chr14-39431722" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG009368.Aligned.sortedByCoord.out.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 55, + "uncallable": 22 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr1", + 151242178, + "AG", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "BG009368.Aligned.sortedByCoord.out.md.PIP5K1A-chr1-151242178", + "observed_before_sampling": { + "alt": 8, + "other": 0, + "ref": 80, + "uncallable": 12 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "PIP5K1A-chr1-151242178" + }, + { + "allele": [ + "chr8", + 22192067, + "T", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.BMP1-chr8-22192067", + "observed_before_sampling": { + "alt": 95, + "other": 3, + "ref": 279, + "uncallable": 59 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "BMP1-chr8-22192067" + }, + { + "allele": [ + "chr14", + 101980529, + "G", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.DYNC1H1-chr14-101980529", + "observed_before_sampling": { + "alt": 1560, + "other": 13, + "ref": 3434, + "uncallable": 64 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-101980529" + }, + { + "allele": [ + "chr14", + 102030200, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.DYNC1H1-chr14-102030200", + "observed_before_sampling": { + "alt": 8, + "other": 2, + "ref": 228, + "uncallable": 47 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-102030200" + }, + { + "allele": [ + "chr7", + 133274996, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.EXOC4-chr7-133274996", + "observed_before_sampling": { + "alt": 238, + "other": 4, + "ref": 1640, + "uncallable": 14 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "EXOC4-chr7-133274996" + }, + { + "allele": [ + "chr17", + 51154443, + "G", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.NME1-chr17-51154443", + "observed_before_sampling": { + "alt": 536, + "other": 6, + "ref": 100, + "uncallable": 6388 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "NME1-chr17-51154443" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 11, + "uncallable": 65 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr12", + 5494381, + "A", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.NTF3-chr12-5494381", + "observed_before_sampling": { + "alt": 9, + "other": 0, + "ref": 5, + "uncallable": 1 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr12", + 5494381, + "AG", + "GT" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.NTF3-chr12-5494381-compound", + "observed_before_sampling": { + "alt": 9, + "other": 0, + "ref": 5, + "uncallable": 1 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr1", + 151242178, + "AG", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.PIP5K1A-chr1-151242178", + "observed_before_sampling": { + "alt": 4, + "other": 2, + "ref": 55, + "uncallable": 34 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "PIP5K1A-chr1-151242178" + }, + { + "allele": [ + "chr3", + 64198863, + "C", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.PRICKLE2-chr3-64198863", + "observed_before_sampling": { + "alt": 13, + "other": 0, + "ref": 28, + "uncallable": 0 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "PRICKLE2-chr3-64198863" + }, + { + "allele": [ + "chr1", + 151185547, + "T", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.VPS72-chr1-151185547", + "observed_before_sampling": { + "alt": 90, + "other": 24, + "ref": 2484, + "uncallable": 109 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "VPS72-chr1-151185547" + }, + { + "allele": [ + "chr1", + 23362762, + "G", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT.tagged.ZNF436-chr1-23362762", + "observed_before_sampling": { + "alt": 3, + "other": 2, + "ref": 24, + "uncallable": 5 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF436-chr1-23362762" + }, + { + "allele": [ + "chr14", + 101980529, + "G", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.DYNC1H1-chr14-101980529", + "observed_before_sampling": { + "alt": 887, + "other": 6, + "ref": 1946, + "uncallable": 38 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "DYNC1H1-chr14-101980529" + }, + { + "allele": [ + "chr7", + 133274996, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.EXOC4-chr7-133274996", + "observed_before_sampling": { + "alt": 131, + "other": 4, + "ref": 905, + "uncallable": 7 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "EXOC4-chr7-133274996" + }, + { + "allele": [ + "chr9", + 3856149, + "CTGATGTGG", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.GLIS3-chr9-3856149", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 2 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "GLIS3-chr9-3856149" + }, + { + "allele": [ + "chr9", + 133057893, + "GGAGGAGGAGGAA", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.GTF3C5-chr9-133057893", + "observed_before_sampling": { + "alt": 117, + "other": 23, + "ref": 291, + "uncallable": 64 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "GTF3C5-chr9-133057893" + }, + { + "allele": [ + "chr6", + 26055824, + "ACCTTGGGCTTAGCGG", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.H1_2-chr6-26055824", + "observed_before_sampling": { + "alt": 740, + "other": 243, + "ref": 3095, + "uncallable": 41 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "H1_2-chr6-26055824" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 0, + "other": 8, + "ref": 630, + "uncallable": 24 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr2", + 209694768, + "CCTGGGCTACTGTGTGTTCAATAAGTACACAGT", + "CAGGG" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.MAP2-chr2-209694768", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 22 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694768" + }, + { + "allele": [ + "chr2", + 209694772, + "GGCTACTGTGTGTTCAATAAGTACACAGT", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.MAP2-chr2-209694772", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 22 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694772" + }, + { + "allele": [ + "chrM", + 12994, + "G", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.MT_ND5-chrM-12994", + "observed_before_sampling": { + "alt": 5612, + "other": 30, + "ref": 11574, + "uncallable": 6161 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "MT_ND5-chrM-12994" + }, + { + "allele": [ + "chr17", + 75589953, + "GC", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.MYO15B-chr17-75589953", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 6, + "uncallable": 3 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "MYO15B-chr17-75589953" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 6, + "uncallable": 30 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr12", + 5494381, + "A", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.NTF3-chr12-5494381", + "observed_before_sampling": { + "alt": 4, + "other": 0, + "ref": 4, + "uncallable": 1 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr12", + 5494381, + "AG", + "GT" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.NTF3-chr12-5494381-compound", + "observed_before_sampling": { + "alt": 4, + "other": 0, + "ref": 4, + "uncallable": 1 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr1", + 151242178, + "AG", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_ONT_dedup.PIP5K1A-chr1-151242178", + "observed_before_sampling": { + "alt": 3, + "other": 1, + "ref": 36, + "uncallable": 17 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "PIP5K1A-chr1-151242178" + }, + { + "allele": [ + "chr9", + 3856149, + "CTGATGTGG", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.GLIS3-chr9-3856149", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 0, + "uncallable": 0 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "GLIS3-chr9-3856149" + }, + { + "allele": [ + "chr9", + 133057893, + "GGAGGAGGAGGAA", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.GTF3C5-chr9-133057893", + "observed_before_sampling": { + "alt": 19, + "other": 2, + "ref": 46, + "uncallable": 10 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "GTF3C5-chr9-133057893" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 220, + "uncallable": 5 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chrM", + 12994, + "G", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.MT_ND5-chrM-12994", + "observed_before_sampling": { + "alt": 1294, + "other": 1, + "ref": 2570, + "uncallable": 1288 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "MT_ND5-chrM-12994" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 18, + "uncallable": 11 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr12", + 5494381, + "A", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.NTF3-chr12-5494381", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 1, + "uncallable": 0 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr12", + 5494381, + "AG", + "GT" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.NTF3-chr12-5494381-compound", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 1, + "uncallable": 0 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "NTF3-chr12-5494381" + }, + { + "allele": [ + "chr17", + 80327830, + "ATAC", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T1_sclrs_live_pbmm2_mapped.RNF213-chr17-80327830", + "observed_before_sampling": { + "alt": 2, + "other": 0, + "ref": 34, + "uncallable": 4 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "target_assembly": "GRCh38", + "variant_id": "RNF213-chr17-80327830" + }, + { + "allele": [ + "chr3", + 15645183, + "T", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.BTD-chr3-15645183", + "observed_before_sampling": { + "alt": 23, + "other": 2, + "ref": 160, + "uncallable": 16 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "BTD-chr3-15645183" + }, + { + "allele": [ + "chr6", + 73818405, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.CD109-chr6-73818405", + "observed_before_sampling": { + "alt": 52, + "other": 0, + "ref": 105, + "uncallable": 6 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "CD109-chr6-73818405" + }, + { + "allele": [ + "chr1", + 173811223, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.CENPL-chr1-173811223", + "observed_before_sampling": { + "alt": 43, + "other": 2, + "ref": 237, + "uncallable": 33 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "CENPL-chr1-173811223" + }, + { + "allele": [ + "chr6", + 26055824, + "ACCTTGGGCTTAGCGG", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.H1_2-chr6-26055824", + "observed_before_sampling": { + "alt": 3461, + "other": 1213, + "ref": 16807, + "uncallable": 208 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "H1_2-chr6-26055824" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 18, + "uncallable": 49 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr9", + 70298024, + "G", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.SMC5-chr9-70298024", + "observed_before_sampling": { + "alt": 103, + "other": 1, + "ref": 993, + "uncallable": 41 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "SMC5-chr9-70298024" + }, + { + "allele": [ + "chr1", + 151185547, + "T", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.VPS72-chr1-151185547", + "observed_before_sampling": { + "alt": 177, + "other": 10, + "ref": 1810, + "uncallable": 80 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "VPS72-chr1-151185547" + }, + { + "allele": [ + "chr16", + 30557995, + "C", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT.tagged.ZNF764-chr16-30557995", + "observed_before_sampling": { + "alt": 66, + "other": 6, + "ref": 540, + "uncallable": 29 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF764-chr16-30557995" + }, + { + "allele": [ + "chr6", + 73818405, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT_dedup.CD109-chr6-73818405", + "observed_before_sampling": { + "alt": 49, + "other": 0, + "ref": 95, + "uncallable": 5 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "CD109-chr6-73818405" + }, + { + "allele": [ + "chr9", + 3856149, + "CTGATGTGG", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT_dedup.GLIS3-chr9-3856149", + "observed_before_sampling": { + "alt": 0, + "other": 1, + "ref": 1, + "uncallable": 2 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "GLIS3-chr9-3856149" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT_dedup.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 10, + "other": 9, + "ref": 1381, + "uncallable": 37 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr2", + 209694768, + "CCTGGGCTACTGTGTGTTCAATAAGTACACAGT", + "CAGGG" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT_dedup.MAP2-chr2-209694768", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 0, + "uncallable": 31 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694768" + }, + { + "allele": [ + "chr2", + 209694772, + "GGCTACTGTGTGTTCAATAAGTACACAGT", + "G" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT_dedup.MAP2-chr2-209694772", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 0, + "uncallable": 32 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694772" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T2_sclrs_ONT_dedup.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 16, + "uncallable": 46 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T3_sclrs_ONT.tagged.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 1, + "uncallable": 2 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT.tagged.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_T3_sclrs_ONT_dedup.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 1, + "uncallable": 1 + }, + "samples": [ + "T3_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT_dedup/IPISRC044_T3_sclrs_ONT_dedup.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T0_personalis_rna.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 22, + "uncallable": 3 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/rna/IPISRC044_tumor_T0_personalis_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr9", + 3856149, + "CTGATGTGG", + "C" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T1_ucla_rna.md.GLIS3-chr9-3856149", + "observed_before_sampling": { + "alt": 0, + "other": 13, + "ref": 36, + "uncallable": 16 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "GLIS3-chr9-3856149" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T1_ucla_rna.md.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 0, + "other": 2, + "ref": 1111, + "uncallable": 14 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr2", + 209694768, + "CCTGGGCTACTGTGTGTTCAATAAGTACACAGT", + "CAGGG" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T1_ucla_rna.md.MAP2-chr2-209694768", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 8, + "uncallable": 70 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694768" + }, + { + "allele": [ + "chr2", + 209694772, + "GGCTACTGTGTGTTCAATAAGTACACAGT", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T1_ucla_rna.md.MAP2-chr2-209694772", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 8, + "uncallable": 64 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694772" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T1_ucla_rna.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 55, + "uncallable": 21 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr14", + 55627965, + "G", + "GTT" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T2_ucla_rna.md.KTN1-chr14-55627965", + "observed_before_sampling": { + "alt": 4, + "other": 0, + "ref": 612, + "uncallable": 10 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/rna/IPISRC044_tumor_T2_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "KTN1-chr14-55627965" + }, + { + "allele": [ + "chr2", + 209694768, + "CCTGGGCTACTGTGTGTTCAATAAGTACACAGT", + "CAGGG" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T2_ucla_rna.md.MAP2-chr2-209694768", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 3, + "uncallable": 15 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/rna/IPISRC044_tumor_T2_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694768" + }, + { + "allele": [ + "chr2", + 209694772, + "GGCTACTGTGTGTTCAATAAGTACACAGT", + "G" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T2_ucla_rna.md.MAP2-chr2-209694772", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 3, + "uncallable": 14 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/rna/IPISRC044_tumor_T2_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "MAP2-chr2-209694772" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "IPISRC044_tumor_T2_ucla_rna.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 13, + "uncallable": 7 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/rna/IPISRC044_tumor_T2_ucla_rna.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chrM", + 12995, + "G", + "A" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "P116686_3.MT_ND5-chrM-12994-hg19", + "observed_before_sampling": { + "alt": 6048, + "other": 39, + "ref": 1541, + "uncallable": 337 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/cegat/P116686_2_S000048/P116686_3.bam", + "target_assembly": "GRCh37", + "variant_id": "MT_ND5-chrM-12994" + }, + { + "allele": [ + "chr15", + 96875528, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "P116686_3.NR2F2-chr15-96332299-GRCh37", + "observed_before_sampling": { + "alt": 7, + "other": 0, + "ref": 69, + "uncallable": 1 + }, + "samples": [ + "T0_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/cegat/P116686_2_S000048/P116686_3.bam", + "target_assembly": "GRCh37", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "SARC0277.Aligned.sortedByCoord.out.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 13, + "uncallable": 12 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/SARC0277/SARC0277.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "T1.sample_alignments.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 69, + "uncallable": 21 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T1/outs/per_sample_outs/T1/sample_alignments.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "T2.sample_alignments.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 61, + "uncallable": 32 + }, + "samples": [ + "T2_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T2/outs/per_sample_outs/T2/sample_alignments.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr6", + 73818405, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "T2_sample_alignments.CD109-chr6-73818405", + "observed_before_sampling": { + "alt": 26, + "other": 0, + "ref": 53, + "uncallable": 8 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ucsf/T2/illumina_bams/T2_sample_alignments.bam", + "target_assembly": "GRCh38", + "variant_id": "CD109-chr6-73818405" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "T3.sample_alignments.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 2, + "uncallable": 4 + }, + "samples": [ + "T3_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T3/outs/per_sample_outs/T3/sample_alignments.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "T3_CD45neg.sample_alignments.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 261, + "uncallable": 264 + }, + "samples": [ + "T3_tumor_CD45neg" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T3_CD45neg/outs/per_sample_outs/T3_CD45neg/sample_alignments.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 4, + "uncallable": 3 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96332299, + "G", + "T" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "illumina_bams.June2024_pfo-004-SYS2.NR2F2-chr15-96332299", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 69, + "uncallable": 21 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ucsf/T1/illumina_bams/June2024_pfo-004-SYS2.bam", + "target_assembly": "GRCh38", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr1", + 151242178, + "AG", + "A" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "illumina_bams.June2024_pfo-004-SYS2.PIP5K1A-chr1-151242178", + "observed_before_sampling": { + "alt": 1, + "other": 0, + "ref": 134, + "uncallable": 50 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ucsf/T1/illumina_bams/June2024_pfo-004-SYS2.bam", + "target_assembly": "GRCh38", + "variant_id": "PIP5K1A-chr1-151242178" + }, + { + "allele": [ + "chr1", + 151185547, + "T", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "illumina_bams.June2024_pfo-004-SYS2.VPS72-chr1-151185547", + "observed_before_sampling": { + "alt": 31, + "other": 0, + "ref": 1072, + "uncallable": 103 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ucsf/T1/illumina_bams/June2024_pfo-004-SYS2.bam", + "target_assembly": "GRCh38", + "variant_id": "VPS72-chr1-151185547" + }, + { + "allele": [ + "chr1", + 23362762, + "G", + "C" + ], + "assay": "scrna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "illumina_bams.June2024_pfo-004-SYS2.ZNF436-chr1-23362762", + "observed_before_sampling": { + "alt": 12, + "other": 0, + "ref": 19, + "uncallable": 21 + }, + "samples": [], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ucsf/T1/illumina_bams/June2024_pfo-004-SYS2.bam", + "target_assembly": "GRCh38", + "variant_id": "ZNF436-chr1-23362762" + }, + { + "allele": [ + "chr15", + 96875528, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "vendor.TL-24-ALMY2X4KMV_T_sorted.NR2F2-chr15-96332299-GRCh37", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 4, + "uncallable": 0 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/tempus/TL-24-ALMY2X4KMV/RNA/TL-24-ALMY2X4KMV_T_sorted.bam", + "target_assembly": "GRCh37", + "variant_id": "NR2F2-chr15-96332299" + }, + { + "allele": [ + "chr15", + 96875528, + "G", + "T" + ], + "assay": "rna-seq", + "bundle": "openvax-v2", + "interpretation": "Full-region template classifier counts from the published bundle recipe; not quality-filtered allele read counts.", + "manifest_sha256": "b42dbce529cb5724153f035fca3783a41e673b31610a30851b2ef96d4ba43734", + "member": "vendor.TL-24-KCVBE1UI1P_T_sorted.NR2F2-chr15-96332299-GRCh37", + "observed_before_sampling": { + "alt": 0, + "other": 0, + "ref": 4, + "uncallable": 0 + }, + "samples": [ + "T1_tumor" + ], + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/tempus/TL-24-KCVBE1UI1P/RNA/TL-24-KCVBE1UI1P_T_sorted.bam", + "target_assembly": "GRCh37", + "variant_id": "NR2F2-chr15-96332299" + } +] diff --git a/tests/data/comprehensive/inputs.json.gz b/tests/data/comprehensive/inputs.json.gz new file mode 100644 index 0000000..d2be857 Binary files /dev/null and b/tests/data/comprehensive/inputs.json.gz differ diff --git a/tests/data/comprehensive/spec.json b/tests/data/comprehensive/spec.json new file mode 100644 index 0000000..68ef42f --- /dev/null +++ b/tests/data/comprehensive/spec.json @@ -0,0 +1,555 @@ +{ + "description": "Comprehensive vaccine and longitudinal RNA test corpus, with all catalog variants, RNA-negative DNA-positive SNVs, and structural regressions. Candidate build; not published.", + "id": "openvax-v3", + "redistribution": { + "license": "CC0-1.0", + "source": "https://registry.opendata.aws/sid-osteosarc/" + }, + "selection": { + "caps": { + "alt": 20, + "other": 5, + "ref": 10, + "uncallable": 2 + }, + "low_quality_alt": 2, + "split_depth": 1000000, + "split_regions": 2000, + "structural": { + "cap": 50, + "window": 1000 + }, + "supplementary": true, + "unplaced_mates": false + }, + "snapshot": { + "id": "efb65d4b683bda162879c86c0ea889afcc64704b5228224c061109f306503b91", + "name": "2026-09-28" + }, + "sources": { + "all_targets": [ + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT_dedup/IPISRC044_T3_sclrs_ONT_dedup.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek24_bostongene/alignment/preprocessing/recalibrated/normal_bg24/normal_bg24.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek24_bostongene/alignment/preprocessing/recalibrated/tumor_bg24/tumor_bg24.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek_bostongene22/sarek_bostongene22_alignment/alignment/preprocessing/recalibrated/normal_bg22/normal_bg22.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek_bostongene22/sarek_bostongene22_alignment/alignment/preprocessing/recalibrated/tumor_bg22/tumor_bg22.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/dna/IPISRC044_normal_personalis.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/dna/IPISRC044_tumor_T0_personalis.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/rna/IPISRC044_tumor_T0_personalis_rna.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_organoid_ucla/alignments/dna/IPISRC044_normal_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_organoid_ucla/alignments/dna/IPISRC044_tumor_T1_organoid_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/dna/IPISRC044_normal_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/dna/IPISRC044_tumor_T1_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/dna/IPISRC044_normal_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/dna/IPISRC044_tumor_T2_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/rna/IPISRC044_tumor_T2_ucla_rna.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T1/outs/per_sample_outs/T1/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T2/outs/per_sample_outs/T2/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T3/outs/per_sample_outs/T3/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T3_CD45neg/outs/per_sample_outs/T3_CD45neg/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/SARC0277/SARC0277.Aligned.sortedByCoord.out.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam" + ], + "structural": [ + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT/IPISRC044_T1_sclrs_ONT_dedup/IPISRC044_T1_sclrs_ONT_dedup.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT/IPISRC044_T2_sclrs_ONT_dedup/IPISRC044_T2_sclrs_ONT_dedup.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/ONT/IPISRC044_ONT_upload/IPISRC044_ONT/processed/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT/IPISRC044_T3_sclrs_ONT_dedup/IPISRC044_T3_sclrs_ONT_dedup.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-bulk/2025.01.06/RNA/2025.01.06.rna.ucla-core/processed/STAR/25.03.23.rna.ucla.2025.01.resection.tcga.d32.protocolAligned.sorted.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek24_bostongene/alignment/preprocessing/recalibrated/normal_bg24/normal_bg24.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek24_bostongene/alignment/preprocessing/recalibrated/tumor_bg24/tumor_bg24.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek_bostongene22/sarek_bostongene22_alignment/alignment/preprocessing/recalibrated/normal_bg22/normal_bg22.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/genomics/genomics-duplicates/sarek_bostongene22/sarek_bostongene22_alignment/alignment/preprocessing/recalibrated/tumor_bg22/tumor_bg22.recal.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/dna/IPISRC044_normal_personalis.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/dna/IPISRC044_tumor_T0_personalis.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T0_personalis/alignments/rna/IPISRC044_tumor_T0_personalis_rna.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_organoid_ucla/alignments/dna/IPISRC044_normal_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_organoid_ucla/alignments/dna/IPISRC044_tumor_T1_organoid_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/dna/IPISRC044_normal_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/dna/IPISRC044_tumor_T1_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T1_ucla/alignments/rna/IPISRC044_tumor_T1_ucla_rna.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/dna/IPISRC044_normal_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/dna/IPISRC044_tumor_T2_ucla.redux.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/oncoanalyser/IPISRC044_T2_ucla/alignments/rna/IPISRC044_tumor_T2_ucla_rna.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T1/outs/per_sample_outs/T1/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T2/outs/per_sample_outs/T2/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T3/outs/per_sample_outs/T3/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/kamil/tumor/output/T3_CD45neg/outs/per_sample_outs/T3_CD45neg/sample_alignments.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/pacbio/IPISRC044_T1_sclrs_live_pbmm2_mapped.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG009368/BG009368.Aligned.sortedByCoord.out.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/SARC0277/SARC0277.Aligned.sortedByCoord.out.md.bam", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam" + ] + }, + "targets": { + "catalog": "all", + "extra": [ + { + "alt": "C", + "assembly": "GRCh38", + "contig": "chr2", + "label": "historical", + "name": "MAP2-chr2-209694768-historical", + "position": 209694768, + "reason": "The site's allele before the allele-MAP2-chr2-209694768 correction; the libraries' tests still use it.", + "ref": "CCTGGGCTACTGTGTGTTCAATA", + "used_by": [ + "isovar", + "topiary", + "vaxrank" + ], + "variant_id": "MAP2-chr2-209694768" + }, + { + "alt": "T", + "assembly": "GRCh37", + "contig": "chr15", + "label": "native_grch37", + "name": "NR2F2-chr15-96332299-GRCh37", + "position": 96875528, + "reason": "The catalog allele at its GRCh37 position, for GRCh37 BAMs.", + "ref": "G", + "used_by": [ + "isovar", + "vaxrank" + ], + "variant_id": "NR2F2-chr15-96332299" + }, + { + "alt": "A", + "assembly": "GRCh37", + "contig": "chrM", + "label": "mitochondrial", + "name": "MT_ND5-chrM-12994-hg19", + "position": 12995, + "reason": "The catalog allele on hg19's chrM (16571 bases), as CeGaT's BAMs use.", + "ref": "G", + "reference_length": 16571, + "used_by": [ + "isovar", + "vaxrank" + ], + "variant_id": "MT_ND5-chrM-12994" + }, + { + "alt": "A", + "assembly": "GRCh37", + "contig": "MT", + "label": "mitochondrial", + "name": "MT_ND5-chrM-12994-GRCh37", + "position": 12994, + "reason": "The catalog allele on GRCh37's MT (the revised Cambridge sequence), as Tempus's BAMs use.", + "ref": "G", + "reference_length": 16569, + "used_by": [ + "isovar", + "vaxrank" + ], + "variant_id": "MT_ND5-chrM-12994" + }, + { + "alt": "GT", + "assembly": "GRCh38", + "contig": "chr12", + "label": "library_allele", + "name": "NTF3-chr12-5494381-compound", + "position": 5494381, + "reason": "The catalog's A>G together with the next base's G>T, as one compound allele.", + "ref": "AG", + "used_by": [ + "isovar", + "vaxrank" + ], + "variant_id": "NTF3-chr12-5494381" + } + ], + "renamed": { + "CABLES1-chr18-23135500": "CABLES1-chr18-23135764", + "CCDC40-chr17-80058951": "CCDC40-chr17-80090148", + "DCHS2-chr4-154322488": "DCHS2-chr4-154323273", + "GAPVD1-chr9-125299105": "GAPVD1-chr9-125301980", + "GOLGA6L2-chr15-23441121": "GOLGA6L2-chr15-23440197", + "USH2A-chr1-215560752": "USH2A-chr1-215650752" + }, + "structural": [ + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr6", + "orientation": "-", + "position": 29612905, + "retained_side": "right" + }, + { + "contig": "chr6", + "orientation": "+", + "position": 44218907, + "retained_side": "right" + } + ], + "label": "fusion", + "name": "GABBR1--SLC29A1", + "reason": "Retained sides established from junction reads in openvax-v2; https://github.com/iskandr/osteosarc/issues/96. Original panel: GABBR1-SLC29A1", + "used_by": [ + "isovar", + "topiary", + "varcode" + ] + }, + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr15", + "orientation": "-", + "position": 31743669, + "retained_side": "right" + }, + { + "contig": "chr15", + "orientation": "+", + "position": 33043478, + "retained_side": "right" + } + ], + "label": "fusion", + "name": "OTUD7A--FMN1", + "reason": "Retained sides established from junction reads in openvax-v2; https://github.com/iskandr/osteosarc/issues/96. Original panel: OTUD7A-FMN1", + "used_by": [ + "isovar", + "topiary", + "varcode" + ] + }, + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr2", + "orientation": "+", + "position": 205310103, + "retained_side": "left" + }, + { + "contig": "chr9", + "orientation": "+", + "position": 22007647, + "retained_side": "right" + } + ], + "label": "fusion", + "name": "PARD3B--CDKN2B-AS1-CDKN2B", + "reason": "Retained sides established from junction reads in openvax-v2; https://github.com/iskandr/osteosarc/issues/96. Original panel: PARD3B-CDKN2B", + "used_by": [ + "isovar" + ] + }, + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr11", + "orientation": null, + "position": 118401717, + "retained_side": "left" + }, + { + "contig": "chr11", + "orientation": null, + "position": 118468774, + "retained_side": "right" + } + ], + "label": "fusion", + "name": "ATP5MG--KMT2A", + "reason": "Isovar's fusion junction boundaries (zero-based); the retained sides are where its junction reads align.", + "used_by": [ + "isovar", + "vaxrank" + ] + }, + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr6", + "orientation": null, + "position": 108611245, + "retained_side": "left" + }, + { + "contig": "chr17", + "orientation": null, + "position": 63745979, + "retained_side": "right" + } + ], + "label": "fusion", + "name": "FOXO3--STRADA-CCDC47", + "reason": "Isovar's fusion junction boundaries (zero-based); the retained sides are where its junction reads align.", + "used_by": [ + "isovar" + ] + }, + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr7", + "orientation": null, + "position": 66205522, + "retained_side": "left" + }, + { + "contig": "chr7", + "orientation": null, + "position": 66127703, + "retained_side": "right" + } + ], + "label": "fusion", + "name": "TPST1--CRCP", + "reason": "Isovar's fusion junction boundaries (zero-based); the retained sides are where its junction reads align.", + "used_by": [ + "isovar", + "vaxrank" + ] + }, + { + "from": { + "sv_candidates": "SV0172" + }, + "label": "fusion", + "name": "KLF15--PPIAP72", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "id": "SV0055", + "panel": "sv-regressions-v1" + }, + "label": "sv", + "name": "SV0055", + "reason": "osteosarc's sv-regressions-v1 panel.", + "used_by": [] + }, + { + "from": { + "id": "SV0175", + "panel": "sv-regressions-v1" + }, + "label": "sv", + "name": "SV0175", + "reason": "osteosarc's sv-regressions-v1 panel.", + "used_by": [] + }, + { + "from": { + "id": "SV0402", + "panel": "sv-regressions-v1" + }, + "label": "sv", + "name": "SV0402", + "reason": "osteosarc's sv-regressions-v1 panel.", + "used_by": [] + }, + { + "from": { + "id": "SV0461", + "panel": "sv-regressions-v1" + }, + "label": "sv", + "name": "SV0461", + "reason": "osteosarc's sv-regressions-v1 panel.", + "used_by": [] + }, + { + "from": { + "id": "SV0499", + "panel": "sv-regressions-v1" + }, + "label": "sv", + "name": "SV0499", + "reason": "osteosarc's sv-regressions-v1 panel.", + "used_by": [] + }, + { + "assembly": "GRCh38", + "breakends": [ + { + "contig": "chr10", + "orientation": null, + "position": 77850914, + "retained_side": "left" + }, + { + "contig": "chr10", + "orientation": null, + "position": 77930460, + "retained_side": "right" + } + ], + "inserted_sequence": "CTTCTCTGAAATGATGCTTCTCCA", + "label": "sv", + "name": "DLG5-deletion", + "reason": "Isovar's DLG5 deletion, at the junction esvee resolved (IPISRC044_tumor_T2_ucla records 26313 and 26315), with its 24-base insertion; DRAGEN's nominal breakends were chr10:77850921 and 77930452.", + "used_by": [ + "isovar" + ] + }, + { + "from": { + "sv_candidates": "SV0384" + }, + "label": "sv", + "name": "SV0384", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0324" + }, + "label": "sv", + "name": "SV0324", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0009" + }, + "label": "sv", + "name": "SV0009", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0030" + }, + "label": "sv", + "name": "SV0030", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0178" + }, + "label": "sv", + "name": "SV0178", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0186" + }, + "label": "sv", + "name": "SV0186", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0521" + }, + "label": "sv", + "name": "SV0521", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0522" + }, + "label": "sv", + "name": "SV0522", + "used_by": [ + "varcode" + ] + }, + { + "from": { + "sv_candidates": "SV0244" + }, + "label": "sv", + "name": "SV0244", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + }, + { + "from": { + "sv_candidates": "SV0281" + }, + "label": "sv", + "name": "SV0281", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + }, + { + "from": { + "sv_candidates": "SV0318" + }, + "label": "sv", + "name": "SV0318", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + }, + { + "from": { + "sv_candidates": "SV0357" + }, + "label": "sv", + "name": "SV0357", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + }, + { + "from": { + "sv_candidates": "SV0373" + }, + "label": "sv", + "name": "SV0373", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + }, + { + "from": { + "sv_candidates": "SV0381" + }, + "label": "sv", + "name": "SV0381", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + }, + { + "from": { + "sv_candidates": "SV0525" + }, + "label": "sv", + "name": "SV0525", + "reason": "Additional RNA-supported SV candidate: retains exact-allele and geometry evidence separately.", + "used_by": [] + } + ] + } +} diff --git a/tests/data/comprehensive/summary.json b/tests/data/comprehensive/summary.json new file mode 100644 index 0000000..18ea8d6 --- /dev/null +++ b/tests/data/comprehensive/summary.json @@ -0,0 +1,22 @@ +{ + "annotated_frameshifts": 12, + "count_sources": 37, + "negative_controls": 4, + "rna_count_sources": 15, + "samples": 21, + "source_summary_products": 71, + "source_summary_rows": 12638, + "statuses": { + "alt_observed": 2173, + "covered_no_alt": 3972, + "no_coverage": 903, + "not_measured": 259, + "other_only": 93, + "unresolved_allele": 74 + }, + "structural_candidates": 637, + "support_cells": 7474, + "vaccine_rows": 38, + "vaccine_variants": 51, + "variants": 202 +} diff --git a/tests/data/evidence-overlap/README.md b/tests/data/evidence-overlap/README.md new file mode 100644 index 0000000..5325666 --- /dev/null +++ b/tests/data/evidence-overlap/README.md @@ -0,0 +1,21 @@ +# Regional Tempus overlap evidence + +These two unmodified regional BAMs reproduce Osteosarc #100. Each contains reads +at the same 44 vaccine loci with 2,000-base flanks plus fetched mates. Original +acquisition receipts, remote identities, request regions and source URLs are in +`receipts.json`; the files are pinned in `osteosarc/data/evidence-overlaps.json`. +The original public source reads are CC0. + +Run `python -m pytest tests/test_provenance.py` to verify the inputs and reproduce +the comparison without network access. It counts record occurrences and includes +base qualities, while excluding optional tags such as differing RG labels. +There are 40,684 identical core records, 12 different records per BAM and 18,971 +shared read names. The files contain 40,696 records each. + +The result applies to these regions, not whole libraries. Both original RG/SM +labels remain intact. The full published FASTQ catalogue is also pinned here: it +explicitly describes KCVBE1UI1P as a duplicate delivery of ALMY2X4KMV RNA. The +registry records matching lengths and multipart ETags for the corresponding mate +objects; these are server metadata, not whole-file SHA-256 hashes. The biological +specimen/timepoint remains disputed by the existing `tempus-file-labels` curation. +Specimen documentation is still needed before relabeling it. diff --git a/tests/data/evidence-overlap/c75479dce2b07bbf.bam b/tests/data/evidence-overlap/c75479dce2b07bbf.bam new file mode 100644 index 0000000..a30807f Binary files /dev/null and b/tests/data/evidence-overlap/c75479dce2b07bbf.bam differ diff --git a/tests/data/evidence-overlap/e5c28abdbf307d55.bam b/tests/data/evidence-overlap/e5c28abdbf307d55.bam new file mode 100644 index 0000000..1d99e71 Binary files /dev/null and b/tests/data/evidence-overlap/e5c28abdbf307d55.bam differ diff --git a/tests/data/evidence-overlap/fastqs-consolidated.tsv b/tests/data/evidence-overlap/fastqs-consolidated.tsv new file mode 100644 index 0000000..f77c2f0 --- /dev/null +++ b/tests/data/evidence-overlap/fastqs-consolidated.tsv @@ -0,0 +1,296 @@ +display_name tissue timepoint sample_date sample_id provider analyst assay b2_folder s3_folder file_count total_size_bytes total_size_human is_primary is_superseded_by notes +T0 BostonGene Tumor RNA 2022-12 Tumor T0 2022-12 T0_tumor BostonGene RNA genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/fastqs 2 9932494899 9.25 GiB +T0 BostonGene Tumor RNA 2022-12 (rna-seq/fastq mirror) Tumor T0 2022-12 T0_tumor BostonGene RNA rna-seq/fastq/bostongene_2022 2 9932494899 9.25 GiB File lives under rna-seq/fastq/; may duplicate a genomics-bulk path +T0 Tempus Tumor RNA 2022-12 (rna-seq/fastq mirror) Tumor T0 2022-12 T0_tumor Tempus RNA rna-seq/fastq/tempus_2022 4 2616790154 2.44 GiB File lives under rna-seq/fastq/; may duplicate a genomics-bulk path +T0 BostonGene Tumor RNA 2022-12 (BG003082 vendor) Tumor T0 2022-12 T0_tumor BostonGene RNA vendor/bostongene/BG003082/RNASeq-tumor-A01231 4 11007830868 10.25 GiB As-delivered vendor FASTQ (untrimmed); the older catalog copy was adapter-trimmed before archiving. BAM is byte-identical to the catalog copy at genomics/genomics-bulk/2022.12.16/RNA/2022.12.16.rna.bostongene/processed_by_pfo/RNASeq-tumor.bam. +T0 CeGaT Tumor RNA 2022-12 (P116686_3 vendor) Tumor T0 2022-12 T0_tumor CeGaT RNA vendor/cegat/P116686_2_S000048/P116686_3 2 7210584452 6.72 GiB CeGaT tumor RNA (STAR 2.7.3a, hg19). Sequenced 2023-03-22 on the T0 material collected 2022-12-16. Files live under P116686_2_S000048/ despite the P116686_3 sample id. +T0 BostonGene Tumor WES 2022-12 Tumor T0 2022-12 T0_tumor BostonGene WES genomics/genomics-bulk/2022.12.16/DNA/2022.12.16.dna.bostongene.WES/fastqs/tumor 2 19465508018 18.13 GiB +T0 BostonGene Tumor WES 2022-12 (BG003082 vendor) Tumor T0 2022-12 T0_tumor BostonGene WES vendor/bostongene/BG003082/WES-tumor-A01231 4 22995318623 21.42 GiB As-delivered vendor FASTQ (untrimmed); the older catalog copy was adapter-trimmed before archiving. BAM is byte-identical to the catalog copy under genomics/genomics-bulk/2022.12.16/DNA/.../processed_by_pfo/. +T0 CeGaT Tumor WES 2022-12 (P116686_2 vendor) Tumor T0 2022-12 T0_tumor CeGaT WES vendor/cegat/P116686_2_S000048/P116686_2 2 13089275642 12.19 GiB CeGaT tumor DNA (exome kit S000048, hg19). Sequenced 2023-03-22 on the T0 material collected 2022-12-16. Ships _somatic.tsv; source data for the CeGaT neoantigen vaccine. +T0 Personalis Tumor WGS 2022-12 Tumor T0 2022-12 T0_tumor Personalis WGS genomics/genomics-bulk/2022.12.16/DNA/2022.12.16.dna.personalis.WGS/fastqs/tumor 6 98817732608 92.03 GiB +T0 BostonGene Blood WES 2022-12 Blood T0 2022-12 T0_blood BostonGene WES genomics/genomics-bulk/2022.12.16/DNA/2022.12.16.dna.bostongene.WES/fastqs/normal-blood 2 9864267107 9.19 GiB +T0 BostonGene Blood WES 2022-12 (BG003082 vendor) Blood T0 2022-12 T0_blood BostonGene WES vendor/bostongene/BG003082/WES-normal-A01231 4 11678164961 10.88 GiB As-delivered vendor FASTQ (untrimmed); the older catalog copy was adapter-trimmed before archiving. BAM is byte-identical to the catalog copy under genomics/genomics-bulk/2022.12.16/DNA/.../processed_by_pfo/. +T0 BostonGene Blood WES 2022-12 (BG009368 vendor, re-delivered T0 normal) Blood T0 2022-12 T0_blood BostonGene WES vendor/bostongene/BG009368/WES-normal-A01231 4 11678164961 10.88 GiB As-delivered vendor FASTQ (untrimmed); the older catalog copy was adapter-trimmed before archiving. FASTQs are byte-identical to vendor/bostongene/BG003082/WES-normal-A01231 (run 539/HJ3NCDMXY); BostonGene reused the T0 germline normal for the T1 order. The BAM differs slightly -- it was re-aligned for this order. +T0 CeGaT Blood WES 2022-12 (P116686_1 vendor) Blood T0 2022-12 T0_blood CeGaT WES vendor/cegat/P116686_1_S000048/P116686_1 2 11321968597 10.54 GiB CeGaT normal DNA (exome kit S000048, hg19, chrY PAR masked). Sequenced 2023-03-22 on the T0 material collected 2022-12-16. Source data for the CeGaT peptide neoantigen vaccine. +T0 Personalis Blood WGS 2022-12 Blood T0 2022-12 T0_blood Personalis WGS genomics/genomics-bulk/2022.12.16/DNA/2022.12.16.dna.personalis.WGS/fastqs/normal-blood 8 99411928768 92.58 GiB +T1 BostonGene Tumor RNA 2024-06 (rna-seq/fastq mirror) Tumor T1 2024-06 T1_tumor BostonGene RNA rna-seq/fastq/bostongene_2024 2 8244946583 7.68 GiB File lives under rna-seq/fastq/; may duplicate a genomics-bulk path +T1 Tempus Tumor RNA 2024-06 (TL-24-ALMY2X4KMV) Tumor T1 2024-06 T1_tumor Tempus RNA rna-seq/tempus/TL-24-ALMY2X4KMV/RNA 2 1238829178 1.15 GiB Tempus ID: TL-24-ALMY2X4KMV +T1 BostonGene Tumor RNA 2024-06 (BG009368 vendor) Tumor T1 2024-06 T1_tumor BostonGene RNA vendor/bostongene/BG009368/RNASeq-tumor-A01231 8 9240081148 8.61 GiB As-delivered vendor FASTQ (untrimmed); the older catalog copy was adapter-trimmed before archiving. +T1 Tempus Tumor RNA 2024-06 (TL-24-ALMY2X4KMV vendor) Tumor T1 2024-06 T1_tumor Tempus RNA vendor/tempus/TL-24-ALMY2X4KMV/RNA/FastQ 2 1377960976 1.28 GiB RNA mates are _1/_3 (_2 was the index read). Byte-identical to the catalog copy under rna-seq/tempus/TL-24-ALMY2X4KMV/RNA/. +T1 Tempus Tumor RNA 2024-06 (TL-24-KCVBE1UI1P vendor) Tumor T1 2024-06 T1_tumor Tempus RNA vendor/tempus/TL-24-KCVBE1UI1P/RNA/FastQ 2 1377960976 1.28 GiB Duplicate delivery of TL-24-ALMY2X4KMV RNA -- identical content, different md5 sidecars because they were hashed after renaming. Do not count as an independent library. +T1 BostonGene Tumor WES 2024-06 Tumor T1 2024-06 T1_tumor BostonGene WES genomics/genomics-bulk/2024.06.06/DNA/2024.06.06.dna.bostongene.WES/raw/tumor 2 16907199063 15.75 GiB +T1 BostonGene Tumor WES 2024-06 (BG009368 vendor) Tumor T1 2024-06 T1_tumor BostonGene WES vendor/bostongene/BG009368/WES-tumor-A01231 8 20080114801 18.70 GiB As-delivered vendor FASTQ (untrimmed); the older catalog copy was adapter-trimmed before archiving. +T1 Tempus Tumor WES 2024-06 (TL-24-5GQLV9WSXQ vendor) Tumor T1 2024-06 T1_tumor Tempus WES vendor/tempus/TL-24-5GQLV9WSXQ/DNA/FastQ 2 7916872819 7.37 GiB Byte-identical to the catalog copy under rna-seq/tempus/TL-24-5GQLV9WSXQ/wes/. The sibling .tar.gz repackages these same FASTQs and is not counted here. +T1 Tempus Tumor WES 2024-06 (TL-24-ALMY2X4KMV vendor) Tumor T1 2024-06 T1_tumor Tempus WES vendor/tempus/TL-24-ALMY2X4KMV/DNA/FastQ/T 2 15470759019 14.41 GiB Byte-identical to the catalog copy under rna-seq/tempus/TL-24-ALMY2X4KMV/WES/. Tumor and normal share one FastQ/ directory, so the row key appends /T. +T1 UCLA Tumor WGS 2024-06 Tumor T1 2024-06 T1_tumor UCLA WGS genomics/genomics-bulk/2024.06.06/DNA/2024.06.06.dna.WGS/raw/tumor 2 184092873973 171.45 GiB +T1 UCSF Tumor scRNA_BCR 2024-06 Tumor T1 2024-06 T1_tumor UCSF scRNA_BCR ucsf/T1/FASTQ/IPISRC044_T1_BCR 4 7748503985 7.22 GiB +T1 UCSF Tumor scRNA_GEX 2024-06 Tumor T1 2024-06 T1_tumor UCSF scRNA_GEX ucsf/T1/FASTQ/IPISRC044_T1_SCG1 4 36867288457 34.34 GiB +T1 UCSF Tumor scRNA_ONT 2024-06 Tumor T1 2024-06 T1_tumor UCSF scRNA_ONT ONT/IPISRC044_ONT_upload/IPISRC044_ONT/fastqs/IPISRC044_T1_ONT_fastqs/fastq_pass 97 223398075228 208.06 GiB fastq_pass (basecaller-passing reads only) +T1 UCSF Tumor scRNA_TCR 2024-06 Tumor T1 2024-06 T1_tumor UCSF scRNA_TCR ucsf/T1/FASTQ/IPISRC044_T1_TCR 4 7413145524 6.90 GiB +T1 Tempus Blood WES 2024-06 (TL-24-ALMY2X4KMV vendor) Blood T1 2024-06 T1_blood Tempus WES vendor/tempus/TL-24-ALMY2X4KMV/DNA/FastQ/N 2 9202603169 8.57 GiB Byte-identical to the catalog copy under rna-seq/tempus/TL-24-ALMY2X4KMV/WES/. Tumor and normal share one FastQ/ directory, so the row key appends /N. +T1 UCLA Blood WGS 2024-06 Blood T1 2024-06 T1_blood UCLA WGS genomics/genomics-bulk/2024.06.06/DNA/2024.06.06.dna.WGS/raw/normal-blood 2 115047855715 107.15 GiB +T1 UCLA Organoid WGS 2024-06 Organoid T1 2024-06 T1_organoid UCLA WGS genomics/genomics-bulk/2024.06.06/DNA/2024.06.06.dna.WGS/raw/organoid 2 184798645644 172.11 GiB +T1 Tempus WES 2024-06 (TL-24-5GQLV9WSXQ) T1 2024-06 Tempus WES rna-seq/tempus/TL-24-5GQLV9WSXQ/wes 2 7916872819 7.37 GiB Tempus ID: TL-24-5GQLV9WSXQ; contains both normal and tumor reads +T1 Tempus WES 2024-06 (TL-24-ALMY2X4KMV) T1 2024-06 Tempus WES rna-seq/tempus/TL-24-ALMY2X4KMV/WES 4 24673362188 22.98 GiB Tempus ID: TL-24-ALMY2X4KMV; contains both normal and tumor reads +T2 UCSF Tumor CITE 2025-01 Tumor T2 2025-01 T2_tumor UCSF CITE ucsf/T2/FASTQ/IPISRC044_T2_ADT 4 8328124220 7.76 GiB +T2 UCLA Tumor RNA 2025-01 (rna-seq/fastq mirror) Tumor T2 2025-01 T2_tumor UCLA RNA rna-seq/fastq/ucla_2025 2 10195778897 9.50 GiB File lives under rna-seq/fastq/; may duplicate a genomics-bulk path +T2 UCLA Tumor WGS 2025-01 Tumor T2 2025-01 T2_tumor UCLA WGS genomics/genomics-bulk/2025.01.06/DNA/2025.01.06.dna.WGS/fastqs/tumor 2 273883526194 255.07 GiB +T2 UCSF Tumor scRNA_BCR 2025-01 Tumor T2 2025-01 T2_tumor UCSF scRNA_BCR ucsf/T2/FASTQ/IPISRC044_T2_BCR 4 27483044748 25.60 GiB +T2 UCSF Tumor scRNA_GEX 2025-01 Tumor T2 2025-01 T2_tumor UCSF scRNA_GEX ucsf/T2/FASTQ/IPISRC044_T2_SCG1 4 38407017555 35.77 GiB +T2 UCSF Tumor scRNA_ONT 2025-01 Tumor T2 2025-01 T2_tumor UCSF scRNA_ONT ONT/IPISRC044_ONT_upload/IPISRC044_ONT/fastqs/IPISRC044_T2_ONT_fastqs/fastq_pass 97 226587432501 211.03 GiB fastq_pass (basecaller-passing reads only) +T2 UCSF Tumor scRNA_TCR 2025-01 Tumor T2 2025-01 T2_tumor UCSF scRNA_TCR ucsf/T2/FASTQ/IPISRC044_T2_TCR 4 21961800745 20.45 GiB +T3 UCSF Tumor CITE 2025-04 Tumor T3 2025-04 T3_tumor UCSF CITE ucsf/T3/FASTQ/IPISRC044_T3_ADT 4 15385452822 14.33 GiB +T3 UCSF Tumor scRNA_BCR 2025-04 Tumor T3 2025-04 T3_tumor UCSF scRNA_BCR ucsf/T3/FASTQ/IPISRC044_T3_BCR 4 14241098983 13.26 GiB +T3 UCSF Tumor scRNA_GEX 2025-04 (CD45neg) Tumor T3 2025-04 T3_tumor_CD45neg UCSF scRNA_GEX ucsf/T3/FASTQ/IPISRC044_T3_CD45neg_enriched_illumina 4 60828949243 56.65 GiB CD45-negative enriched fraction +T3 UCSF Tumor scRNA_GEX 2025-04 Tumor T3 2025-04 T3_tumor UCSF scRNA_GEX ucsf/T3/FASTQ/IPISRC044_T3_SCG1 4 49059849784 45.69 GiB +T3 UCSF Tumor scRNA_ONT 2025-04 Tumor T3 2025-04 T3_tumor UCSF scRNA_ONT ONT/IPISRC044_ONT_upload/IPISRC044_ONT/fastqs/IPISRC044_T3_ONT_fastqs/fastq_pass 97 234568053243 218.46 GiB fastq_pass (basecaller-passing reads only) +T3 UCSF Tumor scRNA_TCR 2025-04 Tumor T3 2025-04 T3_tumor UCSF scRNA_TCR ucsf/T3/FASTQ/IPISRC044_T3_TCR 4 12049925463 11.22 GiB +Hudson Lab Blood scRNA_GEX 2025-01-25 (Pool 1) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/GEX/Pool 1 4 115167845143 107.26 GiB Pool 1 +Hudson Lab Blood scRNA_GEX 2025-01-25 (Pool 2) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/GEX/Pool 2 4 101004472711 94.07 GiB Pool 2 +Hudson Lab Blood scRNA_GEX 2025-01-25 (Pool 3) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/GEX/Pool 3 4 82472131104 76.81 GiB Pool 3 +Hudson Lab Blood scRNA_TCR 2025-01-25 (Pool 1) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/TCRab/Pool 1 4 18485394427 17.22 GiB Pool 1 +Hudson Lab Blood scRNA_TCR 2025-01-25 (Pool 2) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/TCRab/Pool 2 4 15196323187 14.15 GiB Pool 2 +Hudson Lab Blood scRNA_TCR 2025-01-25 (Pool 3) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/TCRab/Pool 3 4 5824955107 5.42 GiB Pool 3 +Hudson Lab Blood scRNA_TCRgd 2025-01-25 (Pool 1) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/TCRgd/Pool 1 4 739602996 705.34 MiB Pool 1 +Hudson Lab Blood scRNA_TCRgd 2025-01-25 (Pool 2) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/TCRgd/Pool 2 4 845177047 806.02 MiB Pool 2 +Hudson Lab Blood scRNA_TCRgd 2025-01-25 (Pool 3) Blood 2025-01-25 blood_2025-01-25 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Jan2025 (250125)/TCRgd/Pool 3 4 714322343 681.23 MiB Pool 3 +Hudson Lab Blood scRNA_GEX 2025-04-09 (Pool 1) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/GEX/Pool 1 4 37180381868 34.63 GiB Pool 1 +Hudson Lab Blood scRNA_GEX 2025-04-09 (Pool 2) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/GEX/Pool 2 4 139287184572 129.72 GiB Pool 2 +Hudson Lab Blood scRNA_GEX 2025-04-09 (Pool 3) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/GEX/Pool 3 4 136438719895 127.07 GiB Pool 3 +Hudson Lab Blood scRNA_GEX 2025-04-09 (Pool 4) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/GEX/Pool 4 4 130326321507 121.38 GiB Pool 4 +Hudson Lab Blood scRNA_GEX 2025-04-09 (Pool 5) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/GEX/Pool 5 4 144267820951 134.36 GiB Pool 5 +Hudson Lab Blood scRNA_TCR 2025-04-09 (Pool 1) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/TCRab/Pool 1 4 16245753768 15.13 GiB Pool 1 +Hudson Lab Blood scRNA_TCR 2025-04-09 (Pool 2) Blood 2025-04-09 blood_2025-04-09 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Apr2025 (250409)/TCRab/Pool 2 4 13119839605 12.22 GiB Pool 2 +Hudson Lab Blood CITE 2025-05-01 (Pool1) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/CITEseq/Pool1 2 18769228997 17.48 GiB Pool1 +Hudson Lab Blood CITE 2025-05-01 (Pool2) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/CITEseq/Pool2 2 23866559699 22.23 GiB Pool2 +Hudson Lab Blood CITE 2025-05-01 (Pool3) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/CITEseq/Pool3 2 27878025971 25.96 GiB Pool3 +Hudson Lab Blood CITE 2025-05-01 (Pool4) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/CITEseq/Pool4 2 26570425559 24.75 GiB Pool4 +Hudson Lab Blood scRNA_GEX 2025-05-01 (Pool1) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/GEX/Pool1 4 92960795426 86.58 GiB Pool1 +Hudson Lab Blood scRNA_GEX 2025-05-01 (Pool2) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/GEX/Pool2 4 91383915771 85.11 GiB Pool2 +Hudson Lab Blood scRNA_GEX 2025-05-01 (Pool3) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/GEX/Pool3 4 90927245951 84.68 GiB Pool3 +Hudson Lab Blood scRNA_GEX 2025-05-01 (Pool4) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/GEX/Pool4 4 98084741243 91.35 GiB Pool4 +Hudson Lab Blood scRNA_TCR 2025-05-01 (Pool1) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRab/Pool1 2 18532431168 17.26 GiB Pool1 +Hudson Lab Blood scRNA_TCR 2025-05-01 (Pool2) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRab/Pool2 2 18860711563 17.57 GiB Pool2 +Hudson Lab Blood scRNA_TCR 2025-05-01 (Pool3) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRab/Pool3 2 19514188798 18.17 GiB Pool3 +Hudson Lab Blood scRNA_TCR 2025-05-01 (Pool4) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRab/Pool4 2 19591271850 18.25 GiB Pool4 +Hudson Lab Blood scRNA_TCRgd 2025-05-01 (Pool1) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRgd/Pool1 2 3316750340 3.09 GiB Pool1 +Hudson Lab Blood scRNA_TCRgd 2025-05-01 (Pool2) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRgd/Pool2 2 2653486559 2.47 GiB Pool2 +Hudson Lab Blood scRNA_TCRgd 2025-05-01 (Pool3) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRgd/Pool3 2 2267226930 2.11 GiB Pool3 +Hudson Lab Blood scRNA_TCRgd 2025-05-01 (Pool4) Blood 2025-05-01 blood_2025-05-01 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/May2025 (1P1Src044)/TCRgd/Pool4 2 3094767242 2.88 GiB Pool4 +Hudson Lab Blood CITE 2025-06-26 (Pool1) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/CITEseq/Pool1 2 20694848862 19.27 GiB Pool1 +Hudson Lab Blood CITE 2025-06-26 (Pool2) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/CITEseq/Pool2 2 23717313918 22.09 GiB Pool2 +Hudson Lab Blood CITE 2025-06-26 (Pool3) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/CITEseq/Pool3 2 23487814102 21.87 GiB Pool3 +Hudson Lab Blood CITE 2025-06-26 (Pool4) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/CITEseq/Pool4 2 25648081105 23.89 GiB Pool4 +Hudson Lab Blood scRNA_GEX 2025-06-26 (Pool1) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/GEX/Pool1 4 60236733163 56.10 GiB Pool1 +Hudson Lab Blood scRNA_GEX 2025-06-26 (Pool2) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/GEX/Pool2 4 61607430108 57.38 GiB Pool2 +Hudson Lab Blood scRNA_GEX 2025-06-26 (Pool3) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/GEX/Pool3 4 55818743545 51.99 GiB Pool3 +Hudson Lab Blood scRNA_GEX 2025-06-26 (Pool4) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/GEX/Pool4 4 56016952586 52.17 GiB Pool4 +Hudson Lab Blood scRNA_TCR 2025-06-26 (Pool1) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRab/Pool1 2 19760729616 18.40 GiB Pool1 +Hudson Lab Blood scRNA_TCR 2025-06-26 (Pool2) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRab/Pool2 2 19805452565 18.45 GiB Pool2 +Hudson Lab Blood scRNA_TCR 2025-06-26 (Pool3) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRab/Pool3 2 22102920760 20.58 GiB Pool3 +Hudson Lab Blood scRNA_TCR 2025-06-26 (Pool4) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRab/Pool4 2 20043207923 18.67 GiB Pool4 +Hudson Lab Blood scRNA_TCRgd 2025-06-26 (Pool1) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRgd/Pool1 2 3140080946 2.92 GiB Pool1 +Hudson Lab Blood scRNA_TCRgd 2025-06-26 (Pool2) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRgd/Pool2 2 2854244172 2.66 GiB Pool2 +Hudson Lab Blood scRNA_TCRgd 2025-06-26 (Pool3) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRgd/Pool3 2 2644386867 2.46 GiB Pool3 +Hudson Lab Blood scRNA_TCRgd 2025-06-26 (Pool4) Blood 2025-06-26 blood_2025-06-26 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/June2025 (260625)/TCRgd/Pool4 2 2895234848 2.70 GiB Pool4 +Hudson Lab Blood CITE 2025-07-24 (Pool1) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/CITEseq/Pool1 2 26246049699 24.44 GiB Pool1 +Hudson Lab Blood CITE 2025-07-24 (Pool2) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/CITEseq/Pool2 2 25124146032 23.40 GiB Pool2 +Hudson Lab Blood CITE 2025-07-24 (Pool3) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/CITEseq/Pool3 2 21860079898 20.36 GiB Pool3 +Hudson Lab Blood scRNA_GEX 2025-07-24 (Pool1) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/GEX/Pool1 4 68607470130 63.90 GiB Pool1 +Hudson Lab Blood scRNA_GEX 2025-07-24 (Pool2) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/GEX/Pool2 4 61011872041 56.82 GiB Pool2 +Hudson Lab Blood scRNA_GEX 2025-07-24 (Pool3) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/GEX/Pool3 4 55257258445 51.46 GiB Pool3 +Hudson Lab Blood scRNA_TCR 2025-07-24 (Pool1) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/TCRab/Pool1 2 22143608836 20.62 GiB Pool1 +Hudson Lab Blood scRNA_TCR 2025-07-24 (Pool2) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/TCRab/Pool2 2 19468298879 18.13 GiB Pool2 +Hudson Lab Blood scRNA_TCR 2025-07-24 (Pool3) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/TCRab/Pool3 2 19260532299 17.94 GiB Pool3 +Hudson Lab Blood scRNA_TCRgd 2025-07-24 (Pool1) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/TCRgd/Pool1 2 3589122494 3.34 GiB Pool1 +Hudson Lab Blood scRNA_TCRgd 2025-07-24 (Pool2) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/TCRgd/Pool2 2 3310209830 3.08 GiB Pool2 +Hudson Lab Blood scRNA_TCRgd 2025-07-24 (Pool3) Blood 2025-07-24 blood_2025-07-24 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/July2025 (250724)/TCRgd/Pool3 2 3368986296 3.14 GiB Pool3 +Hudson Lab Blood CITE 2025-08-21 (Pool1) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/CITEseq/Pool1 2 24819448629 23.11 GiB Pool1 +Hudson Lab Blood CITE 2025-08-21 (Pool2) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/CITEseq/Pool2 2 25360428086 23.62 GiB Pool2 +Hudson Lab Blood CITE 2025-08-21 (Pool3) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/CITEseq/Pool3 2 25276608584 23.54 GiB Pool3 +Hudson Lab Blood CITE 2025-08-21 (Pool4) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/CITEseq/Pool4 2 25253577273 23.52 GiB Pool4 +Hudson Lab Blood scRNA_GEX 2025-08-21 (Pool1) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/GEX/Pool1 4 71210400970 66.32 GiB Pool1 +Hudson Lab Blood scRNA_GEX 2025-08-21 (Pool2) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/GEX/Pool2 4 71651916047 66.73 GiB Pool2 +Hudson Lab Blood scRNA_GEX 2025-08-21 (Pool3) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/GEX/Pool3 4 73796139800 68.73 GiB Pool3 +Hudson Lab Blood scRNA_GEX 2025-08-21 (Pool4) Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/GEX/Pool4 4 69245512117 64.49 GiB Pool4 +Hudson Lab Blood scRNA_TCR 2025-08-21 Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/TCRab 8 95121189713 88.59 GiB +Hudson Lab Blood scRNA_TCRgd 2025-08-21 Blood 2025-08-21 blood_2025-08-21 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Aug2025 (250821)/TCRgd 8 11001632849 10.25 GiB +Hudson Lab Blood CITE 2025-09-22 (Pool1) Blood 2025-09-22 blood_2025-09-22 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Sept2025 (250922)/CITEseq/Pool1 2 24606951230 22.92 GiB Pool1 +Hudson Lab Blood scRNA_GEX 2025-09-22 (Pool1) Blood 2025-09-22 blood_2025-09-22 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Sept2025 (250922)/GEX/Pool1 4 45441319435 42.32 GiB Pool1 +Hudson Lab Blood scRNA_TCR 2025-09-22 (Pool1) Blood 2025-09-22 blood_2025-09-22 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Sept2025 (250922)/TCRab/Pool1 2 18736897109 17.45 GiB Pool1 +Hudson Lab Blood scRNA_TCRgd 2025-09-22 (Pool1) Blood 2025-09-22 blood_2025-09-22 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Sept2025 (250922)/TCRgd/Pool1 2 2994367484 2.79 GiB Pool1 +Hudson Lab Blood CITE 2025-11-06 (Pool1) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/CITEseq/Pool1 2 4035826298 3.76 GiB Pool1 +Hudson Lab Blood CITE 2025-11-06 (Pool2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/CITEseq/Pool2 2 7548037680 7.03 GiB Pool2 +Hudson Lab Blood CITE 2025-11-06 (capture1 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture1/CITE 4 1101845150 1.03 GiB capture1 v2 +Hudson Lab Blood CITE 2025-11-06 (capture2 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture2/CITE 4 25943625261 24.16 GiB capture2 v2 +Hudson Lab Blood CITE 2025-11-06 (capture3 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture3/CITE 4 40427139712 37.65 GiB capture3 v2 +Hudson Lab Blood CITE 2025-11-06 (capture4 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture4/CITE 4 10149280258 9.45 GiB capture4 v2 +Hudson Lab Blood scRNA_GEX 2025-11-06 (Pool1) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/GEX/Pool1 2 208876631319 194.53 GiB Pool1 +Hudson Lab Blood scRNA_GEX 2025-11-06 (Pool2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/GEX/Pool2 2 204215940594 190.19 GiB Pool2 +Hudson Lab Blood scRNA_GEX 2025-11-06 (capture1 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture1/GEX 4 129741407540 120.83 GiB capture1 v2 +Hudson Lab Blood scRNA_GEX 2025-11-06 (capture2 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture2/GEX 4 91800412606 85.50 GiB capture2 v2 +Hudson Lab Blood scRNA_GEX 2025-11-06 (capture3 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture3/GEX 4 53757460381 50.07 GiB capture3 v2 +Hudson Lab Blood scRNA_GEX 2025-11-06 (capture4 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture4/GEX 4 99504521135 92.67 GiB capture4 v2 +Hudson Lab Blood scRNA_TCR 2025-11-06 (Pool1) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/TCRab/Pool1 2 34501799947 32.13 GiB Pool1 +Hudson Lab Blood scRNA_TCR 2025-11-06 (Pool2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/TCRab/Pool2 2 12054930367 11.23 GiB Pool2 +Hudson Lab Blood scRNA_TCR 2025-11-06 (capture1 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture1/TCRab 4 14122357909 13.15 GiB capture1 v2 +Hudson Lab Blood scRNA_TCR 2025-11-06 (capture2 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture2/TCRab 4 12811608075 11.93 GiB capture2 v2 +Hudson Lab Blood scRNA_TCR 2025-11-06 (capture3 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture3/TCRab 4 16205637717 15.09 GiB capture3 v2 +Hudson Lab Blood scRNA_TCR 2025-11-06 (capture4 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture4/TCRab 4 16886259362 15.73 GiB capture4 v2 +Hudson Lab Blood scRNA_TCRgd 2025-11-06 (Pool1) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/TCRgd/Pool1 2 3911818391 3.64 GiB Pool1 +Hudson Lab Blood scRNA_TCRgd 2025-11-06 (Pool2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025/TCRgd/Pool2 2 7246848980 6.75 GiB Pool2 +Hudson Lab Blood scRNA_TCRgd 2025-11-06 (capture1 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture1/TCRgd 4 967595565 922.77 MiB capture1 v2 +Hudson Lab Blood scRNA_TCRgd 2025-11-06 (capture2 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture2/TCRgd 4 1171482976 1.09 GiB capture2 v2 +Hudson Lab Blood scRNA_TCRgd 2025-11-06 (capture3 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture3/TCRgd 4 1059609580 1010.52 MiB capture3 v2 +Hudson Lab Blood scRNA_TCRgd 2025-11-06 (capture4 v2) Blood 2025-11-06 blood_2025-11-06 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Nov2025v2/capture4/TCRgd 4 510906467 487.24 MiB capture4 v2 +Hudson Lab Blood CITE 2025-12-20 (capture1) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture1/CITE 4 10241996558 9.54 GiB capture1 +Hudson Lab Blood CITE 2025-12-20 (capture2) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture2/CITE 4 35750567463 33.30 GiB capture2 +Hudson Lab Blood CITE 2025-12-20 (capture3) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture3/CITE 4 8812237339 8.21 GiB capture3 +Hudson Lab Blood CITE 2025-12-20 (capture4) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture4/CITE 4 35277388902 32.85 GiB capture4 +Hudson Lab Blood scRNA_GEX 2025-12-20 (capture1) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture1/GEX 4 75251838205 70.08 GiB capture1 +Hudson Lab Blood scRNA_GEX 2025-12-20 (capture2) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture2/GEX 4 34355305376 32.00 GiB capture2 +Hudson Lab Blood scRNA_GEX 2025-12-20 (capture3) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture3/GEX 4 86564218320 80.62 GiB capture3 +Hudson Lab Blood scRNA_GEX 2025-12-20 (capture4) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture4/GEX 4 74847395173 69.71 GiB capture4 +Hudson Lab Blood scRNA_TCR 2025-12-20 (capture1) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture1/TCRab 4 16295560500 15.18 GiB capture1 +Hudson Lab Blood scRNA_TCR 2025-12-20 (capture2) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture2/TCRab 4 13581331461 12.65 GiB capture2 +Hudson Lab Blood scRNA_TCR 2025-12-20 (capture3) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture3/TCRab 4 15701776716 14.62 GiB capture3 +Hudson Lab Blood scRNA_TCR 2025-12-20 (capture4) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture4/TCRab 4 5281676973 4.92 GiB capture4 +Hudson Lab Blood scRNA_TCRgd 2025-12-20 (capture1) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture1/TCRgd 4 952516717 908.39 MiB capture1 +Hudson Lab Blood scRNA_TCRgd 2025-12-20 (capture2) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture2/TCRgd 4 1077102182 1.00 GiB capture2 +Hudson Lab Blood scRNA_TCRgd 2025-12-20 (capture3) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture3/TCRgd 4 1164137700 1.08 GiB capture3 +Hudson Lab Blood scRNA_TCRgd 2025-12-20 (capture4) Blood 2025-12-20 blood_2025-12-20 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Dec2025/capture4/TCRgd 4 1226878053 1.14 GiB capture4 +Hudson Lab Blood CITE 2026-01-20 (capture2) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture2/CITE 2 4855342193 4.52 GiB capture2 +Hudson Lab Blood scRNA_GEX 2026-01-20 (capture1) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture1/GEX 2 246640462543 229.70 GiB capture1 +Hudson Lab Blood scRNA_GEX 2026-01-20 (capture2) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture2/GEX 2 213315035620 198.67 GiB capture2 +Hudson Lab Blood scRNA_TCR 2026-01-20 (capture1) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture1/TCR_ab 2 3424366943 3.19 GiB capture1 +Hudson Lab Blood scRNA_TCR 2026-01-20 (capture2) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture2/TCR_ab 2 8831483740 8.22 GiB capture2 +Hudson Lab Blood scRNA_TCRgd 2026-01-20 (capture1) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture1/TCR_gd 4 687543062 655.69 MiB capture1 +Hudson Lab Blood scRNA_TCRgd 2026-01-20 (capture2) Blood 2026-01-20 blood_2026-01-20 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/Jan2026/capture2/TCR_gd 2 145533470 138.79 MiB capture2 +Hudson Lab Blood CITE 2026-02-13 (capture1, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture1/CITEseq 4 15612300293 14.54 GiB capture1 +Hudson Lab Blood CITE 2026-02-13 (capture2, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture2/CITEseq 4 13257610913 12.35 GiB capture2 +Hudson Lab Blood CITE 2026-02-13 (capture3, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture3/CITEseq 4 20173620886 18.79 GiB capture3 +Hudson Lab Blood scRNA_GEX 2026-02-13 (capture1, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture1/GEX 4 86731475884 80.77 GiB capture1 +Hudson Lab Blood scRNA_GEX 2026-02-13 (capture2, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture2/GEX 4 71493625687 66.58 GiB capture2 +Hudson Lab Blood scRNA_GEX 2026-02-13 (capture3, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture3/GEX 4 38701783493 36.04 GiB capture3 +Hudson Lab Blood scRNA_TCR 2026-02-13 (capture1, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture1/TCRab 4 28181564607 26.25 GiB capture1 +Hudson Lab Blood scRNA_TCR 2026-02-13 (capture2, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture2/TCRab 4 28780789692 26.80 GiB capture2 +Hudson Lab Blood scRNA_TCR 2026-02-13 (capture3, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture3/TCRab 4 32893468915 30.63 GiB capture3 +Hudson Lab Blood scRNA_TCRgd 2026-02-13 (capture1, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture1/TCRgd 4 2074280477 1.93 GiB capture1 +Hudson Lab Blood scRNA_TCRgd 2026-02-13 (capture2, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture2/TCRgd 4 1834464176 1.71 GiB capture2 +Hudson Lab Blood scRNA_TCRgd 2026-02-13 (capture3, day 13) Blood 2026-02-13 blood_2026-02-13 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-13_capture3/TCRgd 4 1331015820 1.24 GiB capture3 +Hudson Lab Blood CITE 2026-02-25 (capture1, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture1/CITEseq 4 8164408128 7.60 GiB capture1 +Hudson Lab Blood CITE 2026-02-25 (capture2, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture2/CITEseq 4 10248928287 9.55 GiB capture2 +Hudson Lab Blood scRNA_GEX 2026-02-25 (capture1, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture1/GEX 4 75507872743 70.32 GiB capture1 +Hudson Lab Blood scRNA_GEX 2026-02-25 (capture2, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture2/GEX 4 74757147654 69.62 GiB capture2 +Hudson Lab Blood scRNA_TCR 2026-02-25 (capture1, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture1/TCRab 4 26571699586 24.75 GiB capture1 +Hudson Lab Blood scRNA_TCR 2026-02-25 (capture2, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture2/TCRab 4 33374430567 31.08 GiB capture2 +Hudson Lab Blood scRNA_TCRgd 2026-02-25 (capture1, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture1/TCRgd 4 912872593 870.58 MiB capture1 +Hudson Lab Blood scRNA_TCRgd 2026-02-25 (capture2, day 25) Blood 2026-02-25 blood_2026-02-25 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-02-25_capture2/TCRgd 4 2828731794 2.63 GiB capture2 +Hudson Lab Blood CITE 2026-03-09 (capture1, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture1/CITEseq 4 19260931900 17.94 GiB capture1 +Hudson Lab Blood CITE 2026-03-09 (capture2, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture2/CITEseq 4 20792510357 19.36 GiB capture2 +Hudson Lab Blood CITE 2026-03-09 (capture3, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil CITE hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture3/CITEseq 4 16167313702 15.06 GiB capture3 +Hudson Lab Blood scRNA_GEX 2026-03-09 (capture1, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture1/GEX 4 33488955965 31.19 GiB capture1 +Hudson Lab Blood scRNA_GEX 2026-03-09 (capture2, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture2/GEX 4 88787780412 82.69 GiB capture2 +Hudson Lab Blood scRNA_GEX 2026-03-09 (capture3, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_GEX hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture3/GEX 4 80193109237 74.69 GiB capture3 +Hudson Lab Blood scRNA_TCR 2026-03-09 (capture1, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture1/TCRab 4 34632684186 32.25 GiB capture1 +Hudson Lab Blood scRNA_TCR 2026-03-09 (capture2, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture2/TCRab 4 35428278757 33.00 GiB capture2 +Hudson Lab Blood scRNA_TCR 2026-03-09 (capture3, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_TCR hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture3/TCRab 4 12008724546 11.18 GiB capture3 +Hudson Lab Blood scRNA_TCRgd 2026-03-09 (capture1, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture1/TCRgd 4 2879369473 2.68 GiB capture1 +Hudson Lab Blood scRNA_TCRgd 2026-03-09 (capture2, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture2/TCRgd 4 2688218825 2.50 GiB capture2 +Hudson Lab Blood scRNA_TCRgd 2026-03-09 (capture3, day 09) Blood 2026-03-09 blood_2026-03-09 Hudson Lab Kamil scRNA_TCRgd hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-09_capture3/TCRgd 4 2427594759 2.26 GiB capture3 +Hudson Lab Tumor bulk RNA (Aug-tumor IFNg_neg) Tumor Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/Aug-tumor/IFNg_neg 2 1629909092 1.52 GiB Peptide expansion: Aug-tumor, IFNg_neg +Hudson Lab Tumor bulk RNA (Aug-tumor IFNg_pos) Tumor Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/Aug-tumor/IFNg_pos 2 1143087659 1.06 GiB Peptide expansion: Aug-tumor, IFNg_pos +Hudson Lab Tumor bulk RNA (HD-tumor IFNg_neg) Tumor Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/HD-tumor/IFNg_neg 2 1060036407 1010.93 MiB Peptide expansion: HD-tumor, IFNg_neg +Hudson Lab Tumor bulk RNA (HD-tumor IFNg_pos) Tumor Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/HD-tumor/IFNg_pos 2 1392074275 1.30 GiB Peptide expansion: HD-tumor, IFNg_pos +Hudson Lab Tumor bulk RNA (May-tumor IFNg_neg) Tumor Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/May-tumor/IFNg_neg 2 1513821950 1.41 GiB Peptide expansion: May-tumor, IFNg_neg +Hudson Lab Tumor bulk RNA (May-tumor IFNg_pos) Tumor Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/May-tumor/IFNg_pos 2 1293957240 1.21 GiB Peptide expansion: May-tumor, IFNg_pos +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture1/CITEseq 4 63222567500 58.88 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture1/GEX 4 35452916922 33.02 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture1/TCRab 4 40564552983 37.78 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture1/TCRgd 4 3399890586 3.17 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture2/CITEseq 4 51857289182 48.30 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture2/GEX 4 34877060916 32.48 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture2/TCRab 4 40548261892 37.76 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture2/TCRgd 4 7429104851 6.92 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture3/CITEseq 4 74286946637 69.19 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture3/GEX 4 38995038351 36.32 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture3/TCRab 4 39689930090 36.96 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture3/TCRgd 4 4563526804 4.25 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture4/CITEseq 4 53661200414 49.98 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture4/GEX 4 40430570983 37.65 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture4/TCRab 4 12366665632 11.52 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-03-24/capture4/TCRgd 4 7130237344 6.64 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16/capture1/CITEseq 2 1079662554 1.01 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16/capture1/GEX 2 68918909056 64.19 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16/capture1/TCRab 2 8968368982 8.35 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16/capture1/TCRgd 2 940452162 896.89 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture1/CITEseq 6 590282340 562.94 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture1/GEX 6 113126828067 105.36 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture1/TCRab 6 20621426958 19.21 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture1/TCRgd 6 293599265 280.00 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture2/CITEseq 6 19084672813 17.77 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture2/GEX 6 88082924640 82.03 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture2/TCRab 6 8031010499 7.48 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-16_run1/capture2/TCRgd 6 1037000197 988.96 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30/capture1/CITEseq 2 47886828046 44.60 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30/capture1/GEX 2 123228278111 114.77 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30/capture1/TCRab 2 21564351161 20.08 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30/capture1/TCRgd 2 4002283792 3.73 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture1/CITEseq 6 27992134583 26.07 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture1/GEX 6 42871911126 39.93 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture1/TCRab 6 19239428321 17.92 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture1/TCRgd 6 656694877 626.27 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture2/CITEseq 6 10114411171 9.42 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture2/GEX 6 96966329874 90.31 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture2/TCRab 6 47919565479 44.63 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-04-30_run1/capture2/TCRgd 6 1155279993 1.08 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture1/CITEseq 6 10991076486 10.24 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture1/GEX 6 92703981726 86.34 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture1/TCRab 6 51962425269 48.39 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture1/TCRgd 6 627356641 598.29 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture2/CITEseq 6 29658616393 27.62 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture2/GEX 6 39395062228 36.69 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture2/TCRab 6 18064795309 16.82 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture2/TCRgd 6 858382512 818.62 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture3/CITEseq 6 8668768921 8.07 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture3/GEX 6 101562941744 94.59 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture3/TCRab 6 18045440048 16.81 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-05-20/capture3/TCRgd 6 499170171 476.05 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture1/CITEseq 6 32777170025 30.53 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture1/GEX 6 99500099978 92.67 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture1/TCRab 6 18141008815 16.90 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture1/TCRgd 6 854190445 814.62 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture2/CITEseq 6 32703543618 30.46 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture2/GEX 6 110519484565 102.93 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture2/TCRab 6 27734064866 25.83 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture2/TCRgd 6 379343565 361.77 MiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture3/CITEseq 6 22867565244 21.30 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture3/GEX 6 89201173211 83.08 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture3/TCRab 6 7357847369 6.85 GiB +Hudson Lab Blood Blood Hudson Lab Kamil hudson_lab/PBMC_scRNAseq/FASTQ/2026-06-16/capture3/TCRgd 6 790691297 754.06 MiB +Hudson Lab Blood bulk RNA (Aug-bys IFNg_neg) Blood Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/Aug-bys/IFNg_neg 2 1476587483 1.38 GiB Peptide expansion: Aug-bys, IFNg_neg +Hudson Lab Blood bulk RNA (Aug-bys IFNg_pos) Blood Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/Aug-bys/IFNg_pos 2 713341098 680.30 MiB Peptide expansion: Aug-bys, IFNg_pos +Hudson Lab Blood bulk RNA (HD-bys IFNg_neg) Blood Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/HD-bys/IFNg_neg 2 1241649394 1.16 GiB Peptide expansion: HD-bys, IFNg_neg +Hudson Lab Blood bulk RNA (HD-bys IFNg_pos) Blood Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/HD-bys/IFNg_pos 2 1834037338 1.71 GiB Peptide expansion: HD-bys, IFNg_pos +Hudson Lab Blood bulk RNA (May-bys IFNg_neg) Blood Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/May-bys/IFNg_neg 2 1462096167 1.36 GiB Peptide expansion: May-bys, IFNg_neg +Hudson Lab Blood bulk RNA (May-bys IFNg_pos) Blood Hudson Lab Kamil bulk RNA hudson_lab/peptide_expansion/data/May-bys/IFNg_pos 2 1735402819 1.62 GiB Peptide expansion: May-bys, IFNg_pos +hudson_lab/PBMC_scRNAseq/EBV_tetramer_sort/FASTQ hudson_lab/PBMC_scRNAseq/EBV_tetramer_sort/FASTQ 12 160727145032 149.69 GiB +ucsf/T1/IPISRC044_T1_sclrs_ONT/fastq_fail ucsf/T1/IPISRC044_T1_sclrs_ONT/fastq_fail 97 15985577581 14.89 GiB +ucsf/T1/IPISRC044_T1_sclrs_ONT/fastq_pass ucsf/T1/IPISRC044_T1_sclrs_ONT/fastq_pass 97 223398075228 208.06 GiB +ucsf/T2/IPISRC044_T2_sclrs_ONT/fastq_fail ucsf/T2/IPISRC044_T2_sclrs_ONT/fastq_fail 97 17110021094 15.93 GiB +ucsf/T2/IPISRC044_T2_sclrs_ONT/fastq_pass ucsf/T2/IPISRC044_T2_sclrs_ONT/fastq_pass 97 226587432501 211.03 GiB +ucsf/T3/IPISRC044_T3_sclrs_ONT/fastq_fail ucsf/T3/IPISRC044_T3_sclrs_ONT/fastq_fail 97 17471114346 16.27 GiB +ucsf/T3/IPISRC044_T3_sclrs_ONT/fastq_pass ucsf/T3/IPISRC044_T3_sclrs_ONT/fastq_pass 97 234568053243 218.46 GiB +vendor/bostongene/BG003082/RNASeq-tumor-A01231 vendor/bostongene/BG003082/RNASeq-tumor-A01231 4 11007830868 10.25 GiB +vendor/bostongene/BG003082/WES-normal-A01231 vendor/bostongene/BG003082/WES-normal-A01231 4 11678164961 10.88 GiB +vendor/bostongene/BG003082/WES-tumor-A01231 vendor/bostongene/BG003082/WES-tumor-A01231 4 22995318623 21.42 GiB +vendor/bostongene/BG009368/RNASeq-tumor-A01231 vendor/bostongene/BG009368/RNASeq-tumor-A01231 8 9240081148 8.61 GiB +vendor/bostongene/BG009368/WES-normal-A01231 vendor/bostongene/BG009368/WES-normal-A01231 4 11678164961 10.88 GiB +vendor/bostongene/BG009368/WES-tumor-A01231 vendor/bostongene/BG009368/WES-tumor-A01231 8 20080114801 18.70 GiB +vendor/cegat/P116686_1_S000048 vendor/cegat/P116686_1_S000048 2 11321968597 10.54 GiB +vendor/cegat/P116686_2_S000048 vendor/cegat/P116686_2_S000048 4 20299860094 18.91 GiB +vendor/natera/fastq vendor/natera/fastq 8 474427430619 441.84 GiB +vendor/tempus/TL-24-5GQLV9WSXQ/DNA/FastQ vendor/tempus/TL-24-5GQLV9WSXQ/DNA/FastQ 2 7916872819 7.37 GiB +vendor/tempus/TL-24-ALMY2X4KMV/DNA/FastQ vendor/tempus/TL-24-ALMY2X4KMV/DNA/FastQ 4 24673362188 22.98 GiB +vendor/tempus/TL-24-ALMY2X4KMV/RNA/FastQ vendor/tempus/TL-24-ALMY2X4KMV/RNA/FastQ 2 1377960976 1.28 GiB +vendor/tempus/TL-24-KCVBE1UI1P/RNA/FastQ vendor/tempus/TL-24-KCVBE1UI1P/RNA/FastQ 2 1377960976 1.28 GiB diff --git a/tests/data/evidence-overlap/receipts.json b/tests/data/evidence-overlap/receipts.json new file mode 100644 index 0000000..0168f32 --- /dev/null +++ b/tests/data/evidence-overlap/receipts.json @@ -0,0 +1,1436 @@ +{ + "c75479dce2b07bbf": { + "command": [ + "samtools", + "view", + "--no-PG", + "-b", + "-M", + "-X", + "-L", + "regions.bed", + "-q", + "0", + "-F", + "0", + "-f", + "0", + "-o", + "reads.bam", + "--fetch-pairs", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam", + "objects/sha256/76e825657c3b6bdc6aca83deef08cb13ad7261d20de84348ea3a124722dd757a.Aligned.sortedByCoord.out.md.bam.bai" + ], + "files": { + "header.sam": "3e16854aafaf36b29192eb4c20c79470c17946f4d563fb921f1c74b77ac82f2b", + "reads.bam": "333b459db4357990cabe80beb361af9279c8e95cd7c9a604216dfcce47be7065", + "reads.bam.bai": "a8ad0d16ec8b053b300279cb567e9c699c4aeb8fa235a1d376be097b6df2daf5", + "regions.bed": "8498e9f2066de18f2a63db822c9fbbc3ab218d8f6cb9f7f7cc7cc0fc9af410df" + }, + "header_receipt": { + "command": [ + "samtools", + "view", + "--no-PG", + "-H", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam" + ], + "files": { + "header.sam": "3e16854aafaf36b29192eb4c20c79470c17946f4d563fb921f1c74b77ac82f2b" + }, + "remote_identity": { + "content-length": "1518873721", + "etag": "\"d4b0ef9bcd9305357dbd3f4b0e79f208-290\"", + "last-modified": "Wed, 03 Jun 2026 21:50:31 GMT" + }, + "request": { + "operation": "inspect_alignment", + "schema_version": 1, + "snapshot_id": "160c14e6ddc9c33d0dd7acd70556698d8244e03159f4524b9c474dc9bc4b3535", + "source": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam", + "source_modified": null, + "source_sha256": null, + "source_size": 1518873721 + }, + "samtools_version": "samtools 1.21" + }, + "index_receipt": { + "etag": "\"30f8d79ff861124fc3a67034f2c5bab4\"", + "filename": "TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam.bai", + "last_modified": "Wed, 03 Jun 2026 21:50:30 GMT", + "md5": null, + "retrieved_at": "2026-09-28T15:54:16.259100+00:00", + "sha256": "76e825657c3b6bdc6aca83deef08cb13ad7261d20de84348ea3a124722dd757a", + "size": 2601008, + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam.bai" + }, + "pysam_version": "0.24.1", + "records": 40696, + "remote_identity": { + "content-length": "1518873721", + "etag": "\"d4b0ef9bcd9305357dbd3f4b0e79f208-290\"", + "last-modified": "Wed, 03 Jun 2026 21:50:31 GMT" + }, + "request": { + "fetch_pairs": true, + "filters": { + "barcode_tag": "CB", + "barcodes": [], + "exclude_flags": 0, + "min_mapq": 0, + "query_names": [], + "require_flags": 0 + }, + "index": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam.bai", + "index_sha256": null, + "operation": "extract_reads", + "reference_index_sha256": null, + "reference_sha256": null, + "regions": [ + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151187547, + "reference_length": 248956422, + "start": 151183546 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151244179, + "reference_length": 248956422, + "start": 151240177 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 173813223, + "reference_length": 248956422, + "start": 173809222 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 23364762, + "reference_length": 248956422, + "start": 23360761 + }, + { + "assembly": "GRCh38", + "contig": "chr11", + "end": 20082142, + "reference_length": 135086622, + "start": 20078141 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 52953767, + "reference_length": 133275309, + "start": 52949766 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 5496381, + "reference_length": 133275309, + "start": 5492380 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 101982529, + "reference_length": 107043718, + "start": 101978528 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 102032200, + "reference_length": 107043718, + "start": 102028199 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 39433722, + "reference_length": 107043718, + "start": 39429721 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 71996488, + "reference_length": 101991189, + "start": 71992487 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 96334299, + "reference_length": 101991189, + "start": 96330298 + }, + { + "assembly": "GRCh38", + "contig": "chr16", + "end": 30559995, + "reference_length": 90338345, + "start": 30555994 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 5009293, + "reference_length": 83257441, + "start": 5005292 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 51156443, + "reference_length": 83257441, + "start": 51152442 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 75591954, + "reference_length": 83257441, + "start": 75587952 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 80329833, + "reference_length": 83257441, + "start": 80325829 + }, + { + "assembly": "GRCh38", + "contig": "chr18", + "end": 45927851, + "reference_length": 80373285, + "start": 45923850 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 171815470, + "reference_length": 242193529, + "start": 171811469 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 209696790, + "reference_length": 242193529, + "start": 209692767 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 15647183, + "reference_length": 198295559, + "start": 15643182 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 46900732, + "reference_length": 198295559, + "start": 46896731 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 64200863, + "reference_length": 198295559, + "start": 64196862 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 77609853, + "reference_length": 198295559, + "start": 77605852 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 138393529, + "reference_length": 181538259, + "start": 138389528 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 141528090, + "reference_length": 181538259, + "start": 141524089 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 168401513, + "reference_length": 181538259, + "start": 168397512 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 110230838, + "reference_length": 170805979, + "start": 110226837 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 26057839, + "reference_length": 170805979, + "start": 26053823 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 43188384, + "reference_length": 170805979, + "start": 43184383 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 46858758, + "reference_length": 170805979, + "start": 46854757 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 73820405, + "reference_length": 170805979, + "start": 73816404 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 133276996, + "reference_length": 159345973, + "start": 133272995 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 151220156, + "reference_length": 159345973, + "start": 151216155 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 98243128, + "reference_length": 159345973, + "start": 98239126 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 22194067, + "reference_length": 145138636, + "start": 22190066 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 99863923, + "reference_length": 145138636, + "start": 99859922 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 3858157, + "reference_length": 138394717, + "start": 3854148 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 70300024, + "reference_length": 138394717, + "start": 70296023 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 97912412, + "reference_length": 138394717, + "start": 97908411 + }, + { + "assembly": "GRCh38", + "contig": "chrM", + "end": 14994, + "reference_length": 16569, + "start": 10993 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 154932861, + "reference_length": 156040895, + "start": 154928860 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 46503045, + "reference_length": 156040895, + "start": 46499044 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 77601465, + "reference_length": 156040895, + "start": 77597464 + } + ], + "schema_version": 1, + "snapshot_id": "160c14e6ddc9c33d0dd7acd70556698d8244e03159f4524b9c474dc9bc4b3535", + "source": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-KCVBE1UI1P/TL-24-KCVBE1UI1P.Aligned.sortedByCoord.out.md.bam", + "source_modified": null, + "source_sha256": null, + "source_size": 1518873721 + }, + "resolved_regions": [ + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 23364762, + "reference_length": 248956422, + "start": 23360761 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151187547, + "reference_length": 248956422, + "start": 151183546 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151244179, + "reference_length": 248956422, + "start": 151240177 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 173813223, + "reference_length": 248956422, + "start": 173809222 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 171815470, + "reference_length": 242193529, + "start": 171811469 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 209696790, + "reference_length": 242193529, + "start": 209692767 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 15647183, + "reference_length": 198295559, + "start": 15643182 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 46900732, + "reference_length": 198295559, + "start": 46896731 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 64200863, + "reference_length": 198295559, + "start": 64196862 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 77609853, + "reference_length": 198295559, + "start": 77605852 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 138393529, + "reference_length": 181538259, + "start": 138389528 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 141528090, + "reference_length": 181538259, + "start": 141524089 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 168401513, + "reference_length": 181538259, + "start": 168397512 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 26057839, + "reference_length": 170805979, + "start": 26053823 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 43188384, + "reference_length": 170805979, + "start": 43184383 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 46858758, + "reference_length": 170805979, + "start": 46854757 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 73820405, + "reference_length": 170805979, + "start": 73816404 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 110230838, + "reference_length": 170805979, + "start": 110226837 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 98243128, + "reference_length": 159345973, + "start": 98239126 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 133276996, + "reference_length": 159345973, + "start": 133272995 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 151220156, + "reference_length": 159345973, + "start": 151216155 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 22194067, + "reference_length": 145138636, + "start": 22190066 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 99863923, + "reference_length": 145138636, + "start": 99859922 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 3858157, + "reference_length": 138394717, + "start": 3854148 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 70300024, + "reference_length": 138394717, + "start": 70296023 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 97912412, + "reference_length": 138394717, + "start": 97908411 + }, + { + "assembly": "GRCh38", + "contig": "chr11", + "end": 20082142, + "reference_length": 135086622, + "start": 20078141 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 5496381, + "reference_length": 133275309, + "start": 5492380 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 52953767, + "reference_length": 133275309, + "start": 52949766 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 39433722, + "reference_length": 107043718, + "start": 39429721 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 101982529, + "reference_length": 107043718, + "start": 101978528 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 102032200, + "reference_length": 107043718, + "start": 102028199 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 71996488, + "reference_length": 101991189, + "start": 71992487 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 96334299, + "reference_length": 101991189, + "start": 96330298 + }, + { + "assembly": "GRCh38", + "contig": "chr16", + "end": 30559995, + "reference_length": 90338345, + "start": 30555994 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 5009293, + "reference_length": 83257441, + "start": 5005292 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 51156443, + "reference_length": 83257441, + "start": 51152442 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 75591954, + "reference_length": 83257441, + "start": 75587952 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 80329833, + "reference_length": 83257441, + "start": 80325829 + }, + { + "assembly": "GRCh38", + "contig": "chr18", + "end": 45927851, + "reference_length": 80373285, + "start": 45923850 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 46503045, + "reference_length": 156040895, + "start": 46499044 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 77601465, + "reference_length": 156040895, + "start": 77597464 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 154932861, + "reference_length": 156040895, + "start": 154928860 + }, + { + "assembly": "GRCh38", + "contig": "chrM", + "end": 14994, + "reference_length": 16569, + "start": 10993 + } + ], + "samtools_version": "samtools 1.21", + "scope": "regional_records_and_paired_mates" + }, + "e5c28abdbf307d55": { + "command": [ + "samtools", + "view", + "--no-PG", + "-b", + "-M", + "-X", + "-L", + "regions.bed", + "-q", + "0", + "-F", + "0", + "-f", + "0", + "-o", + "reads.bam", + "--fetch-pairs", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam", + "objects/sha256/08431f84b5daf7cca50a3112ffbf2f673065248c433e869a6e41e8b9d74bf07d.Aligned.sortedByCoord.out.md.bam.bai" + ], + "files": { + "header.sam": "7eebbde17c994c62b8e56c3a3d0780558a889133c6266b8a0921b572f171ea41", + "reads.bam": "c6af0965958b55954757945dbd0125eb0b452d60b1c9038bf980621852831f95", + "reads.bam.bai": "a7c0c2174786e59c07eccecbad96344d7c69ce3b1ec4dbf780a048d3a20481d6", + "regions.bed": "8498e9f2066de18f2a63db822c9fbbc3ab218d8f6cb9f7f7cc7cc0fc9af410df" + }, + "header_receipt": { + "command": [ + "samtools", + "view", + "--no-PG", + "-H", + "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam" + ], + "files": { + "header.sam": "7eebbde17c994c62b8e56c3a3d0780558a889133c6266b8a0921b572f171ea41" + }, + "remote_identity": { + "content-length": "1518846497", + "etag": "\"9f88b09613aebf4c1e6e17c120b435c7-290\"", + "last-modified": "Wed, 03 Jun 2026 17:42:55 GMT" + }, + "request": { + "operation": "inspect_alignment", + "schema_version": 1, + "snapshot_id": "160c14e6ddc9c33d0dd7acd70556698d8244e03159f4524b9c474dc9bc4b3535", + "source": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam", + "source_modified": null, + "source_sha256": null, + "source_size": 1518846497 + }, + "samtools_version": "samtools 1.21" + }, + "index_receipt": { + "etag": "\"1b3741e560ed88c1e90c74983da48f3d\"", + "filename": "TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam.bai", + "last_modified": "Wed, 03 Jun 2026 17:42:55 GMT", + "md5": null, + "retrieved_at": "2026-09-28T15:54:16.645027+00:00", + "sha256": "08431f84b5daf7cca50a3112ffbf2f673065248c433e869a6e41e8b9d74bf07d", + "size": 2600904, + "url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam.bai" + }, + "pysam_version": "0.24.1", + "records": 40696, + "remote_identity": { + "content-length": "1518846497", + "etag": "\"9f88b09613aebf4c1e6e17c120b435c7-290\"", + "last-modified": "Wed, 03 Jun 2026 17:42:55 GMT" + }, + "request": { + "fetch_pairs": true, + "filters": { + "barcode_tag": "CB", + "barcodes": [], + "exclude_flags": 0, + "min_mapq": 0, + "query_names": [], + "require_flags": 0 + }, + "index": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam.bai", + "index_sha256": null, + "operation": "extract_reads", + "reference_index_sha256": null, + "reference_sha256": null, + "regions": [ + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151187547, + "reference_length": 248956422, + "start": 151183546 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151244179, + "reference_length": 248956422, + "start": 151240177 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 173813223, + "reference_length": 248956422, + "start": 173809222 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 23364762, + "reference_length": 248956422, + "start": 23360761 + }, + { + "assembly": "GRCh38", + "contig": "chr11", + "end": 20082142, + "reference_length": 135086622, + "start": 20078141 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 52953767, + "reference_length": 133275309, + "start": 52949766 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 5496381, + "reference_length": 133275309, + "start": 5492380 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 101982529, + "reference_length": 107043718, + "start": 101978528 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 102032200, + "reference_length": 107043718, + "start": 102028199 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 39433722, + "reference_length": 107043718, + "start": 39429721 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 71996488, + "reference_length": 101991189, + "start": 71992487 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 96334299, + "reference_length": 101991189, + "start": 96330298 + }, + { + "assembly": "GRCh38", + "contig": "chr16", + "end": 30559995, + "reference_length": 90338345, + "start": 30555994 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 5009293, + "reference_length": 83257441, + "start": 5005292 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 51156443, + "reference_length": 83257441, + "start": 51152442 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 75591954, + "reference_length": 83257441, + "start": 75587952 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 80329833, + "reference_length": 83257441, + "start": 80325829 + }, + { + "assembly": "GRCh38", + "contig": "chr18", + "end": 45927851, + "reference_length": 80373285, + "start": 45923850 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 171815470, + "reference_length": 242193529, + "start": 171811469 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 209696790, + "reference_length": 242193529, + "start": 209692767 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 15647183, + "reference_length": 198295559, + "start": 15643182 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 46900732, + "reference_length": 198295559, + "start": 46896731 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 64200863, + "reference_length": 198295559, + "start": 64196862 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 77609853, + "reference_length": 198295559, + "start": 77605852 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 138393529, + "reference_length": 181538259, + "start": 138389528 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 141528090, + "reference_length": 181538259, + "start": 141524089 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 168401513, + "reference_length": 181538259, + "start": 168397512 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 110230838, + "reference_length": 170805979, + "start": 110226837 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 26057839, + "reference_length": 170805979, + "start": 26053823 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 43188384, + "reference_length": 170805979, + "start": 43184383 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 46858758, + "reference_length": 170805979, + "start": 46854757 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 73820405, + "reference_length": 170805979, + "start": 73816404 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 133276996, + "reference_length": 159345973, + "start": 133272995 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 151220156, + "reference_length": 159345973, + "start": 151216155 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 98243128, + "reference_length": 159345973, + "start": 98239126 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 22194067, + "reference_length": 145138636, + "start": 22190066 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 99863923, + "reference_length": 145138636, + "start": 99859922 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 3858157, + "reference_length": 138394717, + "start": 3854148 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 70300024, + "reference_length": 138394717, + "start": 70296023 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 97912412, + "reference_length": 138394717, + "start": 97908411 + }, + { + "assembly": "GRCh38", + "contig": "chrM", + "end": 14994, + "reference_length": 16569, + "start": 10993 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 154932861, + "reference_length": 156040895, + "start": 154928860 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 46503045, + "reference_length": 156040895, + "start": 46499044 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 77601465, + "reference_length": 156040895, + "start": 77597464 + } + ], + "schema_version": 1, + "snapshot_id": "160c14e6ddc9c33d0dd7acd70556698d8244e03159f4524b9c474dc9bc4b3535", + "source": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/TL-24-ALMY2X4KMV/TL-24-ALMY2X4KMV.Aligned.sortedByCoord.out.md.bam", + "source_modified": null, + "source_sha256": null, + "source_size": 1518846497 + }, + "resolved_regions": [ + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 23364762, + "reference_length": 248956422, + "start": 23360761 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151187547, + "reference_length": 248956422, + "start": 151183546 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 151244179, + "reference_length": 248956422, + "start": 151240177 + }, + { + "assembly": "GRCh38", + "contig": "chr1", + "end": 173813223, + "reference_length": 248956422, + "start": 173809222 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 171815470, + "reference_length": 242193529, + "start": 171811469 + }, + { + "assembly": "GRCh38", + "contig": "chr2", + "end": 209696790, + "reference_length": 242193529, + "start": 209692767 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 15647183, + "reference_length": 198295559, + "start": 15643182 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 46900732, + "reference_length": 198295559, + "start": 46896731 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 64200863, + "reference_length": 198295559, + "start": 64196862 + }, + { + "assembly": "GRCh38", + "contig": "chr3", + "end": 77609853, + "reference_length": 198295559, + "start": 77605852 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 138393529, + "reference_length": 181538259, + "start": 138389528 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 141528090, + "reference_length": 181538259, + "start": 141524089 + }, + { + "assembly": "GRCh38", + "contig": "chr5", + "end": 168401513, + "reference_length": 181538259, + "start": 168397512 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 26057839, + "reference_length": 170805979, + "start": 26053823 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 43188384, + "reference_length": 170805979, + "start": 43184383 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 46858758, + "reference_length": 170805979, + "start": 46854757 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 73820405, + "reference_length": 170805979, + "start": 73816404 + }, + { + "assembly": "GRCh38", + "contig": "chr6", + "end": 110230838, + "reference_length": 170805979, + "start": 110226837 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 98243128, + "reference_length": 159345973, + "start": 98239126 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 133276996, + "reference_length": 159345973, + "start": 133272995 + }, + { + "assembly": "GRCh38", + "contig": "chr7", + "end": 151220156, + "reference_length": 159345973, + "start": 151216155 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 22194067, + "reference_length": 145138636, + "start": 22190066 + }, + { + "assembly": "GRCh38", + "contig": "chr8", + "end": 99863923, + "reference_length": 145138636, + "start": 99859922 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 3858157, + "reference_length": 138394717, + "start": 3854148 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 70300024, + "reference_length": 138394717, + "start": 70296023 + }, + { + "assembly": "GRCh38", + "contig": "chr9", + "end": 97912412, + "reference_length": 138394717, + "start": 97908411 + }, + { + "assembly": "GRCh38", + "contig": "chr11", + "end": 20082142, + "reference_length": 135086622, + "start": 20078141 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 5496381, + "reference_length": 133275309, + "start": 5492380 + }, + { + "assembly": "GRCh38", + "contig": "chr12", + "end": 52953767, + "reference_length": 133275309, + "start": 52949766 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 39433722, + "reference_length": 107043718, + "start": 39429721 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 101982529, + "reference_length": 107043718, + "start": 101978528 + }, + { + "assembly": "GRCh38", + "contig": "chr14", + "end": 102032200, + "reference_length": 107043718, + "start": 102028199 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 71996488, + "reference_length": 101991189, + "start": 71992487 + }, + { + "assembly": "GRCh38", + "contig": "chr15", + "end": 96334299, + "reference_length": 101991189, + "start": 96330298 + }, + { + "assembly": "GRCh38", + "contig": "chr16", + "end": 30559995, + "reference_length": 90338345, + "start": 30555994 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 5009293, + "reference_length": 83257441, + "start": 5005292 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 51156443, + "reference_length": 83257441, + "start": 51152442 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 75591954, + "reference_length": 83257441, + "start": 75587952 + }, + { + "assembly": "GRCh38", + "contig": "chr17", + "end": 80329833, + "reference_length": 83257441, + "start": 80325829 + }, + { + "assembly": "GRCh38", + "contig": "chr18", + "end": 45927851, + "reference_length": 80373285, + "start": 45923850 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 46503045, + "reference_length": 156040895, + "start": 46499044 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 77601465, + "reference_length": 156040895, + "start": 77597464 + }, + { + "assembly": "GRCh38", + "contig": "chrX", + "end": 154932861, + "reference_length": 156040895, + "start": 154928860 + }, + { + "assembly": "GRCh38", + "contig": "chrM", + "end": 14994, + "reference_length": 16569, + "start": 10993 + } + ], + "samtools_version": "samtools 1.21", + "scope": "regional_records_and_paired_mates" + } +} diff --git a/tests/data/retrieval/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam b/tests/data/retrieval/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam new file mode 100644 index 0000000..eccc2a9 Binary files /dev/null and b/tests/data/retrieval/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam differ diff --git a/tests/data/retrieval/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai b/tests/data/retrieval/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai new file mode 100644 index 0000000..ed10201 Binary files /dev/null and b/tests/data/retrieval/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai differ diff --git a/tests/data/retrieval/44-MT_ND5-chrM-12994-238f917202dd9997.bam b/tests/data/retrieval/44-MT_ND5-chrM-12994-238f917202dd9997.bam new file mode 100644 index 0000000..3d179be Binary files /dev/null and b/tests/data/retrieval/44-MT_ND5-chrM-12994-238f917202dd9997.bam differ diff --git a/tests/data/retrieval/44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai b/tests/data/retrieval/44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai new file mode 100644 index 0000000..a6ec70c Binary files /dev/null and b/tests/data/retrieval/44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai differ diff --git a/tests/data/retrieval/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam b/tests/data/retrieval/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam new file mode 100644 index 0000000..dd97fce Binary files /dev/null and b/tests/data/retrieval/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam differ diff --git a/tests/data/retrieval/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai b/tests/data/retrieval/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai new file mode 100644 index 0000000..b81288e Binary files /dev/null and b/tests/data/retrieval/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai differ diff --git a/tests/data/retrieval/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam b/tests/data/retrieval/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam new file mode 100644 index 0000000..60bea77 Binary files /dev/null and b/tests/data/retrieval/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam differ diff --git a/tests/data/retrieval/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai b/tests/data/retrieval/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai new file mode 100644 index 0000000..1c65fab Binary files /dev/null and b/tests/data/retrieval/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai differ diff --git a/tests/data/retrieval/README.md b/tests/data/retrieval/README.md new file mode 100644 index 0000000..2102f19 --- /dev/null +++ b/tests/data/retrieval/README.md @@ -0,0 +1,18 @@ +# Native retrieval coordinate regressions + +Four unchanged BAM/index pairs and their original case metadata from the Vaxrank +cohort archive at commit `0565cf15754fa3ac45b82fa5fc7fd5ddfbe06cfa`, path +`vaxrank/data/sid-test-data.zip`, members `osteosarc/shared-v1/*`. +The manifest retains each original asset's SHA-256, source URL, selection and +reference-validation receipt. The public source reads are CC0. + +Cases 44, 45 and 48 exercise Osteosarc #99: plain `MT` on a GRCh37 nuclear +reference with rCRS mitochondria, UCSC hg19 chrM with its different length and +position, and a GRCh37 NR2F2 locus whose catalogue ID is GRCh38. Case 00 is an +ordinary GRCh38 control. No read or historical coordinate has been edited. + +`osteosarc/data/retrieval-cases.json` separately versions the native metadata for +all 49 cases. It was generated with `annotate_retrieval_manifest` against all +original assets: all checksums and all 49 native indexed queries passed. Original +cases and BAM identities remain unchanged; the new fields supply exact query +contigs, coordinates and reference identities. Do not merge all cases as one BAM. diff --git a/tests/data/retrieval/historical-manifest.json b/tests/data/retrieval/historical-manifest.json new file mode 100644 index 0000000..0c9687e --- /dev/null +++ b/tests/data/retrieval/historical-manifest.json @@ -0,0 +1,269 @@ +{ + "acquisition": "osteosarc; current extraction receipts are in ../../provenance.json", + "assets": [ + { + "bundle_path": "osteosarc/shared-v1/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam", + "filename": "00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam", + "sha256": "5e95118af62ea8d000100a87d0c0ed0d571045f320d63375e58969bd4ff1fa63", + "size_bytes": 4179 + }, + { + "bundle_path": "osteosarc/shared-v1/00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai", + "filename": "00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam.bai", + "sha256": "11d1472317a1d8dac7285f71b04a777337f76397a30226097100929fc1d628f2", + "size_bytes": 75480 + }, + { + "bundle_path": "osteosarc/shared-v1/44-MT_ND5-chrM-12994-238f917202dd9997.bam", + "filename": "44-MT_ND5-chrM-12994-238f917202dd9997.bam", + "sha256": "510062c3cbe9df54cf4bb15cf96ee83cf9f4f79bde8df536b3e6ee639c42bcb5", + "size_bytes": 2055 + }, + { + "bundle_path": "osteosarc/shared-v1/44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai", + "filename": "44-MT_ND5-chrM-12994-238f917202dd9997.bam.bai", + "sha256": "fd9875ef3646a2a6a3bcaf3277d2d7c2a240f3aaf93697aae78e8c756fe268b3", + "size_bytes": 760 + }, + { + "bundle_path": "osteosarc/shared-v1/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam", + "filename": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam", + "sha256": "dbdecc9fd5fdc887667153005d300f22f0aaf55606a2d884164cc4e20d139ad2", + "size_bytes": 1257 + }, + { + "bundle_path": "osteosarc/shared-v1/45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai", + "filename": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam.bai", + "sha256": "81752c733dcd56f9cbd040ee5314c1b1868a370f4f744453eb1f3c651c80c7e9", + "size_bytes": 288 + }, + { + "bundle_path": "osteosarc/shared-v1/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam", + "filename": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam", + "sha256": "b7fcdd4f5ed3c3f97de9e23c3e77fa10033c8a3b927ee75d4888520c99a5fcc9", + "size_bytes": 1255 + }, + { + "bundle_path": "osteosarc/shared-v1/48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai", + "filename": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam.bai", + "sha256": "3facf5d7a5eb2f86eff9feb6b45b72145f196d69a64481c98a842379ad1139a7", + "size_bytes": 47584 + } + ], + "cache_namespace": "openvax", + "cache_object_layout": "objects/sha256/{sha256}{original_suffixes}", + "cases": [ + { + "bam": "00-ABCF2-chr7-151218156-f30f618fb76a0e49.bam", + "case_id": "00-ABCF2-chr7-151218156-f30f618fb76a0e49", + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": "16c085f81a650134624ce7675a576107bfdbac0783a05f11952382d7555d3cc5", + "source_receipt_sha256": "6dec36f21a037f16ff5b337b76c71b405d5c783d3011536f0e1b924866bdb066", + "source_region_sha256": "8c60781ff61622445c53a6d561660a9edbacfc22764048bcec28e7e175def2ca" + }, + "selected_record_count": 2, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "f30f618fb76a0e49", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/reprocessed/BG003082/BG003082.Aligned.sortedByCoord.out.md.bam", + "variant": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr7", + "gene": "ABCF2", + "genomic_validation": { + "allele_offset": 30, + "end": 151218186, + "genome": "hg38", + "receipt": { + "bytes": 221, + "sha256": "afa73fbb385f2ec436bdb3802f31da52d1296aa4d656a0ee2c7a2e62b9c5f942", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chr7&start=151218125&end=151218186" + }, + "sequence": "GGGCCCTACCAGAGCCACTCGTGTGTCAAGGTCAATTCCAAATTCTAGATTATTGTAGATG", + "start": 151218125 + }, + "pos": 151218156, + "ref": "G", + "source_location": "chr7:151218156", + "source_protein_label": "\u2014", + "source_url": "https://osteosarc.com/variant/ABCF2-chr7-151218156/", + "vaccine_count": 1, + "variant_id": "ABCF2-chr7-151218156" + } + }, + { + "bam": "44-MT_ND5-chrM-12994-238f917202dd9997.bam", + "case_id": "44-MT_ND5-chrM-12994-238f917202dd9997", + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "681adc14fb73f60564ed8b59616f72f5f0add573c23b3a22f0867df9ad3be861", + "source_region_sha256": "bf1166ecd0a642c301191ff19675b4412fb3f12d11da171353f6d2c624829d49" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "238f917202dd9997", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/rna-seq/tempus/TL-24-ALMY2X4KMV/RNA/TL-24-ALMY2X4KMV_T_sorted.bam", + "variant": { + "alt": "A", + "assembly": "GRCh37", + "chrom": "chrM", + "coordinate_mapping": { + "method": "rCRS MT, not UCSC hg19 chrM", + "reference_length": 16569 + }, + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13024, + "genome": "hg38", + "receipt": { + "bytes": 213, + "sha256": "f36b6b5a1172d89c0f2b801232b8c1993b280019e4f9035acf006562bc92f38c", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38&chrom=chrM&start=12963&end=13024" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12963 + }, + "original_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "pos": 12994, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18.bam", + "case_id": "45-MT_ND5-chrM-12994-fbeb5d8a415e4d18", + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "771bc1d14258b99f336f6ce18a58528fe5831130a25b0c04a4903da8fafe0ac6", + "source_region_sha256": "7066148b3a84af932d23ca18097a279fd7ddb40c2aaaeb4bb6a9341c12d227ef" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbeb5d8a415e4d18", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/cegat/P116686_2_S000048/P116686_3.bam", + "variant": { + "alt": "A", + "assembly": "GRCh37", + "chrom": "chrM", + "coordinate_mapping": { + "chain_id": "2406", + "chrom": "chrM", + "end": 12995, + "start": 12994, + "strand": "+" + }, + "gene": "MT-ND5", + "genomic_validation": { + "allele_offset": 30, + "end": 13025, + "genome": "hg19", + "receipt": { + "bytes": 213, + "sha256": "644822d1d8988e2adde299255f7a1edfbb90fc515305d50dde42a37459355b26", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg19&chrom=chrM&start=12964&end=13025" + }, + "sequence": "CTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCC", + "start": 12964 + }, + "original_identity": { + "alt": "A", + "assembly": "GRCh38", + "chrom": "chrM", + "pos": 12994, + "ref": "G" + }, + "pos": 12995, + "ref": "G", + "source_location": "chrM:12994", + "source_protein_label": "p.Ala220Thr", + "source_url": "https://osteosarc.com/variant/MT_ND5-chrM-12994/", + "vaccine_count": 1, + "variant_id": "MT_ND5-chrM-12994" + } + }, + { + "bam": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18.bam", + "case_id": "48-NR2F2-chr15-96332299-fbeb5d8a415e4d18", + "historical_selection": { + "selection": "allele-balanced hash-selected names plus up to 32 protein-supporting names", + "selection_row_sha256": null, + "source_receipt_sha256": "771bc1d14258b99f336f6ce18a58528fe5831130a25b0c04a4903da8fafe0ac6", + "source_region_sha256": "7066148b3a84af932d23ca18097a279fd7ddb40c2aaaeb4bb6a9341c12d227ef" + }, + "selected_record_count": 1, + "selection": "One reviewed template for indexed retrieval; NTF3 retains compound AG>GT evidence", + "source_id": "fbeb5d8a415e4d18", + "source_url": "https://sid-sijbrandij-osteosarc-dataset.s3.us-west-2.amazonaws.com/vendor/cegat/P116686_2_S000048/P116686_3.bam", + "variant": { + "alt": "T", + "assembly": "GRCh37", + "chrom": "chr15", + "coordinate_mapping": { + "chain_id": "16", + "chrom": "chr15", + "end": 96875528, + "start": 96875527, + "strand": "+" + }, + "gene": "NR2F2", + "genomic_validation": { + "allele_offset": 30, + "end": 96875558, + "genome": "hg19", + "receipt": { + "bytes": 220, + "sha256": "1c930cf48c5e8f56d9a0baa0d8b22b9691cd4e4d4bc038dc952526a789e269f4", + "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg19&chrom=chr15&start=96875497&end=96875558" + }, + "sequence": "CGGCGGCCGGTGGCCAGGGCGGCCCTGGCGGCCCGGGTAGCGACAAGCAGCAGCAGCAGCA", + "start": 96875497 + }, + "original_identity": { + "alt": "T", + "assembly": "GRCh38", + "chrom": "chr15", + "pos": 96332299, + "ref": "G" + }, + "pos": 96875528, + "ref": "G", + "source_location": "chr15:96332299", + "source_protein_label": "p.Gly65Val", + "source_url": "https://osteosarc.com/variant/NR2F2-chr15-96332299/", + "vaccine_count": 3, + "variant_id": "NR2F2-chr15-96332299" + } + } + ], + "data_version": "minimal-vaccine-rna-v2", + "dataset": "osteosarc", + "historical_import": { + "commit": "0cad5b275c852263a1c77722aa463fe5568b2c76", + "generator_path": "tests/data/osteosarc/expansion/fixtures.py", + "manifest_sha256": "d656e10c4c2a859e9d7a108e2df68a7bed04189074ae185cba2f1aaddd958e86", + "manifest_url": "https://raw.githubusercontent.com/openvax/isovar/0cad5b275c852263a1c77722aa463fe5568b2c76/tests/data/osteosarc/expansion/corpus/manifest.json", + "repository": "https://github.com/openvax/isovar" + }, + "interpretation": "Deliberately selected regression reads, not full-source coverage, independent platform samples, somatic truth or validated vaccine targets.", + "license_source": "https://registry.opendata.aws/sid-osteosarc/", + "original_vaccine_loci": 44, + "schema_version": 1, + "scope": "49 indexed-retrieval cases; one explicit template per case; not coverage or VAF", + "source_data_license": "CC0-1.0", + "species": "Homo sapiens", + "taxon_id": 9606 +} diff --git a/tests/test_bundles.py b/tests/test_bundles.py index 9aeb565..b427f7d 100644 --- a/tests/test_bundles.py +++ b/tests/test_bundles.py @@ -6,7 +6,14 @@ import pytest -from osteosarc import IntegrityError, export_bundle, generate_bundle, list_bundle, verify_bundle +from osteosarc import ( + IntegrityError, + export_bundle, + generate_bundle, + list_bundle, + subset_bundle, + verify_bundle, +) from osteosarc.bundles import pack_bundle from osteosarc.cache import digest from osteosarc.cli import main @@ -50,6 +57,59 @@ def test_generate_pack_export_verify_fresh_offline_directory(bam, tmp_path, monk assert sam == {"duplicates": tmp_path / "sam/duplicates.sam.gz"} +@pytest.mark.parametrize("header_policy", ["full", "compact"]) +def test_subset_preserves_provenance_and_outcomes_without_reselection(bam, tmp_path, monkeypatch, header_policy): + import osteosarc.bundles + + recipe = bundle_recipe(bam) + duplicate = next(key for key, count in record_multiset(bam).items() if count == 2) + recipe["members"]["keep/repeats"] = dict(source="rna", target="snv", + policy=dict(kind="exact", version=1, records={duplicate: 2})) + recipe["members"]["keep/empty"] = dict(source="rna", target="snv", policy=dict(kind="empty", version=1)) + recipe["sources"]["unused"] = copy.deepcopy(recipe["sources"]["rna"]) + recipe["targets"]["unknown"] = dict(kind="unresolved", reason="no coordinates") + recipe["members"]["keep/unknown"] = dict(source="unused", target="unknown", policy=dict(kind="empty", version=1)) + selection = select_fixtures(recipe, {"rna": bam}) + selection.headers["rna"]["HD"]["GO"] = "none" + selection.headers["rna"]["HD"]["SS"] = "coordinate:queryname" + selection.receipts["rna"]["source_receipt"] = dict(url="https://example.test/original.bam", sha256="a" * 64) + parent = tmp_path / "parent" + original = pack_bundle(selection, parent, header_policy=header_policy) + names = [name for name in original["members"] if name.startswith("keep/")] + monkeypatch.setattr(osteosarc.bundles, "select_fixtures", lambda *a, **kw: pytest.fail("reselected reads")) + bam.unlink() + child = tmp_path / "child" + result = subset_bundle(parent, names, child, recipe_id="library-subset") + assert verify_bundle(child) == result + assert result["members"] == {name: original["members"][name] for name in names} + assert result["sources"]["rna"]["records"] == {duplicate: 2} + assert (child / "acquisition.json").read_bytes() == (parent / "acquisition.json").read_bytes() + header = original["sources"]["rna"]["original_header"] + assert (child / header).read_bytes() == (parent / header).read_bytes() + assert result["parent"]["manifest_sha256"] == digest(parent / "manifest.json") + assert result["header_policy"] == header_policy + assert json.loads((child / "recipe.json").read_text())["id"] == "library-subset" + with pytest.raises(KeyError, match="Unknown bundle members"): + subset_bundle(parent, ["absent"], tmp_path / "absent") + assert not (tmp_path / "absent").exists() + with pytest.raises(TypeError, match="iterable"): + subset_bundle(parent, "keep/empty", tmp_path / "wrong") + # Sources with only unresolved members do not gain fabricated BAMs/receipts. + only = subset_bundle(parent, ["keep/unknown"], tmp_path / "unresolved") + assert only["sources"] == {} + + +def test_cli_subset_prefixes(bam, tmp_path, capsys): + parent = tmp_path / "parent" + generate_bundle(bundle_recipe(bam), parent, sources={"rna": bam}) + assert main(["--offline", "test-data", "make", str(tmp_path / "child"), "--from", str(parent), + "--member", "dupl", "--json"]) == 0 + assert set(json.loads(capsys.readouterr().out)["members"]) == {"duplicates"} + assert main(["--offline", "test-data", "make", str(tmp_path / "no-match"), "--from", str(parent), + "--member", "absent"]) == 1 + assert "No bundle member" in capsys.readouterr().err + + def test_cli_and_dataset_produce_same_bundle(bam, dataset, tmp_path, capsys): recipe = bundle_recipe(bam) path = tmp_path / "recipe.json" @@ -442,6 +502,15 @@ def test_a_bundles_library_fixtures_carry_forward_by_checksum(bam, tmp_path): assert subset["unplaced_mates"] is False records = list(read_records(bam)) assert match_records(records, subset["records"]) == subset["records"] + compact = bundle_fixtures(tmp_path / "bundle", compact_regions=True) + compact_subset = compact["isovar/planned.sam"] + assert compact_subset["records"] == exact["records"] + assert sum(end - start for _, start, end in compact_subset["regions"]) < 5000 + # One-base queries still retrieve the exact pinned records, including duplicates. + from osteosarc import Region, extract_reads + recovered = extract_reads(bam, [Region(c, s, e, "GRCh38") for c, s, e in compact_subset["regions"]], + cache=tmp_path / "compact-cache") + assert match_records(list(read_records(recovered.path)), exact["records"]) == exact["records"] with pytest.raises(IntegrityError, match="pinned records"): match_records(records[:1], subset["records"]) # A record with no position (an unaligned mate) makes the source keep them. @@ -458,12 +527,42 @@ def test_a_bundles_library_fixtures_carry_forward_by_checksum(bam, tmp_path): with_unplaced["sources"]["rna"]["archive_sha256"] = digest(unplaced) generate_bundle(with_unplaced, tmp_path / "with-unplaced", sources={"rna": unplaced}) assert bundle_fixtures(tmp_path / "with-unplaced")["isovar/x.sam"]["unplaced_mates"] is True + assert bundle_fixtures(tmp_path / "with-unplaced", compact_regions=True)["isovar/x.sam"]["unplaced_mates"] is True recipe["targets"]["fixture:isovar/x.sam"].pop("consumer") generate_bundle(recipe, tmp_path / "anonymous", sources={"rna": bam}) with pytest.raises(SchemaError, match="Can't carry isovar/x.sam"): bundle_fixtures(tmp_path / "anonymous") +def test_compact_carry_recovers_placed_unmapped_records(bam, tmp_path): + import pysam + + from osteosarc import Region, extract_reads + from osteosarc.shared import bundle_fixtures, match_records + + placed = tmp_path / "placed.bam" + with pysam.AlignmentFile(bam) as source, pysam.AlignmentFile(placed, "wb", template=source) as out: + read = pysam.AlignedSegment(out.header) + read.query_name, read.flag = "placed-unmapped", 4 + read.reference_id, read.reference_start = 0, 100 + read.query_sequence, read.query_qualities = "ACGT", [40] * 4 + out.write(read) + out.write(read) # Keep exact multiplicity, too. + pysam.index(str(placed)) + recipe = bundle_recipe(placed) + recipe["targets"] = {"fixture": dict(kind="fixture", assembly="GRCh38", reference=dict(source="library"), + consumer="isovar", description="Placed-unmapped records", regions=[["chr1", 100, 101]])} + recipe["members"] = {"isovar/placed.bam": dict(source="rna", target="fixture", + policy=dict(kind="exact", version=1, records=dict(record_multiset(placed))))} + generate_bundle(recipe, tmp_path / "bundle", sources={"rna": placed}) + carried = bundle_fixtures(tmp_path / "bundle", compact_regions=True)["isovar/placed.bam"] + assert carried["regions"] == [["chr1", 100, 101]] + assert carried["unplaced_mates"] is False + recovered = extract_reads(placed, [Region(c, s, e, "GRCh38") for c, s, e in carried["regions"]], + cache=tmp_path / "cache") + assert match_records(list(read_records(recovered.path)), carried["records"]) == record_multiset(placed) + + def test_fresh_lists_replace_a_librarys_carried_fixtures(tmp_path): import gzip diff --git a/tests/test_comprehensive_audit.py b/tests/test_comprehensive_audit.py new file mode 100644 index 0000000..66ac7ea --- /dev/null +++ b/tests/test_comprehensive_audit.py @@ -0,0 +1,140 @@ +"""Receipt attribution and truthful packaging, using small indexed control BAMs.""" + +import copy +import gzip +import json +import tarfile +from pathlib import Path + +import pysam +import pytest + +from osteosarc import IntegrityError +from osteosarc.cache import digest +from osteosarc.corpus import snv_read_support, verify_control_extracts +from scripts.shared_test_data import ( + audit_comprehensive, + package_comprehensive, + verify_evidence_comprehensive, +) + +INPUT = Path(__file__).parent / "data/comprehensive" + + +@pytest.fixture +def controls(bam, tmp_path): + output = tmp_path / "output" + directory = output / "controls" + directory.mkdir(parents=True) + control = dict(snapshot=json.loads((INPUT / "spec.json").read_text())["snapshot"], + catalog_sha256=digest(INPUT / "catalog.json.gz"), files={}, audits=[], acquisition={}) + for label in ("rna-a", "rna-b"): + path = directory / (label + ".bam") + with pysam.AlignmentFile(bam) as source, pysam.AlignmentFile(path, "wb", template=source) as out: + for read in source: + read.query_name = label + ":" + read.query_name + out.write(read) + pysam.index(str(path)) + url = "https://example.test/" + path.name + sha256, index_sha256 = digest(path), digest(str(path) + ".bai") + control["files"].update({path.name: sha256, path.name + ".bai": index_sha256}) + control["acquisition"][label] = dict( + request=dict(source=url, snapshot_id=control["snapshot"]["id"]), + files={"reads.bam": sha256, "reads.bam.bai": index_sha256}) + control["audits"].append(dict(source=label, source_url=url, variant_id="control", + extract_file="controls/" + path.name, source_extract_sha256=sha256)) + return output, control + + +def test_controls_bind_the_delivered_files_to_receipts(controls): + output, control = controls + verify_control_extracts(output, control) + + +@pytest.mark.parametrize("change, message", [ + ("urls", "source URL"), ("bam", "Control BAM"), ("index", "Control index"), + ("missing_receipt", "acquisition receipts"), ("snapshot", "snapshot"), + ("missing_inventory", "Control BAM"), ("conflicting_rows", "Conflicting control"), +]) +def test_recountable_files_cannot_override_the_original_receipts(controls, change, message): + output, control = controls + a, b = control["audits"] + if change == "urls": + a["source_url"], b["source_url"] = b["source_url"], a["source_url"] + elif change == "bam": + # The substituted extract still agrees with its inventory and row hash. + a["extract_file"], a["source_extract_sha256"] = b["extract_file"], b["source_extract_sha256"] + elif change == "index": + path = output / (a["extract_file"] + ".bai") + path.write_bytes(path.read_bytes() + b"changed") + control["files"][path.name] = digest(path) + elif change == "missing_receipt": + del control["acquisition"][a["source"]] + elif change == "snapshot": + control["acquisition"][a["source"]]["request"]["snapshot_id"] = "another-snapshot" + elif change == "missing_inventory": + del control["files"][Path(a["extract_file"]).name] + elif change == "conflicting_rows": + control["audits"].append(dict(a, extract_file=b["extract_file"])) + with pytest.raises(IntegrityError, match=message): + verify_control_extracts(output, control) + + +@pytest.mark.parametrize("audit", [verify_evidence_comprehensive.verify, audit_comprehensive.audit]) +def test_both_audits_reject_swapped_source_urls_before_recounting(controls, audit): + output, control = controls + a, b = control["audits"] + a["source_url"], b["source_url"] = b["source_url"], a["source_url"] + (output / "controls/audit.json").write_text(json.dumps(control)) + with pytest.raises(IntegrityError, match="source URL differs"): + audit(output) + + +@pytest.mark.parametrize("has_alt", [False, True]) +def test_packaged_readme_matches_actual_control_recounts(controls, tmp_path, monkeypatch, has_alt): + output, control = controls + root = tmp_path / "reproduction" + inputs = root / "tests/data/comprehensive" + inputs.mkdir(parents=True) + # Only the catalogue fixture is stubbed; receipt checks, indexed recounts, + # evidence report, archive and its README are all produced by the real code. + ref, alt = ("C", "A") if has_alt else ("A", "C") + catalog = dict(variants={"control": dict(allele=["chr1", 101, ref, alt])}, + count_sources={row["source"]: dict(assay_type="RNA", files=[dict(url=row["source_url"])]) + for row in control["audits"]}, + negative_controls=[dict(variant_id="control")], known_rna_disagreements=[], summary={}) + (inputs / "catalog.json.gz").write_bytes(gzip.compress(json.dumps(catalog).encode())) + (inputs / "inputs.json.gz").write_bytes(gzip.compress(b"{}")) + spec = dict(id="test-reads", snapshot=control["snapshot"], redistribution=dict(license="CC0-1.0"), + sources=dict(all_targets=[row["source_url"] for row in control["audits"]])) + (inputs / "spec.json").write_text(json.dumps(spec)) + (inputs / "checksums.json").write_text(json.dumps({p.name: digest(p) for p in inputs.iterdir()})) + for name in ("pyproject.toml", "README.md", "LICENSE", "MANIFEST.in"): + (root / name).write_text("test fixture\n") + control["catalog_sha256"] = digest(inputs / "catalog.json.gz") + for row in control["audits"]: + with pysam.AlignmentFile(output / row["extract_file"]) as source: + row.update(snv_read_support(source.fetch("chr1", 100, 101), 101, ref, alt)) + (output / "controls/audit.json").write_text(json.dumps(control)) + monkeypatch.setattr(verify_evidence_comprehensive, "INPUT", inputs) + monkeypatch.setattr(verify_evidence_comprehensive, "AUDIT_SNVS", ("control",)) + monkeypatch.setattr(verify_evidence_comprehensive, "NEGATIVE_CONTROLS", ("control",)) + monkeypatch.setattr(verify_evidence_comprehensive, "evidence_catalog", lambda inputs: copy.deepcopy(catalog)) + monkeypatch.setattr(package_comprehensive, "INPUT", inputs) + monkeypatch.setattr(package_comprehensive, "ROOT", root) + monkeypatch.setattr(package_comprehensive.subprocess, "check_output", lambda *a, **kw: "review-test\n") + package_comprehensive.package(output, evidence_only=True) + archive, = output.glob("*.tar.gz") + with tarfile.open(archive) as tar: + readme = tar.extractfile("README.md").read().decode() + report = json.load(tar.extractfile("audit/evidence-audit.json")) + assert "all 2 control recounts" in readme + assert report["tumor_rna_products_checked"] == 2 + if has_alt: + assert len(report["published_zero_rna_discrepancies"]) == 2 + assert all(row["templates"]["alt"] == 2 for row in report["published_zero_rna_discrepancies"]) + assert "not uniformly RNA-negative" in readme + assert "zero high-quality ALT templates" not in readme + else: + assert report["published_zero_rna_discrepancies"] == [] + assert "zero high-quality ALT templates in all 2 tested tumor RNA products" in readme diff --git a/tests/test_corpus.py b/tests/test_corpus.py new file mode 100644 index 0000000..664caa8 --- /dev/null +++ b/tests/test_corpus.py @@ -0,0 +1,202 @@ +"""Completeness and anti-false-negative checks on the frozen real evidence.""" + +import copy +from pathlib import Path + +import pytest + +from osteosarc import IntegrityError +from osteosarc.cache import digest +from osteosarc.corpus import ( + COUNT_FIELDS, + count_matrix, + counts, + evidence_catalog, + negative_controls, + support_status, + vaccine_membership, +) +from osteosarc.shared import read_json + +FOLDER = Path(__file__).parent / "data/comprehensive" + + +@pytest.fixture(scope="module") +def inputs(): + return read_json(FOLDER / "inputs.json.gz") + + +@pytest.fixture(scope="module") +def catalog(inputs): + return evidence_catalog(inputs) + + +def test_real_catalogue_rebuilds_exactly_and_inputs_are_pinned(catalog): + for name, checksum in read_json(FOLDER / "checksums.json").items(): + assert digest(FOLDER / name) == checksum + assert catalog == read_json(FOLDER / "catalog.json.gz") + assert catalog["summary"] == read_json(FOLDER / "summary.json") + + +def test_every_vaccine_assertion_is_preserved(inputs, catalog): + vaccinated = {vid for vid, v in catalog["variants"].items() if v["vaccine"]["included"]} + assert len(vaccinated) == 51 + index = {v["id"] for v in inputs["variants"] if (v.get("vaccine_count") or 0) > 0} + assert len(index) == 44 and index <= vaccinated + assert vaccinated - index == { + "ABI3BP-chr3-100850671", "ANKRD17-chr4-73097139", "ASPM-chr1-197102716", + "EXD3-chr9-137373504", "PPP1R3F-chrX-49270761", "PRRC2C-chr1-171540477", "SPG11-chr15-44660435"} + assert len(catalog["vaccine_rows"]) == len(inputs["vaccine_rows"]) == 38 + tecpr1 = catalog["variants"]["TECPR1-chr7-98241127"]["vaccine"] + assert len(tecpr1["overlap_rows"]) == 2 + assert set(tecpr1["overlap_union"]) == {"mRNA", "JLF V1", "JLF V2", "JLF V3", "CeGaT"} + assert catalog["variants"]["ABCF2-chr7-151218156"]["vaccine"]["vaccines_union"] == ["Cure 2024"] + + +def test_matrix_has_every_variant_product_pair_including_missing(catalog): + matrix = catalog["allele_support"] + expected = {(vid, bam) for vid in catalog["variants"] for bam in catalog["count_sources"]} + assert len(matrix) == len(expected) == 7474 + assert {(r["variant_id"], r["bam_file"]) for r in matrix} == expected + assert all(r["total_reads"] is None for r in matrix if r["status"] == "not_measured") + assert all(r["total_reads"] == 0 for r in matrix if r["status"] == "no_coverage") + assert all(r["ref_reads"] > 0 and r["alt_reads"] == 0 for r in matrix if r["status"] == "covered_no_alt") + assert {r["timepoint"] for r in matrix if r["assay_type"] in {"RNA", "scRNA", "scRNA_ONT"}} == { + "T0", "T1", "T2", "T3"} + + +def test_negative_controls_have_matched_dna_and_explicit_rna_coverage(catalog): + assert len(catalog["negative_controls"]) == 4 + for control in catalog["negative_controls"]: + assert control["tumor_rna_products_checked"] == 15 + assert control["comparisons"] + classes = {c["variant_id"]: c["control_class"] for c in catalog["negative_controls"]} + assert classes == { + "ACE-chr17-63497361": "covered_rna_no_alt", + "BTN3A3-chr6-26448446": "covered_rna_no_alt", + "CTSE-chr1-206022947": "insufficient_rna_coverage", + "DBH-chr9-133652279": "insufficient_rna_coverage", + } + for c in catalog["negative_controls"]: + assert all(bool(m["covered_rna"]) == (c["control_class"] == "covered_rna_no_alt") + for m in c["comparisons"]) + btn = next(c for c in catalog["negative_controls"] if c["variant_id"].startswith("BTN3A3-")) + assert [(r["tissue"], r["assay"], r["depth"], r["vaf"]) for r in btn["nonzero_rna_summary_exceptions"]] == [ + ("blood", "CITE", 435, 0.0023)] + + +def test_historical_rna_prevents_false_negative_claims(inputs, catalog): + disagreements = catalog["known_rna_disagreements"] + assert {r["variant_id"] for r in disagreements} == {"NR2F2-chr15-96332299"} + assert any(r["observed_before_sampling"]["alt"] == 7 for r in disagreements) + changed = copy.deepcopy(inputs) + row = copy.deepcopy(disagreements[0]) + row["variant_id"] = "ACE-chr17-63497361" + changed["historical_rna"].append(row) + with pytest.raises(IntegrityError, match="historical RNA support"): + evidence_catalog(changed) + + +def test_other_tumor_rna_summaries_cannot_be_ignored(inputs): + changed = copy.deepcopy(inputs) + variant = next(v for v in changed["variants"] if v["id"] == "ACE-chr17-63497361") + row = next(r for r in variant["annotations"]["source_record"]["vafs"] + if r["assay"] == "RNA" and r["tissue"] == "tumor") + row["vaf"] = 0.01 + with pytest.raises(IntegrityError, match="nonzero tumor RNA summary"): + evidence_catalog(changed) + + +@pytest.mark.parametrize("change", [{"alt_reads": 1}, {"alt_reads": None}, {"status": "not_measured"}]) +def test_a_negative_control_cannot_hide_positive_or_missing_rna(inputs, catalog, change): + matrix = copy.deepcopy(catalog["allele_support"]) + row = next(r for r in matrix if r["variant_id"] == "ACE-chr17-63497361" and r["assay_type"] == "RNA") + row.update(change) + with pytest.raises(IntegrityError, match="alternate or unmeasured"): + negative_controls(inputs["variants"], matrix) + + +def test_negative_control_requires_covered_rna_at_dna_timepoint(inputs, catalog): + matrix = copy.deepcopy(catalog["allele_support"]) + for row in matrix: + if row["variant_id"] == "ACE-chr17-63497361" and row["timepoint"] == "T1" and row["assay_type"] in {"RNA", "scRNA", "scRNA_ONT"}: + row.update(ref_reads=0, alt_reads=0, other_reads=0, total_reads=0, status="no_coverage") + with pytest.raises(IntegrityError, match="No matched"): + negative_controls(inputs["variants"], matrix) + + +def test_missing_zero_other_only_and_invalid_counts_are_distinct(): + assert support_status(counts({})) == "not_measured" + assert support_status(counts(dict.fromkeys(COUNT_FIELDS, "0"))) == "no_coverage" + assert support_status(counts(dict(ref_reads=0, alt_reads=0, other_reads=3, total_reads=3))) == "other_only" + for bad in ("-1", "1.5", "nan", True): + with pytest.raises(IntegrityError): + counts(dict(ref_reads=bad)) + with pytest.raises(IntegrityError, match="differs from depth"): + counts(dict(ref_reads=10, alt_reads=2, other_reads=0, total_reads=10)) + + +def test_ambiguous_vaccine_join_duplicate_evidence_and_wrong_allele_fail(inputs): + duplicate = copy.deepcopy(inputs["variants"]) + duplicate.append(next(v for v in duplicate if v["id"] == "SMC5-chr9-70298024")) + with pytest.raises(IntegrityError, match="joins 2 alleles"): + vaccine_membership(duplicate, inputs["vaccine_rows"]) + with pytest.raises(IntegrityError, match="Duplicate evidence"): + count_matrix(inputs["variants"], inputs["counts"] + inputs["counts"][:1]) + rows = copy.deepcopy(inputs["counts"]) + rows[0]["pos"] = str(int(rows[0]["pos"]) + 1) + with pytest.raises(IntegrityError, match="another allele"): + count_matrix(inputs["variants"], rows) + + +def test_structural_catalogue_keeps_unsupported_and_exact_allele_evidence(catalog): + candidates = catalog["structural_candidates"]["targets"] + assert len(candidates) == 637 + evidence = [e for v in candidates.values() for e in v.get("rna_evidence", [])] + assert any(e["status"] == "no_observed_adjacency" for e in evidence) + assert any(e.get("exact_DNA_allele_20bp_templates") for e in evidence) + assert any(e.get("exact_DNA_allele_20bp_templates") is None for e in evidence) + + +def test_new_spec_preserves_old_release_and_sets_explicit_fusion_sides(): + from osteosarc.shared import structural_targets + spec = read_json(FOLDER / "spec.json") + assert spec["selection"]["split_depth"] == 1_000_000 + targets, _, _ = structural_targets(spec) + for name, sides in {"GABBR1--SLC29A1": ["right", "right"], "OTUD7A--FMN1": ["right", "right"], + "PARD3B--CDKN2B-AS1-CDKN2B": ["left", "right"]}.items(): + assert [end["retained_side"] for end in targets[name]["breakends"]] == sides + + +def test_independent_snv_recount_collapses_mates_and_preserves_quality_unknowns(): + import pysam + + from osteosarc.corpus import snv_read_support + header = pysam.AlignmentHeader.from_dict(dict(SQ=[dict(SN="chr1", LN=100)])) + + def read(name, base="T", quality=40, mapq=60, flag=0, nh=None, rg=None): + r = pysam.AlignedSegment(header) + r.query_name, r.reference_id, r.reference_start = name, 0, 0 + r.flag, r.mapping_quality, r.cigarstring = flag, mapq, "10M" + r.query_sequence = "AAA" + base + "AAAAAA" + r.query_qualities = None if quality is None else [quality] * 10 + if nh is not None: + r.set_tag("NH", nh) + if rg is not None: + r.set_tag("RG", rg) + return r + + records = [read("alt"), read("alt"), read("ref", "G"), + read("conflict", "G"), read("conflict", "T"), + read("same-name", rg="a"), read("same-name", rg="b"), + read("star", mapq=255, nh=1), read("unknown-mapq", mapq=255), + read("no-qual", quality=None), read("unknown-qual", quality=255), + read("low-bq", quality=19), read("low-mq", mapq=19), + read("duplicate", flag=1024), read("secondary", flag=256), read("supplementary", flag=2048)] + result = snv_read_support(records, 4, "G", "T") + assert result["templates"] == dict(alt=4, ref=1, other=1) + assert result["filtered_records"] == dict(flag_filtered=3, low_base_quality=1, low_mapping_quality=1, + missing_base_quality=2, unknown_mapping_quality=1) + assert result["measured_before_sampling"] is True + with pytest.raises(ValueError, match="single-base"): + snv_read_support(records, 4, "GG", "T") diff --git a/tests/test_fixtures.py b/tests/test_fixtures.py index f6cb854..6dec947 100644 --- a/tests/test_fixtures.py +++ b/tests/test_fixtures.py @@ -103,6 +103,20 @@ def test_panels_are_offline_copies(): assert load_panel("sv-regressions-v1")["SV0461"]["kind"] == "sv" +def test_v2_fusion_retained_sides_preserve_historical_panel(): + old = load_panel("sv-regressions-v1") + new = load_panel("sv-regressions-v2") + for name, sides in {"GABBR1-SLC29A1": ["right", "right"], + "OTUD7A-FMN1": ["right", "right"], + "PARD3B-CDKN2B": ["left", "right"]}.items(): + assert [e["retained_side"] for e in new[name]["breakends"]] == sides + assert all("retained_side" not in e for e in old[name]["breakends"]) + assert [e["position"] for e in new[name]["breakends"]] == [e["position"] for e in old[name]["breakends"]] + assert new["SV0055"] == old["SV0055"] + new["GABBR1-SLC29A1"]["breakends"].clear() + assert len(load_panel("sv-regressions-v2")["GABBR1-SLC29A1"]["breakends"]) == 2 + + def test_streamed_records_and_regions_match_materialized_selection(bam): from osteosarc import Region records = list(read_records(bam)) diff --git a/tests/test_provenance.py b/tests/test_provenance.py new file mode 100644 index 0000000..1d90022 --- /dev/null +++ b/tests/test_provenance.py @@ -0,0 +1,63 @@ +import copy +import json +from pathlib import Path + +import pytest + +from osteosarc import File, IntegrityError +from osteosarc.cache import digest +from osteosarc.models import Files +from osteosarc.provenance import audit_alignment_overlap, evidence_overlaps + +DATA = Path(__file__).parent / "data/evidence-overlap" +REGISTRY = Path(__file__).parents[1] / "osteosarc/data/evidence-overlaps.json" + + +def test_real_overlap_is_reproducible_including_qualities_and_multiplicity(): + group, = json.loads(REGISTRY.read_text())["groups"] + paths = [DATA / source["regional_bam"] for source in group["sources"]] + receipts = json.loads((DATA / "receipts.json").read_text()) + for source, path in zip(group["sources"], paths): + assert digest(path) == source["regional_bam_sha256"] + assert receipts[source["id"]]["request"]["source"] == source["url"] + assert receipts[source["id"]]["files"]["reads.bam"] == digest(path) + observed = audit_alignment_overlap(*paths) + assert observed == group["audit"] + assert observed["shared_records_excluding_tags"] == 40684 + assert observed["different_a"] == observed["different_b"] == 12 + assert observed["shared_names"] == observed["union_names"] == 18971 + published = group["published_delivery_alias"] + assert digest(DATA / "fastqs-consolidated.tsv") == published["source"]["receipt"]["sha256"] + assert any("Duplicate delivery of TL-24-ALMY2X4KMV RNA" in row["notes"] + for row in published["source"]["rows"]) + for mate in ("1", "3"): + objects = [o for o in published["objects"] if o["mate"] == mate] + assert len(objects) == 2 + assert objects[0]["headers"]["ETag"] == objects[1]["headers"]["ETag"] + assert objects[0]["headers"]["Content-Length"] == objects[1]["headers"]["Content-Length"] + + +def test_selection_preserves_labels_requires_explicit_preference_and_reports_exclusion(): + group, = json.loads(REGISTRY.read_text())["groups"] + sources = group["sources"] + files = Files([File(s["id"], s["url"].split(".com/", 1)[1], s["url"], "alignment", "bam", + metadata=dict(original_label=s["id"])) for s in sources], source={"snapshot_id": "pinned"}) + before = copy.deepcopy([f.metadata for f in files]) + assert len(files.overlap_groups) == 1 + with pytest.raises(IntegrityError, match="known overlapping evidence"): + files.require_no_known_overlaps() + with pytest.raises(ValueError, match="exactly one"): + files.without_known_overlaps() + with pytest.raises(ValueError, match="exactly one"): + files.without_known_overlaps(prefer=[f.url for f in files]) + selected = files.without_known_overlaps(prefer=[files[1].url]) + assert list(selected) == [files[1]] + assert selected.require_no_known_overlaps() is selected + assert selected.source["snapshot_id"] == "pinned" + assert selected.source["excluded_evidence_overlaps"][0]["url"] == files[0].url + assert [f.metadata for f in files] == before + # The same sample name in a different processing product is not enough. + assert evidence_overlaps(files[0].url.replace("out.md.bam", "out.bam")) == [] + found = files[0].evidence_overlaps + found[0]["status"] = "modified" + assert files[0].evidence_overlaps[0]["status"] == "biological_identity_unresolved" diff --git a/tests/test_retrieval.py b/tests/test_retrieval.py new file mode 100644 index 0000000..cb232c8 --- /dev/null +++ b/tests/test_retrieval.py @@ -0,0 +1,55 @@ +import copy +import json +from pathlib import Path + +import pytest + +from osteosarc import CoordinateError, IntegrityError +from osteosarc.retrieval import ( + annotate_retrieval_case, + annotate_retrieval_manifest, + assert_compatible_retrieval_cases, + load_retrieval_cases, +) + +DATA = Path(__file__).parent / "data/retrieval" + + +def test_native_coordinates_and_contigs_reproduce_reviewed_cases(): + original = json.loads((DATA / "historical-manifest.json").read_text()) + before = copy.deepcopy(original) + annotated = annotate_retrieval_manifest(original, DATA) + shipped = {c["case_id"]: c for c in load_retrieval_cases()["cases"]} + assert len(shipped) == 49 + assert annotated["data_version"] != original["data_version"] + assert original == before + for case in annotated["cases"]: + assert case == shipped[case["case_id"]] + normal, rcrs, hg19, nr2f2 = annotated["cases"] + assert normal["native_variant"]["chrom"] == "chr7" + assert rcrs["native_variant"]["chrom"] == "MT" + assert rcrs["native_variant"]["assembly"] == "GRCh37" + assert rcrs["native_variant"]["pos"] == 12994 + assert rcrs["reference"]["mitochondrial_reference"] == "rCRS" + assert rcrs["reference"]["validation_genome"] == "hg38" + assert hg19["query_region"]["reference_length"] == 16571 + assert hg19["native_variant"]["pos"] == 12995 + assert nr2f2["native_variant"]["pos"] == 96875528 + assert nr2f2["catalogue_identity"]["pos"] == 96332299 + assert_compatible_retrieval_cases([hg19, nr2f2]) + with pytest.raises(CoordinateError, match="different reference dictionaries"): + assert_compatible_retrieval_cases(annotated["cases"]) + with pytest.raises(CoordinateError, match="different reference dictionaries"): + assert_compatible_retrieval_cases([rcrs, hg19]) + + +def test_bad_native_allele_or_reference_is_an_error(): + cases = json.loads((DATA / "historical-manifest.json").read_text())["cases"] + changed = copy.deepcopy(cases[-1]) + changed["variant"]["pos"] = 96332299 # ID is GRCh38; this BAM is GRCh37. + with pytest.raises(IntegrityError, match="native allele"): + annotate_retrieval_case(changed, DATA / changed["bam"]) + changed = copy.deepcopy(cases[1]) + changed["variant"]["genomic_validation"]["genome"] = "hg19" + with pytest.raises(CoordinateError, match="Reference length mismatch"): + annotate_retrieval_case(changed, DATA / changed["bam"]) diff --git a/tests/test_shared.py b/tests/test_shared.py index 827ef77..3309dcb 100644 --- a/tests/test_shared.py +++ b/tests/test_shared.py @@ -316,7 +316,7 @@ def test_a_bundle_spec_says_what_it_needs(dataset): assert bundle_spec(dataset, "x", variants=["DYNC1H1-chr14-101980529"], files=[key], unplaced_mates=True)["selection"]["unplaced_mates"] is True assert bundle_spec(dataset, "x", svs=["GABBR1-SLC29A1"], files=[key])["targets"]["structural"][0]["from"] == { - "panel": "sv-regressions-v1", "id": "GABBR1-SLC29A1"} + "panel": "sv-regressions-v2", "id": "GABBR1-SLC29A1"} with pytest.raises(ValueError, match="did you mean DYNC1H1-chr14-101980529"): bundle_spec(dataset, "x", variants=["DYNC1H1-chr14-101980528"], files=[key]) with pytest.raises(ValueError, match="No SV"): @@ -553,6 +553,31 @@ def test_kept_templates_keep_their_split_alignments_when_the_spec_asks(dataset, crowded = build_shared_recipe(spec, dataset, required={}, log=logged.append) assert crowded["sources"] == plain["sources"] and crowded["members"] == plain["members"] assert "left out 1 region of split alignments in a pileup" in "\n".join(logged) + # A new spec may raise the cap without changing the behavior of published specs. + spec["selection"]["split_depth"] = 1_000_000 + expanded = build_shared_recipe(spec, dataset, required={}, log=lambda text: None) + assert expanded["members"] == split["members"] and expanded["sources"] == split["sources"] + assert expanded["selection"]["split_depth"] == 1_000_000 + checkpoints = tmp_path / "selections" + saved = build_shared_recipe(spec, dataset, required={}, log=lambda text: None, checkpoint=checkpoints) + with monkeypatch.context() as context: + context.setattr(dataset, "extract_reads", lambda *a, **kw: pytest.fail("repeated completed selection")) + assert build_shared_recipe(spec, dataset, required={}, log=lambda text: None, checkpoint=checkpoints) == saved + import json + checkpoint_path, = checkpoints.glob("*.json") + state = json.loads(checkpoint_path.read_text()) + state["result"]["records"] += 1 + checkpoint_path.write_text(json.dumps(state)) + with pytest.raises(IntegrityError, match="Invalid source-selection checkpoint"): + build_shared_recipe(spec, dataset, required={}, log=lambda text: None, checkpoint=checkpoints) + for value in (0, -1, True, 1.5, "1000000"): + spec["selection"]["split_depth"] = value + with pytest.raises(shared.SchemaError, match="positive integer"): + build_shared_recipe(spec, dataset, required={}, log=lambda text: None) + spec["selection"]["split_depth"] = 1_000_000 + spec["selection"]["split_regions"] = 0 + with pytest.raises(shared.SchemaError, match="split_regions"): + build_shared_recipe(spec, dataset, required={}, log=lambda text: None) def test_sv_targets_keep_their_retained_sides_and_inserted_sequence():