diff --git a/pvactools/lib/aggregate_all_epitopes.py b/pvactools/lib/aggregate_all_epitopes.py index 60188ea4f..212730e88 100644 --- a/pvactools/lib/aggregate_all_epitopes.py +++ b/pvactools/lib/aggregate_all_epitopes.py @@ -20,6 +20,10 @@ class AggregateAllEpitopes: def __init__(self): self.hla_types = pd.read_csv(self.input_file, delimiter="\t", usecols=["HLA Allele"])['HLA Allele'].unique() + if self.limiting_alleles: + extra_alleles = list(set(self.limiting_alleles) - set(self.hla_types)) + if len(extra_alleles) > 0: + raise Exception(f"Alleles specified in the --alleles parameter not found in the input file: {extra_alleles.join(', ')}") thresholds = {} for hla_type in self.hla_types: threshold = PredictionClass.cutoff_for_allele(hla_type) @@ -387,6 +391,7 @@ def __init__( anchor_contribution_threshold=0.8, aggregate_inclusion_binding_threshold=5000, aggregate_inclusion_count_limit=15, + limiting_alleles=None, ): self.input_file = input_file self.output_file = output_file @@ -414,6 +419,7 @@ def __init__( self.mt_top_score_metric = "Best" self.wt_top_score_metric = "Corresponding" self.top_score_metric2 = top_score_metric2 + self.limiting_alleles = limiting_alleles self.metrics_file = output_file.replace('.tsv', '.metrics.json') super().__init__() self.anchor_calculator = AnchorResiduePass(binding_threshold, self.use_allele_specific_binding_thresholds, self.allele_specific_binding_thresholds, allele_specific_anchors, anchor_contribution_threshold, self.wt_top_score_metric) @@ -443,6 +449,8 @@ def calculate_clonal_vaf(self): def read_input_file(self, used_columns, dtypes): df = pd.read_csv(self.input_file, delimiter='\t', float_precision='high', low_memory=False, na_values="NA", keep_default_na=False, usecols=used_columns, dtype=dtypes) df = df.astype({"{} MT IC50 Score".format(self.mt_top_score_metric):'float'}) + if self.limiting_alleles: + df = df[df["HLA Allele"].isin(self.limiting_alleles)] return df def get_sub_df(self, all_epitopes_df, key): @@ -833,6 +841,7 @@ def __init__(self, top_score_metric2=["ic50", "combined_percentile"], aggregate_inclusion_binding_threshold=5000, aggregate_inclusion_count_limit=15, + limiting_alleles=None, ): self.input_file = input_file self.output_file = output_file @@ -850,6 +859,7 @@ def __init__(self, else: self.mt_top_score_metric = "Best" self.top_score_metric2 = top_score_metric2 + self.limiting_alleles = limiting_alleles self.metrics_file = output_file.replace('.tsv', '.metrics.json') super().__init__() @@ -867,6 +877,8 @@ def read_input_file(self, used_columns, dtypes): df = pd.read_csv(self.input_file, delimiter='\t', float_precision='high', low_memory=False, na_values="NA", keep_default_na=False, dtype={"Index": str}) df = df[df["{} IC50 Score".format(self.mt_top_score_metric)] != 'NA'] df = df.astype({"{} IC50 Score".format(self.mt_top_score_metric):'float'}) + if self.limiting_alleles: + df = df[df["HLA Allele"].isin(self.limiting_alleles)] return df def get_sub_df(self, all_epitopes_df, key): @@ -951,6 +963,7 @@ def __init__( expn_val=0.1, aggregate_inclusion_binding_threshold=5000, aggregate_inclusion_count_limit=15, + limiting_alleles=None, ): UnmatchedSequenceAggregateAllEpitopes.__init__( self, @@ -966,6 +979,7 @@ def __init__( top_score_metric2=top_score_metric2, aggregate_inclusion_binding_threshold=aggregate_inclusion_binding_threshold, aggregate_inclusion_count_limit=aggregate_inclusion_count_limit, + limiting_alleles=limiting_alleles, ) self.read_support = read_support self.expn_val = expn_val @@ -1092,6 +1106,7 @@ def __init__( transcript_prioritization_strategy=['canonical', 'mane_select', 'tsl'], maximum_transcript_support_level=1, allow_incomplete_transcripts=False, + limiting_alleles=None, ): PvacbindAggregateAllEpitopes.__init__( self, @@ -1107,6 +1122,7 @@ def __init__( aggregate_inclusion_count_limit=aggregate_inclusion_count_limit, top_score_metric=top_score_metric, top_score_metric2=top_score_metric2, + limiting_alleles=limiting_alleles, ) self.tumor_purity = tumor_purity self.trna_vaf = trna_vaf @@ -1124,8 +1140,11 @@ def get_list_unique_mutation_keys(self, df): # pvacbind w/ Index instead of Mutation def read_input_file(self, used_columns, dtypes): - return pd.read_csv(self.input_file, delimiter='\t', float_precision='high', low_memory=False, + df = pd.read_csv(self.input_file, delimiter='\t', float_precision='high', low_memory=False, na_values="NA", keep_default_na=False, dtype={"Index": str}) + if self.limiting_alleles: + df = df[df["HLA Allele"].isin(self.limiting_alleles)] + return df def sort_included_df(self, df): return PvacspliceBestCandidate( diff --git a/pvactools/tools/pvacbind/generate_aggregated_report.py b/pvactools/tools/pvacbind/generate_aggregated_report.py index 0f2f5d7b6..4ad3549c3 100644 --- a/pvactools/tools/pvacbind/generate_aggregated_report.py +++ b/pvactools/tools/pvacbind/generate_aggregated_report.py @@ -83,6 +83,11 @@ def define_parser(): + "Whether the lowest or median is considered for each metric is controlled by the --top-score-metric parameter. ", default=['ic50', 'combined_percentile'], ) + parser.add_argument( + "--limiting-alleles", type=lambda s:[a for a in s.split(',')], + help="Comma-separated list of alleles used for the predictions made in the input file. " + + "If specified, only predictions for those alleles will be included in the aggregated report." + ) return parser def main(args_input = sys.argv[1:]): @@ -104,6 +109,7 @@ def main(args_input = sys.argv[1:]): top_score_metric=args.top_score_metric, aggregate_inclusion_binding_threshold=args.aggregate_inclusion_binding_threshold, aggregate_inclusion_count_limit=args.aggregate_inclusion_count_limit, + limiting_alleles=args.limiting_alleles, ).execute() print("Completed") diff --git a/pvactools/tools/pvacfuse/generate_aggregated_report.py b/pvactools/tools/pvacfuse/generate_aggregated_report.py index 0d0709b47..7f33d8b6e 100644 --- a/pvactools/tools/pvacfuse/generate_aggregated_report.py +++ b/pvactools/tools/pvacfuse/generate_aggregated_report.py @@ -93,6 +93,11 @@ def define_parser(): help="Expression Cutoff. Expression is meassured as FFPM (fusion fragments per million total reads). When failing this cutoff sites will be binned in the \"LowExpr\" tier.", default=0.1 ) + parser.add_argument( + "--limiting-alleles", type=lambda s:[a for a in s.split(',')], + help="Comma-separated list of alleles used for the predictions made in the input file. " + + "If specified, only predictions for those alleles will be included in the aggregated report." + ) return parser @@ -118,6 +123,7 @@ def main(args_input = sys.argv[1:]): expn_val=args.expn_val, aggregate_inclusion_binding_threshold=args.aggregate_inclusion_binding_threshold, aggregate_inclusion_count_limit=args.aggregate_inclusion_count_limit, + limiting_alleles=args.limiting_alleles, ).execute() print("Completed") diff --git a/pvactools/tools/pvacseq/generate_aggregated_report.py b/pvactools/tools/pvacseq/generate_aggregated_report.py index 5e932ada7..e7638c031 100644 --- a/pvactools/tools/pvacseq/generate_aggregated_report.py +++ b/pvactools/tools/pvacseq/generate_aggregated_report.py @@ -137,6 +137,11 @@ def define_parser(): + " As a result, a higher threshold leads to the inclusion of more positions to be considered anchors.", default=0.8 ) + parser.add_argument( + "--limiting-alleles", type=lambda s:[a for a in s.split(',')], + help="Comma-separated list of alleles used for the predictions made in the input file. " + + "If specified, only predictions for those alleles will be included in the aggregated report." + ) return parser @@ -168,6 +173,7 @@ def main(args_input = sys.argv[1:]): anchor_contribution_threshold=args.anchor_contribution_threshold, aggregate_inclusion_binding_threshold=args.aggregate_inclusion_binding_threshold, aggregate_inclusion_count_limit=args.aggregate_inclusion_count_limit, + limiting_alleles=args.limiting_alleles, ).execute() print("Completed") diff --git a/pvactools/tools/pvacsplice/generate_aggregated_report.py b/pvactools/tools/pvacsplice/generate_aggregated_report.py index d3936c173..8aa6bfc88 100644 --- a/pvactools/tools/pvacsplice/generate_aggregated_report.py +++ b/pvactools/tools/pvacsplice/generate_aggregated_report.py @@ -118,6 +118,11 @@ def define_parser(): default=1, choices=[1,2,3,4,5] ) + parser.add_argument( + "--limiting-alleles", type=lambda s:[a for a in s.split(',')], + help="Comma-separated list of alleles used for the predictions made in the input file. " + + "If specified, only predictions for those alleles will be included in the aggregated report." + ) return parser @@ -148,6 +153,7 @@ def main(args_input = sys.argv[1:]): top_score_metric2=args.top_score_metric2, aggregate_inclusion_binding_threshold=args.aggregate_inclusion_binding_threshold, aggregate_inclusion_count_limit=args.aggregate_inclusion_count_limit, + limiting_alleles=args.limiting_alleles, ).execute() print("Completed") diff --git a/tests/test_aggregate_all_epitopes.py b/tests/test_aggregate_all_epitopes.py index c3b6d712a..4695570f6 100644 --- a/tests/test_aggregate_all_epitopes.py +++ b/tests/test_aggregate_all_epitopes.py @@ -98,6 +98,37 @@ def test_aggregate_all_epitopes_HCC1395_pvacseq_normalized_percentiles_runs_and_ self.assertTrue(os.path.isfile(pvacview_file)) os.remove(pvacview_file) + def test_aggregate_all_epitopes_HCC1395_pvacseq_limiting_alleles_runs_and_produces_expected_output(self): + self.assertTrue(py_compile.compile(self.executable)) + output_file = tempfile.NamedTemporaryFile(suffix='.tsv') + self.assertFalse(PvacseqAggregateAllEpitopes( + os.path.join(self.test_data_dir, 'HCC1395_TUMOR_DNA.all_epitopes.short.tsv'), + output_file.name, + limiting_alleles=["HLA-C*06:02"] + ).execute()) + self.assertTrue(cmp( + output_file.name, + os.path.join(self.test_data_dir, "HCC1395.limiting_alleles.output.tsv"), + )) + + metrics_file = output_file.name.replace('.tsv', '.metrics.json') + self.assertTrue(cmp( + metrics_file, + os.path.join(self.test_data_dir, "HCC1395.limiting_alleles.output.metrics.json"), + )) + os.remove(metrics_file) + + for i in self.pvacview_r_files: + pvacview_file = os.path.join(os.path.dirname(output_file.name), i) + self.assertTrue(os.path.isfile(pvacview_file)) + os.remove(pvacview_file) + + for i in ["anchor.jpg", "pVACview_logo.png", "pVACview_logo_mini.png"]: + pvacview_file = os.path.join(os.path.dirname(output_file.name), "www", i) + self.assertTrue(os.path.isfile(pvacview_file)) + os.remove(pvacview_file) + + def test_aggregate_all_epitopes_all_class_i_pvacseq_runs_and_produces_expected_output(self): self.assertTrue(py_compile.compile(self.executable)) output_file = tempfile.NamedTemporaryFile(suffix='.tsv') diff --git a/tests/test_data/aggregate_all_epitopes/HCC1395.limiting_alleles.output.metrics.json b/tests/test_data/aggregate_all_epitopes/HCC1395.limiting_alleles.output.metrics.json new file mode 100644 index 000000000..5eeef18f7 --- /dev/null +++ b/tests/test_data/aggregate_all_epitopes/HCC1395.limiting_alleles.output.metrics.json @@ -0,0 +1,148183 @@ +{ + "tumor_purity": null, + "vaf_clonal": 0.5, + "vaf_subclonal": 0.25, + "binding_threshold": 500, + "aggregate_inclusion_binding_threshold": 5000, + "aggregate_inclusion_count_limit": 15, + "trna_vaf": 0.25, + "trna_cov": 10, + "allele_expr_threshold": 2.5, + "transcript_prioritization_strategy": [ + "canonical", + "mane_select", + "tsl" + ], + "maximum_transcript_support_level": 1, + "binding_percentile_threshold": 2.0, + "immunogenicity_percentile_threshold": 2.0, + "presentation_percentile_threshold": 2.0, + "percentile_threshold_strategy": "conservative", + "use_allele_specific_binding_thresholds": false, + "mt_top_score_metric": "Median", + "wt_top_score_metric": "Median", + "top_score_metric2": [ + "ic50", + "combined_percentile" + ], + "allele_specific_binding_thresholds": { + "HLA-A*29:02": 641.0 + }, + "allele_specific_anchors": false, + "alleles": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "anchor_contribution_threshold": 0.8, + "epitope_lengths": [ + 8, + 9, + 10, + 11 + ], + "chr1-16006133-16006134-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TRVTPMGW": { + "ic50s_MT": [ + "X", + "X", + "X", + 17820.885 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.338 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 16.675 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.903 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 68.807 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 28785.08 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 47.476 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 44.889 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 46.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 72.79 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20016.381, + 37522.949, + 15625.39, + 10191.108, + "NA", + "NA", + 11187.042, + 29894.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36304.88, + 43140.99, + 28951.56, + 12653.213, + "NA", + "NA", + 22071.493, + 28618.6 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.314 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.542 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.0, + 35.0, + 16.0, + 13.0, + "NA", + "NA", + 16.675, + 59.36, + 42.101 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37.0, + 59.0, + 35.0, + 17.0, + "NA", + "NA", + 44.889, + 56.11, + 50.063 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 68.807 + ] + }, + "WT": { + "HLA-C*06:02": [ + 72.79 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.002, + 0.018, + 0.215 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.016 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.0, + 12.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.0, + 62.745 + ] + } + }, + "wt_peptide": "TRVTPMGG" + } + }, + "transcripts": [ + "ENST00000329454.2-SRARP-G/W-100" + ], + "transcript_expr": [ + 0.082 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 169 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.082 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.082 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.082, + "best_peptide_mt": "TRVTPMGW", + "best_peptide_wt": "TRVTPMGG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-16972417-16972418-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRRSSAPFC": { + "ic50s_MT": [ + "X", + "X", + "X", + 5372.915 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.264 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.259 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.727 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6036.635 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 9.225 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.05 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 28.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.543 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "9", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8302.68, + 5674.31, + 5071.52, + 1183.386, + 1049.083, + 229.388, + 7436.646, + 11101.72 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14161.29, + 8665.4, + 12930.01, + 1276.495, + 1049.083, + 285.476, + 19826.45, + 3407.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.262 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 2.0, + 4.8, + 2.1, + 9.4, + 3.1, + 11.687, + 21.51, + 14.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.5, + 3.1, + 14.0, + 2.4, + 9.4, + 3.6, + 36.114, + 9.05, + 13.988 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.877, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.813, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.727 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.543 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.0, + 0.013, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.005, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 46.225 + ] + } + }, + "wt_peptide": "LRRSSAPFS" + } + }, + "transcripts": [ + "ENST00000375541.10-CROCC-S/C-2009" + ], + "transcript_expr": [ + 2.147 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2017 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.147 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.147 + ], + "DNA VAF": 0.988, + "RNA VAF": 1.0, + "gene_expr": 11.754, + "best_peptide_mt": "LRRSSAPFC", + "best_peptide_wt": "LRRSSAPFS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-22576425-22576426-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ETFKLYYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 15039.103 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.865 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.415 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.713 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11537.401 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.832 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 16.109 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.983 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17148.199, + 22441.34, + 5900.97, + 12930.007, + "NA", + "NA", + 10805.56, + 23862.461 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16689.65, + 18491.61, + 3184.8, + 9759.454, + "NA", + "NA", + 13315.348, + 7496.22 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.465 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.725 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 12.0, + 4.5, + 17.0, + "NA", + "NA", + 16.156, + 45.06, + 3.816 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.8, + 7.7, + 2.6, + 12.0, + "NA", + "NA", + 20.123, + 15.75, + 5.964 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + "NA", + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.089, + "NA", + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.713 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.983 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.005, + 0.02, + 0.233 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.009, + 0.044 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 11.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 27.617 + ] + } + }, + "wt_peptide": "ETFNLYYL" + } + }, + "transcripts": [ + "ENST00000166244.8-EPHA8-N/K-123" + ], + "transcript_expr": [ + 0.001 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1005 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.001 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.001 + ], + "DNA VAF": 0.272, + "RNA VAF": 0.0, + "gene_expr": 0.001, + "best_peptide_mt": "ETFKLYYL", + "best_peptide_wt": "ETFNLYYL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-22660990-22660991-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KITFSATRTI": { + "ic50s_MT": [ + "X", + "X", + "X", + 16329.46 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.344 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.689 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 25.362 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.844 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14929.72 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.674 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.422 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.985 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7517.32, + 18173.27, + 14485.65, + 30396.066, + "NA", + "NA", + 19781.715, + 9672.36 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6018.13, + 14969.38, + 14252.45, + 36534.223, + "NA", + "NA", + 15021.314, + 14890.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.454 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.125 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 7.5, + 15.0, + 39.0, + "NA", + "NA", + 36.113, + 19.17, + 17.689 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 5.7, + 14.0, + 46.0, + "NA", + "NA", + 23.315, + 27.86, + 11.348 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.051, + 0.972, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.078, + 0.904, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.844 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.985 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.005, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.009, + 0.008, + 0.046 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.5, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 31.643 + ] + } + }, + "wt_peptide": "KIAFSATRTI" + }, + "ITFSATRTI": { + "ic50s_MT": [ + "X", + "X", + "X", + 431.595 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.453 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.56 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.353 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.133 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 293.963 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.145 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.47 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.115 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.085 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "HLA-C*06:02", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 306.43, + 470.7, + 392.49, + 1170.651, + 669.592, + 732.099, + 105.869, + 57.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 165.07, + 264.2, + 340.99, + 618.284, + 278.49, + 309.435, + 56.6, + 1025.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.105 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.07, + 0.17, + 0.56, + 2.1, + 7.0, + 7.4, + 0.346, + 0.58, + 0.117 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.11, + 0.47, + 0.7, + 3.6, + 3.8, + 0.085, + 4.22, + 0.068 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.942, + 0.136 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.063, + 0.95, + 0.161 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.133 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.085 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.322, + 0.126, + 0.627, + 0.205 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.493, + 0.539, + 0.864, + 0.408 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.14, + 0.566 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.179 + ] + } + }, + "wt_peptide": "IAFSATRTI" + } + }, + "transcripts": [ + "ENST00000509305.6-C1QB-A/T-121" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 251 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.984, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "KITFSATRTI", + "best_peptide_wt": "KIAFSATRTI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-27359862-27359863-T-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LHDNHIVHRDL": { + "ic50s_MT": [ + "X", + "X", + "X", + 8165.07 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.029 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.264 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.029 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.558 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11235.288 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.388 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.776 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.579 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.538 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25221.689, + 31350.01, + 1756.46, + 4778.521, + "NA", + "NA", + 11551.618, + 484.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25918.56, + 34339.11, + 2264.98, + 5324.554, + "NA", + "NA", + 17146.023, + 3903.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.147 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 21.0, + 1.7, + 4.2, + "NA", + "NA", + 17.242, + 2.64, + 9.264 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 27.0, + 2.2, + 5.0, + "NA", + "NA", + 28.471, + 9.94, + 11.776 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.036, + "NA", + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.035, + "NA", + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.538 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.018, + 0.033, + 0.388 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.006, + 0.014, + 0.257 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.5, + 7.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 16.158 + ] + } + }, + "wt_peptide": "LHDNHIVHRDI" + } + }, + "transcripts": [ + "ENST00000357582.3-MAP3K6-I/L-772" + ], + "transcript_expr": [ + 8.08 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1288 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 8.08 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 8.08 + ], + "DNA VAF": 0.26, + "RNA VAF": 0.315, + "gene_expr": 32.59, + "best_peptide_mt": "LHDNHIVHRDL", + "best_peptide_wt": "LHDNHIVHRDI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-27793606-27793607-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLKELGSLRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 11123.982 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.204 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.097 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.247 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 10.31 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18858.066 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.096 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.751 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21160.869, + 41507.27, + 9865.62, + 12382.345, + "NA", + "NA", + 7835.82, + 6175.79 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22507.74, + 43145.19, + 15208.39, + 15208.392, + "NA", + "NA", + 10437.219, + 26878.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.868 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.226 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.9, + 50.0, + 8.6, + 16.0, + "NA", + "NA", + 12.097, + 13.62, + 7.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 59.0, + 16.0, + 20.0, + "NA", + "NA", + 15.654, + 51.91, + 13.298 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.992, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.985, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 10.31 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.751 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.026, + 0.214 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.011, + 0.038 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 9.494 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 22.192 + ] + } + }, + "wt_peptide": "LLKELGSLPL" + } + }, + "transcripts": [ + "ENST00000373943.9-STX12-P/R-88" + ], + "transcript_expr": [ + 19.341 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 276 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 19.341 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 19.341 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 26.914, + "best_peptide_mt": "LLKELGSLRL", + "best_peptide_wt": "LLKELGSLPL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-36179726-36179728-GG-AA": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VQKEKPIPQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 26736.699 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 35.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 45.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.25 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 21.351 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 34130.013 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 45.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 51.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 16.328 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.822 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 34738.949, + 41454.762, + 37333.422, + 14252.448, + 14414.846, + 22313.619, + 7394.86, + 31159.779 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39655.96, + 43648.05, + 40708.92, + 14252.449, + 21223.158, + 39225.637, + 5035.017, + 29034.39 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.357 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 32.0, + 49.0, + 58.0, + 46.0, + 38.0, + 45.0, + 11.585, + 62.78, + 10.494 + ] + }, + "WT": { + "HLA-C*06:02": [ + 51.0, + 62.0, + 72.0, + 46.0, + 44.0, + 54.0, + 8.713, + 57.18, + 15.813 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.994, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + 0.995, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 21.351 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.822 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.018, + 0.088 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.023, + 0.058 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 13.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 10.656 + ] + } + }, + "wt_peptide": "VQKEEPIPQ" + } + }, + "transcripts": [ + "ENST00000474796.2-MAP7D1-EE/EK-763-764" + ], + "transcript_expr": [ + 24.171 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 840 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 24.171 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 24.171 + ], + "DNA VAF": 0.361, + "RNA VAF": "NA", + "gene_expr": 93.193, + "best_peptide_mt": "VQKEKPIPQ", + "best_peptide_wt": "VQKEEPIPQ", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-36179727-36179728-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VQKEKPIPQEP": { + "ic50s_MT": [ + "X", + "X", + "X", + 27898.93 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 25.723 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 41.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 23.116 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 18.666 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 29510.745 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 47.52 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.079 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 13.907 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 42440.512, + 46382.52, + 30893.41, + 18679.436, + "NA", + "NA", + 15970.74, + 24904.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43183.02, + 46539.89, + 34053.09, + 18679.435, + "NA", + "NA", + 11753.497, + 24968.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.476 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.379 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 67.0, + 84.0, + 41.0, + 25.0, + "NA", + "NA", + 25.445, + 47.36, + 18.114 + ] + }, + "WT": { + "HLA-C*06:02": [ + 72.0, + 85.0, + 49.0, + 25.0, + "NA", + "NA", + 17.64, + 47.52, + 16.233 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.037, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + "NA", + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 18.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.907 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.005, + 0.011, + 0.171 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.004, + 0.014, + 0.152 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 26.0, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.0, + 16.158 + ] + } + }, + "wt_peptide": "VQKEEPIPQEP" + } + }, + "transcripts": [ + "ENST00000373151.6-MAP7D1-E/K-765" + ], + "transcript_expr": [ + 6.418 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 841 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.418 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.418 + ], + "DNA VAF": 0.309, + "RNA VAF": 0.326, + "gene_expr": 93.193, + "best_peptide_mt": "VQKEKPIPQEP", + "best_peptide_wt": "VQKEEPIPQEP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-37721680-37721681-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GQFDHSHIVRM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2813.115 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.6 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.788 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.269 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3289.369 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.121 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.941 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17581.619, + 21360.539, + 1196.26, + 4429.969, + "NA", + "NA", + 148.776, + 47.59 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16824.19, + 23815.28, + 1196.26, + 5382.477, + "NA", + "NA", + 108.419, + 348.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.944 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.746 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.4, + 9.6, + 1.2, + 3.7, + "NA", + "NA", + 0.534, + 0.5, + 8.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.9, + 13.0, + 1.2, + 5.1, + "NA", + "NA", + 0.357, + 2.14, + 6.184 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.039, + "NA", + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + "NA", + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.941 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.061, + 0.93, + 0.883 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.074, + 0.954, + 0.922 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.5, + 0.076 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.2, + 0.041 + ] + } + }, + "wt_peptide": "GQFDHSHIVRL" + } + }, + "transcripts": [ + "ENST00000373048.9-EPHA10-L/M-709", + "ENST00000427468.6-EPHA10-L/M-709" + ], + "transcript_expr": [ + 0.002, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 5.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1008, + 1014 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.002 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.002 + ], + "DNA VAF": 0.382, + "RNA VAF": 0.0, + "gene_expr": 0.059, + "best_peptide_mt": "GQFDHSHIVRM", + "best_peptide_wt": "GQFDHSHIVRL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-39429921-39429922-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RTLQQARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3298.866 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.25 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.538 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.425 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2025.24 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.31 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.216 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.81 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5029.06, + 1435.41, + 3099.81, + 6195.392, + 3497.921, + 2633.722, + 188.213, + 4122.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2753.36, + 1275.22, + 1824.25, + 4196.68, + 2653.444, + 2226.23, + 81.152, + 1003.32 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.545 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.375 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 0.47, + 3.2, + 22.0, + 20.0, + 18.0, + 0.689, + 10.31, + 0.526 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.62, + 0.42, + 2.0, + 15.0, + 18.0, + 16.0, + 0.212, + 4.17, + 0.331 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.864, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.873, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.81 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.093, + 0.007, + 0.667, + 0.413 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.198, + 0.023, + 0.874, + 0.533 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.58, + 0.495 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.27, + 0.162 + ] + } + }, + "wt_peptide": "RTLEQARQL" + }, + "LRTLQQARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3989.228 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.51 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.916 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.793 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2966.797 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.755 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.159 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 27.338 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4002.78, + 4052.77, + 823.59, + 3975.676, + "NA", + "NA", + 4223.593, + 1773.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2816.02, + 3719.86, + 1242.43, + 3975.676, + "NA", + "NA", + 3117.573, + 1102.59 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.779 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.9 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.92, + 1.4, + 0.92, + 3.1, + "NA", + "NA", + 7.658, + 5.92, + 6.527 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.64, + 1.3, + 1.4, + 3.1, + "NA", + "NA", + 6.22, + 4.41, + 7.904 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.957, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.849, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.338 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.004, + 0.024, + 0.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.07, + 0.007, + 0.032, + 0.026 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 10.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.76, + 7.558 + ] + } + }, + "wt_peptide": "LRTLEQARQL" + } + }, + "transcripts": [ + "ENST00000564288.6-MACF1-E/Q-5662", + "ENST00000567887.5-MACF1-E/Q-5699", + "ENST00000671089.2-MACF1-E/Q-3549" + ], + "transcript_expr": [ + 4.875, + 0.0, + 28.96 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 5.0, + 5.0, + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 7555, + 7592, + 5379 + ], + "transcript_count": 3, + "peptide_count": 2, + "total_expr": 33.835 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 33.835 + ], + "DNA VAF": 0.333, + "RNA VAF": 0.372, + "gene_expr": 126.838, + "best_peptide_mt": "RTLQQARQL", + "best_peptide_wt": "RTLEQARQL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-43432295-43432296-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RRLHLPRHV": { + "ic50s_MT": [ + "X", + "X", + "X", + 479.931 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.254 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.75 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.119 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.033 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2414.979 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.298 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.61 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.876 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 339.53, + 803.66, + 570.09, + 1121.067, + 389.771, + 330.043, + 69.861, + 5629.05 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1651.09, + 8350.07, + 3272.12, + 2443.191, + 2386.767, + 1864.533, + 97.032, + 19038.25 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.0 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 0.3, + 0.75, + 2.0, + 4.6, + 4.1, + 0.155, + 12.76, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.36, + 3.0, + 3.3, + 6.4, + 17.0, + 15.0, + 0.3, + 35.32, + 1.597 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + 0.93, + 0.207 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.029, + 0.986, + 0.046 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.876 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.575, + 0.547, + 0.846, + 0.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.136, + 0.002, + 0.505, + 0.04 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.207 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.41, + 0.811 + ] + } + }, + "wt_peptide": "RRLHLPGHV" + }, + "FRRLHLPRH": { + "ic50s_MT": [ + "X", + "X", + "X", + 1432.366 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.849 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.857 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.274 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2144.325 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.697 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.595 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.949 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.113 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6039.92, + 615.28, + 2443.19, + 2192.642, + 34.979, + 152.957, + 1511.112, + 1353.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7687.5, + 2342.04, + 3911.67, + 1946.61, + 44.444, + 132.608, + 1406.944, + 7600.15 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.353 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.052 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 0.23, + 2.6, + 5.6, + 0.7, + 2.3, + 3.765, + 5.02, + 3.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 0.74, + 3.8, + 4.8, + 0.8, + 2.0, + 3.595, + 15.92, + 9.959 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.992, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.984, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.274 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.113 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.001, + 0.063, + 0.024 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.001, + 0.069, + 0.033 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 4.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 3.899 + ] + } + }, + "wt_peptide": "FRRLHLPGH" + } + }, + "transcripts": [ + "ENST00000562955.2-SZT2-G/R-1710" + ], + "transcript_expr": [ + 0.576 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3375 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.576 + }, + "Transcript Set 2": { + "peptides": { + "RRLHLPRHV": { + "ic50s_MT": [ + "X", + "X", + "X", + 479.931 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.254 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.75 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.119 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.033 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2414.979 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.298 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.61 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.876 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 339.53, + 803.66, + 570.09, + 1121.067, + 389.771, + 330.043, + 69.861, + 5629.05 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1651.09, + 8350.07, + 3272.12, + 2443.191, + 2386.767, + 1864.533, + 97.032, + 19038.25 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.0 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 0.3, + 0.75, + 2.0, + 4.6, + 4.1, + 0.155, + 12.76, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.36, + 3.0, + 3.3, + 6.4, + 17.0, + 15.0, + 0.3, + 35.32, + 1.597 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + 0.93, + 0.207 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.029, + 0.986, + 0.046 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.876 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.575, + 0.547, + 0.846, + 0.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.136, + 0.002, + 0.505, + 0.04 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.207 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.41, + 0.811 + ] + } + }, + "wt_peptide": "RRLHLPGHV" + }, + "FRRLHLPRH": { + "ic50s_MT": [ + "X", + "X", + "X", + 1432.366 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.849 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.857 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.274 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2144.325 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.697 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.595 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.949 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.113 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6039.92, + 615.28, + 2443.19, + 2192.642, + 34.979, + 152.957, + 1511.112, + 1353.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7687.5, + 2342.04, + 3911.67, + 1946.61, + 44.444, + 132.608, + 1406.944, + 7600.15 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.353 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.052 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 0.23, + 2.6, + 5.6, + 0.7, + 2.3, + 3.765, + 5.02, + 3.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 0.74, + 3.8, + 4.8, + 0.8, + 2.0, + 3.595, + 15.92, + 9.959 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.992, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.984, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.274 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.113 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.001, + 0.063, + 0.024 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.001, + 0.069, + 0.033 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 4.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 3.899 + ] + } + }, + "wt_peptide": "FRRLHLPGH" + }, + "RRLHLPRHVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3083.996 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.79 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.626 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.621 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3709.011 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.49 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.508 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.443 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2600.02, + 9458.8, + 348.45, + 3567.971, + "NA", + "NA", + 197.737, + 7198.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2639.5, + 15500.11, + 776.01, + 4778.521, + "NA", + "NA", + 126.856, + 6319.61 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.668 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.857 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.58, + 3.4, + 0.34, + 2.7, + "NA", + "NA", + 0.732, + 15.3, + 5.438 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.59, + 6.0, + 0.88, + 4.1, + "NA", + "NA", + 0.443, + 13.86, + 7.391 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.956, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.971, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.621 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.443 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.058, + 0.011, + 0.741, + 0.526 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.077, + 0.014, + 0.776, + 0.458 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 0.372 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.7, + 0.317 + ] + } + }, + "wt_peptide": "RRLHLPGHVL" + } + }, + "transcripts": [ + "ENST00000634258.3-SZT2-G/R-1767" + ], + "transcript_expr": [ + 4.946 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3432 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 4.946 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 2, + 3 + ], + "set_expr": [ + 0.576, + 4.946 + ], + "DNA VAF": 0.338, + "RNA VAF": 0.344, + "gene_expr": 34.708, + "best_peptide_mt": "RRLHLPRHV", + "best_peptide_wt": "RRLHLPGHV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-45058674-45058675-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VADPRFTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4563.358 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.296 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.393 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.417 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.412 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2862.12 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.966 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.331 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.163 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 25.471 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18793.359, + 31593.811, + 5441.03, + 3685.685, + "NA", + "NA", + 179.551, + 1937.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18410.77, + 26723.59, + 3254.47, + 2469.769, + "NA", + "NA", + 108.594, + 910.39 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.543 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.389 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.1, + 22.0, + 4.2, + 2.8, + "NA", + "NA", + 0.66, + 6.25, + 4.393 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.9, + 16.0, + 2.6, + 1.3, + "NA", + "NA", + 0.357, + 3.91, + 3.331 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.412 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25.471 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.009, + 0.703, + 0.446 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.042, + 0.832, + 0.517 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 0.435 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 0.227 + ] + } + }, + "wt_peptide": "VADPRLTL" + } + }, + "transcripts": [ + "ENST00000359600.6-ZSWIM5-L/F-396" + ], + "transcript_expr": [ + 0.281 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1185 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.281 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.281 + ], + "DNA VAF": 0.354, + "RNA VAF": 0.0, + "gene_expr": 0.606, + "best_peptide_mt": "VADPRFTL", + "best_peptide_wt": "VADPRLTL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-52961569-52961570-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSDHPVAPQM": { + "ic50s_MT": [ + "X", + "X", + "X", + 11772.125 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.43 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.26 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.077 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 36.78 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14561.625 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.48 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 19.96 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.496 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 28.58 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18225.449, + 37524.98, + 19295.699, + 3167.617, + "NA", + "NA", + 4199.417, + 5318.8 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12894.8, + 34101.03, + 16228.45, + 18679.435, + "NA", + "NA", + 3232.735, + 10158.73 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.375 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.92 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.8, + 35.0, + 21.0, + 2.1, + "NA", + "NA", + 7.658, + 12.26, + 44.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.0, + 26.0, + 17.0, + 25.0, + "NA", + "NA", + 6.406, + 19.96, + 29.408 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.987, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.948, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 36.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.58 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.003, + 0.046, + 0.209 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.006, + 0.037, + 0.074 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.6, + 5.555 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 6.793 + ] + } + }, + "wt_peptide": "LSAHPVAPQM" + } + }, + "transcripts": [ + "ENST00000371514.8-SCP2-A/D-155" + ], + "transcript_expr": [ + 5.456 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 547 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 5.456 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 5.456 + ], + "DNA VAF": 0.482, + "RNA VAF": 0.534, + "gene_expr": 51.669, + "best_peptide_mt": "LSDHPVAPQM", + "best_peptide_wt": "LSAHPVAPQM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-59858482-59858483-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LQVQQDHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 29459.154 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 30.97 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 35.386 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 24.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.297 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27337.345 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.525 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 21.769 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.579 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 27.067 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 36344.98, + 39414.289, + 22573.33, + 50000.0, + "NA", + "NA", + 19579.584, + 8816.36 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34956.88, + 41000.22, + 19717.81, + 50000.0, + "NA", + "NA", + 14127.874, + 10965.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.451 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.353 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 37.0, + 41.0, + 25.0, + 58.0, + "NA", + "NA", + 35.386, + 17.82, + 3.729 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.0, + 47.0, + 21.0, + 58.0, + "NA", + "NA", + 21.769, + 21.28, + 3.098 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.297 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.067 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.008, + 0.119 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.014, + 0.201 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 16.158 + ] + } + }, + "wt_peptide": "SQVQQDHL" + }, + "ETNEELRCL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3549.176 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.334 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.167 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.836 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19996.551 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 37.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.459 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13464.69, + 3530.38, + 6030.06, + 3567.971, + 349.792, + 712.148, + 845.975, + 9480.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37223.72, + 21108.05, + 34053.09, + 7054.341, + 1198.975, + 2532.62, + 18885.053, + 25167.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.45 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.791 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 1.2, + 5.6, + 12.0, + 4.3, + 7.2, + 2.468, + 18.87, + 0.405 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40.0, + 9.4, + 47.0, + 25.0, + 11.0, + 17.0, + 33.385, + 47.96, + 6.661 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.991, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.993, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.459 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.0, + 0.14, + 0.115 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.335 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.0, + 46.225 + ] + } + }, + "wt_peptide": "ETNEELRCS" + } + }, + "transcripts": [ + "ENST00000371208.5-HOOK1-S/L-433" + ], + "transcript_expr": [ + 0.077 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 728 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.077 + }, + "Transcript Set 2": { + "peptides": { + "ETNEELRCL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3549.176 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.334 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.167 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.836 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19996.551 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 37.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.459 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13464.69, + 3530.38, + 6030.06, + 3567.971, + 349.792, + 712.148, + 845.975, + 9480.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37223.72, + 21108.05, + 34053.09, + 7054.341, + 1198.975, + 2532.62, + 18885.053, + 25167.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.45 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.791 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 1.2, + 5.6, + 12.0, + 4.3, + 7.2, + 2.468, + 18.87, + 0.405 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40.0, + 9.4, + 47.0, + 25.0, + 11.0, + 17.0, + 33.385, + 47.96, + 6.661 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.991, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.993, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.459 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.0, + 0.14, + 0.115 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.335 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.0, + 46.225 + ] + } + }, + "wt_peptide": "ETNEELRCS" + } + }, + "transcripts": [ + "ENST00000687049.1-HOOK1-S/L-348" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 643 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 0.077, + 0.0 + ], + "DNA VAF": 0.394, + "RNA VAF": 0.0, + "gene_expr": 0.23, + "best_peptide_mt": "LQVQQDHL", + "best_peptide_wt": "SQVQQDHL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-66834005-66834006-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ISKWVIRKRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 11259.345 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 18.454 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 25.812 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 28.408 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 15623.991 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 29.278 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 31.045 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 21.48 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 27.51 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12706.3, + 39312.922, + 9812.39, + 4526.876, + "NA", + "NA", + 18701.611, + 961.36 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13174.32, + 41805.66, + 11986.87, + 4062.646, + "NA", + "NA", + 18073.663, + 18462.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.285 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 40.0, + 8.5, + 3.8, + "NA", + "NA", + 32.777, + 4.06, + 30.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.1, + 51.0, + 12.0, + 3.2, + "NA", + "NA", + 31.045, + 34.24, + 41.081 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.981, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.966, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 28.408 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.51 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.0, + 0.006, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.006, + 0.045 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.4, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.6, + 37.359 + ] + } + }, + "wt_peptide": "ISKWVIRKGL" + }, + "KRLDCYDL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4674.191 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.284 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.197 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.915 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 49.761 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 33726.568 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 45.983 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 45.966 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 50.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 79.875 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "5", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 22576.76, + 23003.33, + 2416.9, + 4576.123, + "NA", + "NA", + 4772.259, + 565.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39698.47, + 45552.96, + 32085.75, + 35367.386, + "NA", + "NA", + 22230.148, + 19535.23 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.923 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.982 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 12.0, + 2.1, + 4.0, + "NA", + "NA", + 8.371, + 2.92, + 8.197 + ] + }, + "WT": { + "HLA-C*06:02": [ + 51.0, + 77.0, + 42.0, + 46.0, + "NA", + "NA", + 45.966, + 36.28, + 31.287 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.054, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.057, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 49.761 + ] + }, + "WT": { + "HLA-C*06:02": [ + 79.875 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.02, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 11.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.0, + 62.745 + ] + } + }, + "wt_peptide": "KGLDCYDL" + } + }, + "transcripts": [ + "ENST00000371026.8-DNAI4-G/R-626" + ], + "transcript_expr": [ + 0.133 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 848 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.133 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.133 + ], + "DNA VAF": 0.605, + "RNA VAF": 0.0, + "gene_expr": 7.011, + "best_peptide_mt": "ISKWVIRKRL", + "best_peptide_wt": "ISKWVIRKGL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-86453473-86453474-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GSFSVLEV": { + "ic50s_MT": [ + "X", + "X", + "X", + 8492.946 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.444 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.544 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.182 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 20753.103 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.476 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.439 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 41.281 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19962.311, + 32354.881, + 5470.55, + 2099.77, + "NA", + "NA", + 10802.862, + 6183.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27832.29, + 41020.64, + 10699.58, + 2873.703, + "NA", + "NA", + 20824.875, + 20681.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.312 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.0, + 23.0, + 4.2, + 1.0, + "NA", + "NA", + 16.156, + 13.64, + 3.401 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 47.0, + 9.0, + 1.8, + "NA", + "NA", + 40.106, + 38.48, + 14.952 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.104, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.087, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.182 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.281 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.009, + 0.052, + 0.51 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.007, + 0.017, + 0.357 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 4.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.6, + 14.277 + ] + } + }, + "wt_peptide": "GSFSVLGV" + } + }, + "transcripts": [ + "ENST00000370565.5-CLCA2-G/E-754" + ], + "transcript_expr": [ + 0.381 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 943 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.381 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.381 + ], + "DNA VAF": 0.575, + "RNA VAF": 1.0, + "gene_expr": 0.509, + "best_peptide_mt": "GSFSVLEV", + "best_peptide_wt": "GSFSVLGV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-119895935-119895936-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GGLQGVFNI": { + "ic50s_MT": [ + "X", + "X", + "X", + 26216.842 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 26.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 40.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.135 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.986 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 34815.06 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 35.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 54.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.815 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 11.573 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28122.279, + 37464.531, + 33144.32, + 17505.314, + 24311.402, + 15906.33, + 3379.899, + 36529.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29404.59, + 42382.68, + 34986.78, + 21734.483, + 135459.666, + 60753.318, + 5175.998, + 34643.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.472 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.914 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 34.0, + 45.0, + 53.0, + 47.0, + 40.0, + 6.602, + 78.72, + 3.862 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 54.0, + 50.0, + 61.0, + 72.0, + 61.0, + 8.846, + 72.84, + 8.076 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.064, + 0.989, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.973, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.986 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.573 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.03, + 0.023 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.02, + 0.027 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 8.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 11.63 + ] + } + }, + "wt_peptide": "GGLRGVFNI" + } + }, + "transcripts": [ + "ENST00000369400.2-ADAM30-R/Q-134" + ], + "transcript_expr": [ + 0.019 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 790 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.019 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.019 + ], + "DNA VAF": 0.203, + "RNA VAF": 0.0, + "gene_expr": 0.019, + "best_peptide_mt": "GGLQGVFNI", + "best_peptide_wt": "GGLRGVFNI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-150261628-150261629-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DLHNNSHTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2980.25 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.604 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.034 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.004 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.984 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4815.96 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.45 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.313 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.951 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11645.42, + 2562.09, + 3398.41, + 7860.427, + 536.797, + 1038.891, + 1663.977, + 6006.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14326.04, + 5105.04, + 4526.88, + 8950.221, + 783.087, + 1411.14, + 1364.636, + 14389.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.273 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.391 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 0.81, + 3.4, + 28.0, + 5.9, + 9.3, + 4.034, + 13.35, + 2.686 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 1.8, + 4.3, + 31.0, + 7.8, + 13.0, + 3.509, + 26.99, + 3.341 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.992, + 0.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.995, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.984 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.951 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.001, + 0.071, + 0.087 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.001, + 0.077, + 0.06 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 3.807 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 3.527 + ] + } + }, + "wt_peptide": "DLHNNGHTV" + } + }, + "transcripts": [ + "ENST00000369111.9-CA14-G/S-83" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 337 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "DLHNNSHTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2980.25 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.604 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.034 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.004 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.984 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4815.96 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.45 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.313 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.951 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11645.42, + 2562.09, + 3398.41, + 7860.427, + 536.797, + 1038.891, + 1663.977, + 6006.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14326.04, + 5105.04, + 4526.88, + 8950.221, + 783.087, + 1411.14, + 1364.636, + 14389.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.273 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.391 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 0.81, + 3.4, + 28.0, + 5.9, + 9.3, + 4.034, + 13.35, + 2.686 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 1.8, + 4.3, + 31.0, + 7.8, + 13.0, + 3.509, + 26.99, + 3.341 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.992, + 0.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.995, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.984 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.951 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.001, + 0.071, + 0.087 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.001, + 0.077, + 0.06 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 3.807 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 3.527 + ] + } + }, + "wt_peptide": "DLHNNGHTV" + }, + "NSHTVQLSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2040.835 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.583 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.34 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.554 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.167 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4849.408 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.63 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.236 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.279 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3005.29, + 15964.43, + 9812.39, + 4778.521, + 318.28, + 448.301, + 126.67, + 1076.38 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7216.77, + 25856.39, + 20701.6, + 9245.506, + 2482.047, + 1830.501, + 149.038, + 1802.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.936 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.954 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.68, + 6.2, + 9.3, + 16.0, + 4.0, + 5.3, + 0.443, + 4.34, + 1.398 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 15.0, + 23.0, + 32.0, + 17.0, + 14.0, + 0.54, + 5.98, + 1.453 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.099, + 0.995, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.113, + 0.977, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.167 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.279 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.108, + 0.004, + 0.604, + 0.227 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + 0.003, + 0.434, + 0.076 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 0.608 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 0.971 + ] + } + }, + "wt_peptide": "NGHTVQLSL" + } + }, + "transcripts": [ + "ENST00000647854.1-CA14-G/S-83" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 337 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 1, + 2 + ], + "set_expr": [ + 0.0, + 0.0 + ], + "DNA VAF": 0.321, + "RNA VAF": 0.5, + "gene_expr": 0.137, + "best_peptide_mt": "DLHNNSHTV", + "best_peptide_wt": "DLHNNGHTV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-154590262-154590263-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ERMGFTVVT": { + "ic50s_MT": [ + "X", + "X", + "X", + 3459.939 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.873 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.323 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.305 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3803.596 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.774 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.997 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6726.3, + 4717.8, + 5743.49, + 1501.425, + 230.044, + 269.507, + 2202.079, + 5325.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12214.02, + 3984.25, + 6095.65, + 1362.113, + 178.571, + 215.065, + 3622.942, + 16356.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.869 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.54 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 1.6, + 5.3, + 3.2, + 3.1, + 3.5, + 4.925, + 12.27, + 1.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 1.4, + 5.6, + 2.7, + 2.5, + 3.0, + 6.901, + 30.41, + 4.368 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.067, + 0.935, + 0.092 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.891, + 0.041 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.305 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.997 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.002, + 0.116, + 0.316 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.033, + 0.077 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.647 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 7.348 + ] + } + }, + "wt_peptide": "ERMGFTEVT" + } + }, + "transcripts": [ + "ENST00000368474.9-ADAR-E/V-806", + "ENST00000649022.2-ADAR-E/V-511", + "ENST00000648311.1-ADAR-E/V-511", + "ENST00000648231.2-ADAR-E/V-511", + "ENST00000681056.1-ADAR-E/V-511", + "ENST00000681683.1-ADAR-E/V-511" + ], + "transcript_expr": [ + 29.266, + 1.143, + 0.922, + 0.517, + 0.041, + 0.033 + ], + "mane_select": [ + true, + false, + false, + false, + false, + false + ], + "canonical": [ + true, + false, + false, + false, + false, + false + ], + "tsl": [ + 1.0, + "NA", + "NA", + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 1226, + 931, + 931, + 931, + 931, + 931 + ], + "transcript_count": 6, + "peptide_count": 1, + "total_expr": 31.921999999999997 + }, + "Transcript Set 2": { + "peptides": { + "ERMGFTVVT": { + "ic50s_MT": [ + "X", + "X", + "X", + 3459.939 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.873 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.323 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.305 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3803.596 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.774 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.997 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6726.3, + 4717.8, + 5743.49, + 1501.425, + 230.044, + 269.507, + 2202.079, + 5325.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12214.02, + 3984.25, + 6095.65, + 1362.113, + 178.571, + 215.065, + 3622.942, + 16356.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.869 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.54 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 1.6, + 5.3, + 3.2, + 3.1, + 3.5, + 4.925, + 12.27, + 1.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 1.4, + 5.6, + 2.7, + 2.5, + 3.0, + 6.901, + 30.41, + 4.368 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.067, + 0.935, + 0.092 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.891, + 0.041 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.305 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.997 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.002, + 0.116, + 0.316 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.033, + 0.077 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.647 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 7.348 + ] + } + }, + "wt_peptide": "ERMGFTEVT" + }, + "MGFTVVTPV": { + "ic50s_MT": [ + "X", + "X", + "X", + 3814.318 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.26 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.074 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2744.211 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.716 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.441 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2473.94, + 12908.06, + 8119.76, + 2314.529, + 4632.442, + 2996.195, + 368.392, + 6397.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3365.81, + 11159.53, + 8387.64, + 2122.613, + 1670.36, + 1316.952, + 520.631, + 4113.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.976 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.143 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.55, + 4.8, + 7.7, + 6.0, + 23.0, + 19.0, + 1.268, + 13.98, + 1.522 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 4.1, + 7.9, + 5.4, + 14.0, + 12.0, + 1.697, + 10.3, + 2.06 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.139, + 0.991, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.088, + 0.991, + 0.02 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.074 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.441 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.002, + 0.202, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.001, + 0.15, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 1.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 2.232 + ] + } + }, + "wt_peptide": "MGFTEVTPV" + } + }, + "transcripts": [ + "ENST00000649042.1-ADAR-E/V-511" + ], + "transcript_expr": [ + 10.425 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 931 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 10.425 + }, + "Transcript Set 3": { + "peptides": { + "MGFTVVTPV": { + "ic50s_MT": [ + "X", + "X", + "X", + 3814.318 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.26 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.074 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2744.211 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.716 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.441 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2473.94, + 12908.06, + 8119.76, + 2314.529, + 4632.442, + 2996.195, + 368.392, + 6397.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3365.81, + 11159.53, + 8387.64, + 2122.613, + 1670.36, + 1316.952, + 520.631, + 4113.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.976 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.143 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.55, + 4.8, + 7.7, + 6.0, + 23.0, + 19.0, + 1.268, + 13.98, + 1.522 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 4.1, + 7.9, + 5.4, + 14.0, + 12.0, + 1.697, + 10.3, + 2.06 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.139, + 0.991, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.088, + 0.991, + 0.02 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.074 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.441 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.002, + 0.202, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.001, + 0.15, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 1.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 2.232 + ] + } + }, + "wt_peptide": "MGFTEVTPV" + } + }, + "transcripts": [ + "ENST00000649724.1-ADAR-E/V-511", + "ENST00000649749.1-ADAR-E/V-511", + "ENST00000680270.1-ADAR-E/V-511", + "ENST00000679899.1-ADAR-E/V-492" + ], + "transcript_expr": [ + 4.006, + 0.0, + 0.0, + 0.852 + ], + "mane_select": [ + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false + ], + "tsl": [ + "NA", + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 931, + 931, + 931, + 912 + ], + "transcript_count": 4, + "peptide_count": 1, + "total_expr": 4.8580000000000005 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 6, + 1, + 4 + ], + "peptide_counts": [ + 1, + 2, + 1 + ], + "set_expr": [ + 31.921999999999997, + 10.425, + 4.8580000000000005 + ], + "DNA VAF": 0.302, + "RNA VAF": 0.348, + "gene_expr": 131.835, + "best_peptide_mt": "ERMGFTVVT", + "best_peptide_wt": "ERMGFTEVT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-160876800-160876801-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GRGYFPEA": { + "ic50s_MT": [ + "X", + "X", + "X", + 20985.99 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.033 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.86 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.634 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 40329.778 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 55.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 69.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 46.822 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 37.445 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 30646.039, + 41189.629, + 22818.9, + 4936.173, + "NA", + "NA", + 11587.278, + 19153.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42834.02, + 47900.86, + 42509.45, + 38150.106, + "NA", + "NA", + 19769.547, + 37575.58 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.079 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.138 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 23.0, + 48.0, + 25.0, + 4.4, + "NA", + "NA", + 17.432, + 35.55, + 10.475 + ] + }, + "WT": { + "HLA-C*06:02": [ + 69.0, + 98.0, + 84.0, + 48.0, + "NA", + "NA", + 36.114, + 82.11, + 36.285 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.045, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.634 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37.445 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.073, + 0.628 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.108 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 3.72 + ] + }, + "WT": { + "HLA-C*06:02": [ + 62.0, + 31.643 + ] + } + }, + "wt_peptide": "GGGYFPEA" + } + }, + "transcripts": [ + "ENST00000326245.4-ITLN1-G/R-269" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 313 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.25, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "GRGYFPEA", + "best_peptide_wt": "GGGYFPEA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-168179177-168179178-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MKSADVVKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5157.296 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.745 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.855 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.82 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4532.154 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.869 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.57 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5324.72, + 8206.58, + 7818.02, + 4989.872, + 5845.343, + 1736.081, + 396.893, + 337.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10255.49, + 6710.09, + 8297.38, + 4526.877, + 4537.431, + 1385.383, + 692.594, + 590.0 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.219 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.89 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 2.9, + 7.4, + 17.0, + 26.0, + 14.0, + 1.35, + 2.09, + 0.21 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.9, + 2.4, + 7.8, + 16.0, + 23.0, + 12.0, + 2.108, + 3.0, + 1.258 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.952, + 0.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.904, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.57 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.077, + 0.012, + 0.419, + 0.328 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.005, + 0.159, + 0.104 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 1.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 2.138 + ] + } + }, + "wt_peptide": "MKSADVEKL" + } + }, + "transcripts": [ + "ENST00000367833.7-TIPRL-E/V-34" + ], + "transcript_expr": [ + 35.458 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 272 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 35.458 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 35.458 + ], + "DNA VAF": 0.273, + "RNA VAF": 0.332, + "gene_expr": 55.746, + "best_peptide_mt": "MKSADVVKL", + "best_peptide_wt": "MKSADVEKL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-179109009-179109010-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TGFFAPRLI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1136.267 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.854 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.499 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.267 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1199.551 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.831 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.421 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.132 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1114.48, + 2951.44, + 4576.12, + 1158.053, + 296.353, + 342.429, + 216.674, + 8437.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1290.1, + 2878.9, + 4778.52, + 1109.003, + 338.696, + 316.643, + 208.527, + 12872.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.115 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.132 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.26, + 0.91, + 4.4, + 2.1, + 3.8, + 4.2, + 0.797, + 17.21, + 0.156 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.29, + 0.89, + 4.5, + 1.9, + 4.2, + 3.9, + 0.772, + 24.43, + 0.164 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.113, + 0.885, + 0.099 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.116, + 0.927, + 0.137 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.267 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.132 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.09, + 0.869, + 0.719, + 0.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.093, + 0.919, + 0.804, + 0.642 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.59, + 0.408 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.57, + 0.273 + ] + } + }, + "wt_peptide": "TGFFTPRLI" + } + }, + "transcripts": [ + "ENST00000512653.5-ABL2-T/A-738" + ], + "transcript_expr": [ + 3.567 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1167 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.567 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.567 + ], + "DNA VAF": 0.373, + "RNA VAF": 0.429, + "gene_expr": 50.587, + "best_peptide_mt": "TGFFAPRLI", + "best_peptide_wt": "TGFFTPRLI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-183880710-183880711-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLDSLTRMM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2323.898 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.998 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.861 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.665 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3763.695 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.675 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.95 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.274 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.836 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12816.21, + 4111.06, + 5869.13, + 1501.425, + 3146.372, + 1275.176, + 993.129, + 211.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14232.73, + 4836.94, + 8950.22, + 1691.19, + 3325.14, + 1912.362, + 4202.249, + 1787.96 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.168 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.298 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 1.4, + 5.4, + 3.2, + 19.0, + 12.0, + 2.795, + 1.54, + 2.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 1.7, + 8.4, + 3.8, + 20.0, + 15.0, + 7.658, + 5.95, + 2.808 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.973, + 0.056 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.979, + 0.047 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.665 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.836 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.001, + 0.151, + 0.184 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.035, + 0.128 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.5, + 2.222 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.4, + 7.147 + ] + } + }, + "wt_peptide": "LLDYLTRMM" + } + }, + "transcripts": [ + "ENST00000360851.4-RGL1-Y/S-174", + "ENST00000304685.8-RGL1-Y/S-209" + ], + "transcript_expr": [ + 0.012, + 0.449 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 768, + 803 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.461 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.461 + ], + "DNA VAF": 0.3, + "RNA VAF": 0.286, + "gene_expr": 0.461, + "best_peptide_mt": "LLDSLTRMM", + "best_peptide_wt": "LLDYLTRMM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-196995755-196995756-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSSGEVKEIR": { + "ic50s_MT": [ + "X", + "X", + "X", + 37989.371 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 39.958 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 46.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 24.225 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 29.96 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 36760.35 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 31.917 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 39.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.449 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.956 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 38645.32, + 40730.059, + 37333.422, + 50000.0, + "NA", + "NA", + 2135.209, + 13017.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37768.57, + 38967.36, + 35752.13, + 47366.921, + "NA", + "NA", + 1582.533, + 13095.07 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.158 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.752 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 46.0, + 46.0, + 59.0, + 57.0, + "NA", + "NA", + 4.813, + 24.67, + 36.915 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43.0, + 39.0, + 53.0, + 55.0, + "NA", + "NA", + 3.911, + 24.79, + 24.835 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.105, + 0.747, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.076, + 0.783, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 29.96 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.956 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.011, + 0.047, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.007, + 0.069, + 0.065 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 43.0, + 5.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.0, + 3.899 + ] + } + }, + "wt_peptide": "LSNGEVKEIR" + } + }, + "transcripts": [ + "ENST00000256785.5-CFHR5-N/S-216" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 569 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.287, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "LSSGEVKEIR", + "best_peptide_wt": "LSNGEVKEIR", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-203347717-203347718-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRELHLDDN": { + "ic50s_MT": [ + "X", + "X", + "X", + 9606.94 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.164 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.16 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 59.612 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 10.071 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19288.796 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 24.826 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.539 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 44.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.246 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 43820.781, + 15751.68, + 36732.398, + 1946.61, + 257.519, + 205.386, + 19863.359, + 3462.2 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39655.12, + 18852.63, + 31912.64, + 2264.981, + 786.702, + 366.919, + 19724.962, + 21517.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.584 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.239 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 77.0, + 6.1, + 55.0, + 4.8, + 3.4, + 2.9, + 36.113, + 9.16, + 20.256 + ] + }, + "WT": { + "HLA-C*06:02": [ + 51.0, + 7.9, + 42.0, + 5.8, + 7.8, + 4.4, + 36.114, + 40.14, + 13.539 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.954, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.957, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 10.071 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.246 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.005, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 73.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 46.225 + ] + } + }, + "wt_peptide": "LRELHLDHN" + } + }, + "transcripts": [ + "ENST00000354955.5-FMOD-H/D-185" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 376 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.284, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "LRELHLDDN", + "best_peptide_wt": "LRELHLDHN", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-204125889-204125890-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VQMSSLDVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6637.129 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.676 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.276 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.713 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4710.542 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.209 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.317 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.958 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.465 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11752.37, + 8146.86, + 8119.76, + 5154.497, + 3004.761, + 1768.357, + 1323.122, + 8884.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14299.25, + 6306.65, + 6575.26, + 4242.334, + 1580.556, + 969.55, + 3170.356, + 5178.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.727 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.5, + 2.9, + 7.7, + 18.0, + 19.0, + 14.0, + 3.425, + 17.92, + 2.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 2.3, + 6.1, + 15.0, + 13.0, + 8.9, + 6.317, + 12.04, + 5.986 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.958, + 0.027 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.948, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.713 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.465 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.001, + 0.07, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.0, + 0.031, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 3.853 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 8.016 + ] + } + }, + "wt_peptide": "VQMSSSDVL" + } + }, + "transcripts": [ + "ENST00000367204.6-SOX13-S/L-542" + ], + "transcript_expr": [ + 0.442 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 622 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.442 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.442 + ], + "DNA VAF": 0.339, + "RNA VAF": 0.105, + "gene_expr": 2.664, + "best_peptide_mt": "VQMSSLDVL", + "best_peptide_wt": "VQMSSSDVL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-204986102-204986103-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FTSPEGVPSA": { + "ic50s_MT": [ + "X", + "X", + "X", + 14120.293 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.78 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.274 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.765 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17934.185 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.18 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.058 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.531 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17980.43, + 43674.52, + 11294.36, + 16946.227, + "NA", + "NA", + 5838.615, + 324.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21065.84, + 43859.68, + 14802.53, + 24747.82, + "NA", + "NA", + 8818.804, + 366.79 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.375 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.687 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.6, + 62.0, + 9.9, + 22.0, + "NA", + "NA", + 9.659, + 2.04, + 16.163 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.9, + 64.0, + 15.0, + 33.0, + "NA", + "NA", + 13.36, + 2.22, + 23.051 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.988, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.998, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.765 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.531 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.034, + 0.212 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.021, + 0.187 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.2, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 11.116 + ] + } + }, + "wt_peptide": "FTTPEGVPSA" + } + }, + "transcripts": [ + "ENST00000513543.6-NFASC-T/S-923" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1169 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.596, + "RNA VAF": 0.0, + "gene_expr": 0.974, + "best_peptide_mt": "FTSPEGVPSA", + "best_peptide_wt": "FTTPEGVPSA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-207623001-207623002-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TLCGTIFFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 12588.991 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.949 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.267 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.166 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.33 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6571.843 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.463 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.942 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.135 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 14400.32, + 16495.59, + 13000.15, + 13070.666, + 11371.297, + 12177.833, + 3908.196, + 1377.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5371.02, + 18770.0, + 9706.8, + 13356.592, + 4998.158, + 7772.666, + 2744.588, + 300.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.042 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.652 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.6, + 6.5, + 14.0, + 43.0, + 35.0, + 36.0, + 7.267, + 5.07, + 1.724 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 7.8, + 9.2, + 44.0, + 24.0, + 29.0, + 5.742, + 1.94, + 0.692 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.039, + 0.987, + 0.088 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.08, + 0.969, + 0.135 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.135 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.037, + 0.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.003, + 0.088, + 0.292 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 6.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 3.185 + ] + } + }, + "wt_peptide": "TLSGTIFFI" + } + }, + "transcripts": [ + "ENST00000367049.9-CR1-S/C-2429" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2489 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.285, + "RNA VAF": 0.0, + "gene_expr": 0.135, + "best_peptide_mt": "TLCGTIFFI", + "best_peptide_wt": "TLSGTIFFI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-223264671-223264672-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "AYLECLQNV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2401.267 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.005 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.213 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2580.366 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.626 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.105 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "5", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6901.09, + 5899.82, + 2812.19, + 2145.704, + 535.562, + 511.175, + 175.888, + 2656.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7875.15, + 5296.74, + 2496.64, + 2664.091, + 833.317, + 771.916, + 84.798, + 7070.37 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.574 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.536 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 2.1, + 2.9, + 5.4, + 5.9, + 5.8, + 0.648, + 7.66, + 0.567 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 1.9, + 2.6, + 7.2, + 8.0, + 7.7, + 0.233, + 15.09, + 0.514 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + 0.987, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.048, + 0.991, + 0.039 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.105 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.001, + 0.603, + 0.315 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.048, + 0.002, + 0.881, + 0.562 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 0.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 0.153 + ] + } + }, + "wt_peptide": "AYLECLQNL" + } + }, + "transcripts": [ + "ENST00000484758.6-SUSD4-L/V-157", + "ENST00000494793.6-SUSD4-L/V-228", + "ENST00000681285.1-SUSD4-L/V-300", + "ENST00000680429.1-SUSD4-L/V-267", + "ENST00000681305.1-SUSD4-L/V-228" + ], + "transcript_expr": [ + 0.0, + 0.0, + 1.863, + 0.0, + 0.368 + ], + "mane_select": [ + false, + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false, + false + ], + "tsl": [ + 2.0, + 5.0, + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 421, + 488, + 562, + 529, + 490 + ], + "transcript_count": 5, + "peptide_count": 1, + "total_expr": 2.231 + }, + "Transcript Set 2": { + "peptides": { + "LQNVIWSSS": { + "ic50s_MT": [ + "X", + "X", + "X", + 26936.102 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 45.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 46.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 47.372 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.17 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 34312.965 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 53.681 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 54.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 47.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.894 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 33353.32, + 40198.141, + 40270.828, + 22451.545, + 6931.225, + 23909.473, + 23503.031, + 29962.73 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33160.11, + 42256.32, + 40489.28, + 22209.933, + 35465.82, + 44727.024, + 23899.849, + 30482.13 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.731 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.677 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 29.0, + 44.0, + 70.0, + 62.0, + 28.0, + 46.0, + 52.026, + 59.55, + 24.256 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.0, + 54.0, + 71.0, + 61.0, + 53.0, + 57.0, + 53.361, + 60.93, + 22.8 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.952, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.941, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.17 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.894 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 32.0, + 62.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 62.745 + ] + } + }, + "wt_peptide": "LQNLIWSSS" + } + }, + "transcripts": [ + "ENST00000366878.9-SUSD4-L/V-228" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 490 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 5, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 2.231, + 0.0 + ], + "DNA VAF": 0.374, + "RNA VAF": 0.203, + "gene_expr": 24.362, + "best_peptide_mt": "LQNVIWSSS", + "best_peptide_wt": "LQNLIWSSS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-227091906-227091907-GC-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VLLTEENKN": { + "ic50s_MT": [ + "X", + "X", + "X", + 46042.191 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 58.67 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 67.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 66.112 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 50.34 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 43418.145 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 57.42 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 80.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 26.498 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 40.671 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 47211.879, + 41460.59, + 44872.5, + 50000.0, + 93715.195, + 88017.695, + 18074.414, + 15861.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44271.15, + 42565.14, + 42280.1, + 50000.0, + 1046670.539, + 1201074.648, + 1419.738, + 29688.12 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.623 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.224 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 99.0, + 49.0, + 96.0, + 83.0, + 67.0, + 67.0, + 31.045, + 29.54, + 21.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 80.0, + 56.0, + 80.0, + 83.0, + 92.0, + 93.0, + 3.624, + 58.84, + 13.268 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.061, + 0.982, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.265, + 0.984, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 50.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40.671 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.006, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.047, + 0.067, + 0.026 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 86.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 49.0, + 3.997 + ] + } + }, + "wt_peptide": "VLLTEENKK" + } + }, + "transcripts": [ + "ENST00000366766.8-CDC42BPA-K/X-778" + ], + "transcript_expr": [ + 2.676 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1754 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.676 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.676 + ], + "DNA VAF": 0.236, + "RNA VAF": 0.061, + "gene_expr": 40.05, + "best_peptide_mt": "VLLTEENKN", + "best_peptide_wt": "VLLTEENKK", + "best_hla_allele": "HLA-C*06:02" + }, + "chr1-227091907-227091908-T-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLTEENKTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6732.459 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.146 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.794 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10873.18 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.037 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.332 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.793 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21367.02, + 8158.33, + 7818.02, + 10527.332, + 5646.899, + 4483.013, + 429.292, + 4448.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23214.1, + 14083.22, + 11541.43, + 12790.861, + 10204.929, + 7790.584, + 742.687, + 3535.26 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.217 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.112 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.1, + 2.9, + 7.4, + 36.0, + 25.0, + 23.0, + 1.438, + 10.86, + 2.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 5.3, + 12.0, + 43.0, + 33.0, + 29.0, + 2.24, + 9.28, + 1.941 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.964, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.949, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.794 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.793 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.004, + 0.224, + 0.092 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.002, + 0.129, + 0.052 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.6, + 1.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 2.463 + ] + } + }, + "wt_peptide": "LLTEENKKL" + } + }, + "transcripts": [ + "ENST00000366766.8-CDC42BPA-K/T-778" + ], + "transcript_expr": [ + 2.676 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1754 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.676 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.676 + ], + "DNA VAF": 0.231, + "RNA VAF": 0.063, + "gene_expr": 40.05, + "best_peptide_mt": "LLTEENKTL", + "best_peptide_wt": "LLTEENKKL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-13481023-13481024-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TRSGSLLFT": { + "ic50s_MT": [ + "X", + "X", + "X", + 4993.885 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.05 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 6.994 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.34 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9481.233 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.2 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.956 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.417 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4667.08, + 5320.69, + 5353.44, + 1209.273, + 147.846, + 98.078, + 5586.25, + 7837.31 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11016.53, + 13954.59, + 11355.63, + 7945.937, + 5173.804, + 4452.152, + 931.674, + 30356.21 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.835 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.922 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 1.9, + 5.0, + 2.2, + 2.2, + 1.5, + 9.349, + 16.28, + 1.086 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 5.2, + 12.0, + 28.0, + 25.0, + 23.0, + 2.657, + 60.59, + 1.354 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.24, + 0.974, + 0.087 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.128, + 0.985, + 0.077 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.417 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.049, + 0.02, + 0.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.045, + 0.241, + 0.33 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 12.187 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 1.613 + ] + } + }, + "wt_peptide": "TRSGSLLFR" + } + }, + "transcripts": [ + "ENST00000378605.3-BEND7-R/T-274", + "ENST00000341083.7-BEND7-R/T-261" + ], + "transcript_expr": [ + 0.0, + 0.0 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 374, + 468 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.053, + "best_peptide_mt": "TRSGSLLFT", + "best_peptide_wt": "TRSGSLLFR", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-32567832-32567833-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LEKETRKLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 7928.272 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.881 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.586 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.958 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14469.725 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 9.059 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.529 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.516 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16460.83, + 5994.93, + 9919.14, + 3725.78, + 8929.147, + 6927.396, + 1747.932, + 22195.92 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18971.31, + 13975.89, + 14963.56, + 6829.038, + 34499.278, + 23909.473, + 1078.634, + 9954.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.707 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.874 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.6, + 2.1, + 9.4, + 13.0, + 31.0, + 28.0, + 4.195, + 41.5, + 5.803 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.3, + 5.3, + 16.0, + 24.0, + 52.0, + 46.0, + 2.959, + 19.63, + 7.601 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.964, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.953, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.958 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.516 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.001, + 0.061, + 0.057 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.001, + 0.122, + 0.138 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.9, + 4.271 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 2.557 + ] + } + }, + "wt_peptide": "LEKETRKSL" + } + }, + "transcripts": [ + "ENST00000639629.1-CCDC7-S/L-454" + ], + "transcript_expr": [ + 1.874 + ], + "mane_select": [ + false + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1385 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.874 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.874 + ], + "DNA VAF": 0.359, + "RNA VAF": 0.208, + "gene_expr": 20.75, + "best_peptide_mt": "LEKETRKLL", + "best_peptide_wt": "LEKETRKSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-37957500-37957501-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FTKEKWKLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 584.88 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.721 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.48 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.547 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1237.226 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.183 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.85 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.536 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 661.97, + 507.79, + 850.76, + 1109.003, + 224.807, + 194.792, + 173.859, + 4199.67 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1670.01, + 1365.45, + 1989.19, + 1109.003, + 330.986, + 342.429, + 292.059, + 3707.77 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.537 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.814 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.15, + 0.19, + 1.2, + 1.9, + 3.1, + 2.7, + 0.641, + 10.43, + 0.516 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.37, + 0.44, + 2.2, + 1.9, + 4.1, + 4.2, + 1.046, + 9.59, + 1.022 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.099, + 0.967, + 0.064 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.064, + 0.958, + 0.065 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.547 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.536 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.297, + 0.041, + 0.51, + 0.206 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.146, + 0.018, + 0.313, + 0.114 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.16, + 0.8 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.38, + 1.321 + ] + } + }, + "wt_peptide": "FTKEEWKLL" + }, + "FTKEKWKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4464.346 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.325 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.125 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 88.86 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5819.314 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.725 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.925 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 46.247 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10604.39, + 21490.119, + 2352.4, + 6330.918, + "NA", + "NA", + 2597.773, + 478.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17437.26, + 29200.1, + 4429.97, + 7208.657, + "NA", + "NA", + 4245.378, + 419.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.847 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.204 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.1, + 9.7, + 2.0, + 6.3, + "NA", + "NA", + 5.5, + 2.62, + 7.276 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.3, + 18.0, + 3.3, + 7.3, + "NA", + "NA", + 7.712, + 2.41, + 2.352 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.169, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.203, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 88.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46.247 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + 0.016, + 0.049, + 0.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.077, + 0.05, + 0.238 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 5.149 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 5.149 + ] + } + }, + "wt_peptide": "FTKEEWKL" + } + }, + "transcripts": [ + "ENST00000302609.8-ZNF25-E/K-21" + ], + "transcript_expr": [ + 6.784 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 456 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 6.784 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 6.784 + ], + "DNA VAF": 0.485, + "RNA VAF": 0.471, + "gene_expr": 13.09, + "best_peptide_mt": "FTKEKWKLL", + "best_peptide_wt": "FTKEEWKLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-60186848-60186849-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NQMDIATTLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 6091.373 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.729 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.97 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.294 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.111 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5856.35 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.153 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.332 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.788 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.805 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10745.06, + 30331.02, + 2216.49, + 9245.506, + "NA", + "NA", + 1631.03, + 2937.24 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9657.88, + 33381.5, + 2054.82, + 11233.424, + "NA", + "NA", + 781.314, + 177.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.821 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.1, + 20.0, + 2.1, + 12.0, + "NA", + "NA", + 3.97, + 8.19, + 1.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 25.0, + 1.9, + 14.0, + "NA", + "NA", + 2.332, + 1.36, + 1.044 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.721, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.666, + 0.049 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.111 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.805 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.079, + 0.113 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.18, + 0.178 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.1, + 3.488 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 1.975 + ] + } + }, + "wt_peptide": "NQMDIATTLL" + } + }, + "transcripts": [ + "ENST00000280772.7-ANK3-L/M-651" + ], + "transcript_expr": [ + 0.013 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 4377 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.013 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.013 + ], + "DNA VAF": 0.134, + "RNA VAF": 0.0, + "gene_expr": 0.163, + "best_peptide_mt": "NQMDIATTLM", + "best_peptide_wt": "NQMDIATTLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-115241629-115241630-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SAVLINEAM": { + "ic50s_MT": [ + "X", + "X", + "X", + 18726.15 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.538 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.584 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.075 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19300.03 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.528 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 27.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.769 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.98 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15362.2, + 28534.52, + 22090.1, + 11604.035, + 22793.447, + 38866.016, + 286.033, + 6215.18 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15155.5, + 32391.31, + 23444.56, + 13501.892, + 47732.04, + 54647.462, + 735.439, + 14395.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.856 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.161 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.1, + 18.0, + 25.0, + 39.0, + 46.0, + 54.0, + 1.024, + 13.69, + 7.385 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 23.0, + 27.0, + 44.0, + 57.0, + 59.0, + 2.221, + 27.0, + 12.055 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.977, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.974, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.075 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.98 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.001, + 0.396, + 0.211 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.13, + 0.054 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 1.068 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.1, + 2.438 + ] + } + }, + "wt_peptide": "SAVLINGAM" + } + }, + "transcripts": [ + "ENST00000355044.8-ATRNL1-G/E-531" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1379 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.443, + "RNA VAF": 0.0, + "gene_expr": 0.262, + "best_peptide_mt": "SAVLINEAM", + "best_peptide_wt": "SAVLINGAM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-125729432-125729433-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "AIFGGGRYPAV": { + "ic50s_MT": [ + "X", + "X", + "X", + 11726.181 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.2 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.895 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.756 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27372.588 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 29.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 33.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.803 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19847.949, + 31412.49, + 6829.04, + 4526.876, + "NA", + "NA", + 8230.182, + 15222.18 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34759.25, + 34731.45, + 14643.23, + 10757.622, + "NA", + "NA", + 20013.726, + 38442.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.3 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.836 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.9, + 22.0, + 6.0, + 3.9, + "NA", + "NA", + 12.649, + 28.44, + 2.818 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 28.0, + 15.0, + 14.0, + "NA", + "NA", + 36.861, + 84.99, + 7.152 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + "NA", + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.055, + "NA", + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.756 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.803 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.03, + 0.082, + 0.57 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.004, + 0.007, + 0.093 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.4, + 3.39 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.0, + 37.359 + ] + } + }, + "wt_peptide": "PIFGGGRYPAV" + } + }, + "transcripts": [ + "ENST00000356792.9-EDRF1-P/A-324" + ], + "transcript_expr": [ + 9.008 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1238 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 9.008 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 9.008 + ], + "DNA VAF": 0.155, + "RNA VAF": 0.185, + "gene_expr": 17.377, + "best_peptide_mt": "AIFGGGRYPAV", + "best_peptide_wt": "PIFGGGRYPAV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-125859825-125859826-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ARRELKLI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1183.686 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.626 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.551 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.376 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.363 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3787.844 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.196 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.385 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.828 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.732 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9815.26, + 4819.59, + 293.06, + 1209.273, + "NA", + "NA", + 883.401, + 1158.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6312.93, + 8254.13, + 649.13, + 1262.758, + "NA", + "NA", + 243.539, + 11973.61 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.541 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.932 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 1.7, + 0.34, + 0.5, + "NA", + "NA", + 2.551, + 4.55, + 4.373 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 2.9, + 0.69, + 0.5, + "NA", + "NA", + 0.885, + 22.95, + 1.385 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + "NA", + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.16, + "NA", + 0.018 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.363 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.732 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.007, + 0.104, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.084, + 0.075, + 0.42, + 0.195 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 2.852 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.65, + 1.007 + ] + } + }, + "wt_peptide": "ARPELKLI" + }, + "RRELKLII": { + "ic50s_MT": [ + "X", + "X", + "X", + 4361.139 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.525 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.35 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.953 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 46.975 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 26890.895 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 40.721 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 43.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.69 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 83.253 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10894.9, + 14989.81, + 2088.44, + 3000.805, + "NA", + "NA", + 5721.473, + 704.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19311.58, + 24678.57, + 32434.8, + 50000.0, + "NA", + "NA", + 20382.408, + 29103.22 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.665 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 5.7, + 1.9, + 2.0, + "NA", + "NA", + 9.496, + 3.35, + 9.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.5, + 14.0, + 43.0, + 58.0, + "NA", + "NA", + 38.442, + 57.35, + 54.454 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 46.975 + ] + }, + "WT": { + "HLA-C*06:02": [ + 83.253 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.006, + 0.018, + 0.024 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.01, + 0.202 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.1, + 12.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 24.579 + ] + } + }, + "wt_peptide": "RPELKLII" + }, + "LARRELKLI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4932.126 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.998 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.998 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.141 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2405.383 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.941 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.901 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.517 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8744.9, + 6674.11, + 10641.85, + 2551.251, + 3190.142, + 1017.583, + 1356.31, + 16839.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3971.03, + 3082.58, + 6399.79, + 1728.185, + 1053.926, + 387.766, + 167.355, + 22016.71 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.318 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.589 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 2.4, + 11.0, + 6.8, + 19.0, + 9.2, + 3.479, + 31.26, + 2.904 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.92, + 0.96, + 5.9, + 4.0, + 9.4, + 4.6, + 0.613, + 41.14, + 0.589 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.918, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.028, + 0.966, + 0.067 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.517 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.003, + 0.066, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.058, + 0.039, + 0.455, + 0.132 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 3.997 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.88, + 0.923 + ] + } + }, + "wt_peptide": "LARPELKLI" + } + }, + "transcripts": [ + "ENST00000284690.4-DHX32-P/R-209" + ], + "transcript_expr": [ + 42.576 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 743 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 42.576 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 3 + ], + "set_expr": [ + 42.576 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.998, + "gene_expr": 53.951, + "best_peptide_mt": "ARRELKLI", + "best_peptide_wt": "ARPELKLI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr10-132163376-132163377-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ILGERMELL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2437.96 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.874 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.104 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.812 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 945.536 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.052 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.85 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.938 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.504 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13478.98, + 2783.88, + 4676.23, + 3725.78, + 1994.39, + 2092.04, + 218.552, + 1724.91 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4817.14, + 1030.93, + 1283.42, + 2936.567, + 761.746, + 860.142, + 251.966, + 545.8 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.423 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.353 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 0.86, + 4.4, + 13.0, + 15.0, + 16.0, + 0.804, + 5.82, + 3.548 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 0.36, + 1.6, + 8.2, + 7.6, + 8.3, + 0.909, + 2.85, + 3.095 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.926, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.974, + 0.019 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.812 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.504 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.005, + 0.461, + 0.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.034, + 0.003, + 0.677, + 0.505 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 0.908 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 0.477 + ] + } + }, + "wt_peptide": "ILRERMELL" + } + }, + "transcripts": [ + "ENST00000298622.9-JAKMIP3-R/G-795", + "ENST00000666210.1-JAKMIP3-R/G-797", + "ENST00000657785.1-JAKMIP3-R/G-797", + "ENST00000666974.1-JAKMIP3-R/G-797", + "ENST00000668452.1-JAKMIP3-R/G-795", + "ENST00000653512.1-JAKMIP3-R/G-781", + "ENST00000657318.1-JAKMIP3-R/G-721", + "ENST00000670120.1-JAKMIP3-R/G-721", + "ENST00000653623.1-JAKMIP3-R/G-721", + "ENST00000669493.1-JAKMIP3-R/G-699" + ], + "transcript_expr": [ + 0.0, + 1.011, + 0.0, + 0.0, + 0.005, + 0.009, + 0.234, + 0.125, + 0.036, + 0.0 + ], + "mane_select": [ + false, + false, + false, + false, + false, + false, + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false, + false, + false, + false, + false, + false, + false + ], + "tsl": [ + 5.0, + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None", + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 844, + 990, + 846, + 846, + 844, + 830, + 770, + 770, + 770, + 748 + ], + "transcript_count": 10, + "peptide_count": 1, + "total_expr": 1.42 + }, + "Transcript Set 2": { + "peptides": { + "ILGERMEL": { + "ic50s_MT": [ + "X", + "X", + "X", + 10074.341 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.67 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 54.596 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6660.773 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.71 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.177 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 83.679 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29603.789, + 30825.631, + 6646.79, + 13501.893, + "NA", + "NA", + 455.948, + 1436.73 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19711.19, + 22858.43, + 2403.86, + 10641.854, + "NA", + "NA", + 2679.692, + 253.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.536 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 21.0, + 5.2, + 18.0, + "NA", + "NA", + 1.523, + 5.2, + 5.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.8, + 12.0, + 2.1, + 13.0, + "NA", + "NA", + 5.621, + 1.73, + 19.259 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.153, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.07, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 54.596 + ] + }, + "WT": { + "HLA-C*06:02": [ + 83.679 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.022, + 0.589, + 0.56 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.005, + 0.157, + 0.47 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.7, + 0.639 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 2.155 + ] + } + }, + "wt_peptide": "ILRERMEL" + } + }, + "transcripts": [ + "ENST00000684848.1-JAKMIP3-R/G-797" + ], + "transcript_expr": [ + 0.212 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 846 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.212 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 10, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 1.42, + 0.212 + ], + "DNA VAF": 0.462, + "RNA VAF": 0.625, + "gene_expr": 3.848, + "best_peptide_mt": "ILGERMEL", + "best_peptide_wt": "ILRERMEL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-193734-193735-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ATGEDNNEF": { + "ic50s_MT": [ + "X", + "X", + "X", + 12895.53 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 6.501 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.451 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14667.457 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 23.427 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.078 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 23.854 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29822.711, + 18424.711, + 20040.43, + 7366.35, + 3587.649, + 3544.623, + 1415.938, + 24873.381 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35861.0, + 29720.28, + 25842.4, + 8758.623, + 4444.368, + 4737.727, + 3615.63, + 20576.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.386 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.144 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 7.6, + 22.0, + 26.0, + 21.0, + 20.0, + 3.595, + 47.3, + 3.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 19.0, + 31.0, + 31.0, + 23.0, + 24.0, + 6.901, + 38.29, + 11.725 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.909, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.881, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.451 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23.854 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.064, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.026, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.9, + 4.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 9.155 + ] + } + }, + "wt_peptide": "ATGEDNDEF" + } + }, + "transcripts": [ + "ENST00000342878.3-SCGB1C1-D/N-27" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 95 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.213, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "ATGEDNNEF", + "best_peptide_wt": "ATGEDNDEF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-862686-862687-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MAMGFVGCL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1598.855 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.808 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.716 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.581 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2936.77 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.658 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.363 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2089.01, + 1646.75, + 2390.89, + 1550.96, + 303.256, + 266.422, + 112.609, + 9661.94 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3151.17, + 6335.1, + 5382.48, + 2722.37, + 790.333, + 812.026, + 132.649, + 10970.22 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.844 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.622 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.46, + 0.51, + 2.5, + 3.3, + 3.8, + 3.5, + 0.379, + 19.15, + 1.115 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.72, + 2.3, + 5.1, + 7.4, + 7.8, + 7.9, + 0.469, + 21.29, + 0.642 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.99, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032, + 0.987, + 0.084 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.581 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.363 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.001, + 0.542, + 0.123 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.03, + 0.713, + 0.377 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 0.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.9, + 0.417 + ] + } + }, + "wt_peptide": "MAIGFVGCL" + } + }, + "transcripts": [ + "ENST00000527644.2-TSPAN4-I/M-159", + "ENST00000346501.8-TSPAN4-I/M-67", + "ENST00000409531.5-TSPAN4-I/M-86", + "ENST00000409543.6-TSPAN4-I/M-67", + "ENST00000525201.5-TSPAN4-I/M-3", + "ENST00000397396.5-TSPAN4-I/M-3" + ], + "transcript_expr": [ + 0.352, + 0.0, + 1.175, + 0.0, + 1.8, + 1.654 + ], + "mane_select": [ + false, + false, + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false, + false, + false + ], + "tsl": [ + 2.0, + 3.0, + 5.0, + 5.0, + 5.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 330, + 204, + 257, + 238, + 174, + 174 + ], + "transcript_count": 6, + "peptide_count": 1, + "total_expr": 4.981 + }, + "Transcript Set 2": { + "peptides": { + "ITGAFVMAM": { + "ic50s_MT": [ + "X", + "X", + "X", + 9414.46 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 11.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.964 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.502 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10412.885 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.164 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.323 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8129.34, + 11025.82, + 10699.58, + 5743.492, + 18698.639, + 15330.983, + 461.701, + 7923.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7060.07, + 17241.4, + 11233.42, + 7775.837, + 25107.877, + 18431.896, + 475.953, + 9592.35 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.878 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.673 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 4.0, + 11.0, + 20.0, + 43.0, + 39.0, + 1.535, + 16.41, + 1.219 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 6.9, + 12.0, + 28.0, + 47.0, + 42.0, + 1.577, + 19.04, + 0.729 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + 0.985, + 0.068 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.048, + 0.979, + 0.089 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.502 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.323 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.172, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.001, + 0.172, + 0.027 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 2.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.3, + 2.028 + ] + } + }, + "wt_peptide": "ITGAFVMAI" + } + }, + "transcripts": [ + "ENST00000397397.7-TSPAN4-I/M-67" + ], + "transcript_expr": [ + 17.273 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 238 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 17.273 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 6, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 4.981, + 17.273 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.996, + "gene_expr": 72.214, + "best_peptide_mt": "ITGAFVMAM", + "best_peptide_wt": "ITGAFVMAI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-5968293-5968294-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YYLLRLLSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1025.5 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.57 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.58 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.171 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.892 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3356.741 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.225 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.752 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.687 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2496.34, + 977.42, + 1073.58, + 4018.926, + 1134.514, + 860.142, + 134.499, + 58.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6277.04, + 4156.19, + 3150.53, + 4382.296, + 3562.952, + 2497.871, + 274.109, + 122.21 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.677 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.56, + 0.35, + 1.4, + 14.0, + 9.8, + 8.3, + 0.474, + 0.58, + 0.443 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 1.4, + 3.2, + 15.0, + 20.0, + 17.0, + 0.986, + 1.05, + 0.738 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.256, + 0.974, + 0.045 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.111, + 0.988, + 0.055 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.892 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.687 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.193, + 0.248, + 0.946, + 0.934 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.076, + 0.003, + 0.513, + 0.333 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.29, + 0.052 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.71, + 0.794 + ] + } + }, + "wt_peptide": "YYLLSLLSL" + }, + "LRLLSLLDI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1432.677 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.981 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.83 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.981 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.706 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12012.423 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.58 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.58 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.432 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3858.62, + 2304.16, + 4551.43, + 1989.193, + 575.188, + 383.328, + 420.469, + 876.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23766.1, + 26319.01, + 25842.4, + 7945.937, + 5569.42, + 4661.976, + 6291.117, + 16078.91 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.899 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 0.72, + 4.3, + 4.9, + 6.3, + 4.6, + 1.412, + 3.83, + 1.709 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 15.0, + 31.0, + 28.0, + 25.0, + 23.0, + 10.212, + 29.92, + 7.899 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.106, + 0.96, + 0.027 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + 0.984, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.706 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.432 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.013, + 0.181, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.016, + 0.007 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 1.961 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 15.161 + ] + } + }, + "wt_peptide": "LSLLSLLDI" + } + }, + "transcripts": [ + "ENST00000532411.2-OR56A5-S/R-67" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 313 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 0.0, + "best_peptide_mt": "YYLLRLLSL", + "best_peptide_wt": "YYLLSLLSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-6401000-6401001-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YYLGNVPVT": { + "ic50s_MT": [ + "X", + "X", + "X", + 3635.592 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.978 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.265 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.836 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2357.17 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.295 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.595 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.786 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.111 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9275.57, + 4150.62, + 6262.79, + 3167.617, + 1166.299, + 771.916, + 4103.567, + 209.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3407.8, + 4759.17, + 4358.65, + 3307.718, + 1166.299, + 890.369, + 1406.623, + 418.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.356 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.412 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 1.4, + 5.7, + 9.2, + 9.9, + 7.7, + 7.541, + 1.53, + 3.119 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.79, + 1.6, + 4.2, + 9.7, + 9.9, + 8.5, + 3.595, + 2.4, + 3.479 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.983, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.992, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.111 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.001, + 0.124, + 0.509 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.062, + 0.001, + 0.533, + 0.806 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.82, + 0.751 + ] + } + }, + "wt_peptide": "YYLGNVPVA" + } + }, + "transcripts": [ + "ENST00000609360.6-APBB1-A/T-554", + "ENST00000608655.5-APBB1-A/T-334", + "ENST00000609331.5-APBB1-A/T-319", + "ENST00000608394.5-APBB1-A/T-295", + "ENST00000608645.5-APBB1-A/T-295", + "ENST00000608704.5-APBB1-A/T-295" + ], + "transcript_expr": [ + 1.116, + 0.0, + 0.105, + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + true, + false, + false, + false, + false, + false + ], + "canonical": [ + true, + false, + false, + false, + false, + false + ], + "tsl": [ + 5.0, + 5.0, + 5.0, + 5.0, + 5.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 710, + 490, + 475, + 451, + 451, + 451 + ], + "transcript_count": 6, + "peptide_count": 1, + "total_expr": 1.221 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 6 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.221 + ], + "DNA VAF": 0.99, + "RNA VAF": 1.0, + "gene_expr": 6.678, + "best_peptide_mt": "YYLGNVPVT", + "best_peptide_wt": "YYLGNVPVA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-6410863-6410864-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EAEEEEKDD": { + "ic50s_MT": [ + "X", + "X", + "X", + 23444.674 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 38.215 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 33.327 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 65.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 43.102 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 23839.804 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 53.396 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 53.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 62.29 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 53.792 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 48925.398, + 41912.539, + 45606.711, + 9047.587, + 5233.714, + 7007.611, + 13225.748, + 33663.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 48948.72, + 42148.11, + 45606.71, + 10992.949, + 3879.806, + 11286.778, + 10541.892, + 36392.83 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.714 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 100.0, + 52.0, + 99.0, + 32.0, + 25.0, + 28.0, + 20.123, + 69.86, + 33.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 53.0, + 99.0, + 38.0, + 22.0, + 35.0, + 15.821, + 78.26, + 56.189 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.922, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.932, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 43.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 53.792 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.009, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 100.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 24.579 + ] + } + }, + "wt_peptide": "EAEEEEEDD" + } + }, + "transcripts": [ + "ENST00000609360.6-APBB1-E/K-162" + ], + "transcript_expr": [ + 1.116 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 710 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.116 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.116 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 6.678, + "best_peptide_mt": "EAEEEEKDD", + "best_peptide_wt": "EAEEEEEDD", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-20638483-20638484-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YMFQLEDTYA": { + "ic50s_MT": [ + "X", + "X", + "X", + 14068.607 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.741 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 23.79 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.205 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12080.125 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.792 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 29.18 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.006 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20759.461, + 30211.789, + 10470.53, + 7527.491, + "NA", + "NA", + 17666.684, + 140.45 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17906.64, + 21433.23, + 6646.79, + 5997.522, + "NA", + "NA", + 17513.461, + 428.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.085 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.984 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.6, + 20.0, + 8.9, + 8.1, + "NA", + "NA", + 29.453, + 1.15, + 10.583 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.6, + 9.6, + 5.8, + 5.8, + "NA", + "NA", + 29.453, + 2.45, + 8.983 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.889, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.933, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.205 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.006 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.009, + 0.135 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.007, + 0.042 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 23.0, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 37.359 + ] + } + }, + "wt_peptide": "YMFQLVDTYA" + } + }, + "transcripts": [ + "ENST00000525748.6-SLC6A5-V/E-632" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 797 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.452, + "RNA VAF": 0.0, + "gene_expr": 0.006, + "best_peptide_mt": "YMFQLEDTYA", + "best_peptide_wt": "YMFQLVDTYA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-46728135-46728136-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NFTENDLLA": { + "ic50s_MT": [ + "X", + "X", + "X", + 11362.681 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.605 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.877 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 19.29 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.333 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2436.731 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.086 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.531 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.517 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25355.221, + 19946.109, + 18679.43, + 12790.861, + 1177.091, + 2092.04, + 9934.501, + 1565.45 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9488.83, + 3985.93, + 3685.69, + 6978.426, + 220.704, + 658.522, + 1187.771, + 551.04 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.187 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.055 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 8.6, + 20.0, + 43.0, + 10.0, + 16.0, + 14.877, + 5.48, + 12.552 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 1.4, + 3.7, + 25.0, + 3.0, + 6.9, + 3.173, + 2.87, + 1.765 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.039, + 0.996, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.104, + 0.993, + 0.019 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.333 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.517 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.01, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.001, + 0.077, + 0.018 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.5, + 3.563 + ] + } + }, + "wt_peptide": "NFTENDLLV" + } + }, + "transcripts": [ + "ENST00000311907.10-F2-V/A-424" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 622 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.357, + "RNA VAF": 1.0, + "gene_expr": 0.048, + "best_peptide_mt": "NFTENDLLA", + "best_peptide_wt": "NFTENDLLV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-46876561-46876562-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DTGTNQIEV": { + "ic50s_MT": [ + "X", + "X", + "X", + 10325.624 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.85 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 18.844 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8796.364 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.26 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.52 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 9.415 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.535 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25510.141, + 26431.15, + 23444.561, + 11857.879, + 2534.02, + 3385.088, + 5773.13, + 8793.37 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22653.83, + 20761.04, + 15881.05, + 10874.649, + 2107.706, + 3101.487, + 5246.921, + 6718.08 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.476 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.75 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 15.0, + 27.0, + 40.0, + 17.0, + 20.0, + 9.577, + 17.78, + 3.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 9.1, + 17.0, + 37.0, + 16.0, + 19.0, + 8.92, + 14.52, + 6.221 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.15, + 0.91, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.191, + 0.936, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 18.844 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.535 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.002, + 0.017, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.021, + 0.037 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.2, + 13.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.2, + 11.63 + ] + } + }, + "wt_peptide": "DTGTNRIEV" + } + }, + "transcripts": [ + "ENST00000378623.6-LRP4-R/Q-1147" + ], + "transcript_expr": [ + 0.087 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1905 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.087 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.087 + ], + "DNA VAF": 0.421, + "RNA VAF": 0.0, + "gene_expr": 0.268, + "best_peptide_mt": "DTGTNQIEV", + "best_peptide_wt": "DTGTNRIEV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-56542446-56542447-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KTVEESEII": { + "ic50s_MT": [ + "X", + "X", + "X", + 14305.06 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.15 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.763 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.602 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14033.36 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.941 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.637 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21462.0, + 20776.77, + 14564.23, + 8853.904, + 12100.687, + 21556.09, + 1281.708, + 14045.89 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14683.21, + 16043.56, + 12721.85, + 7287.077, + 16323.377, + 13383.509, + 696.091, + 16848.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.728 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.06 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.2, + 9.1, + 16.0, + 31.0, + 36.0, + 45.0, + 3.349, + 26.41, + 5.993 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 6.2, + 14.0, + 26.0, + 40.0, + 37.0, + 2.129, + 31.28, + 1.781 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.056, + 0.968, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.983, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.637 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.005, + 0.084, + 0.067 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.003, + 0.154, + 0.094 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.2, + 3.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 2.183 + ] + } + }, + "wt_peptide": "KTVEESKII" + } + }, + "transcripts": [ + "ENST00000528616.5-OR5M11-K/E-271" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 305 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.291, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "KTVEESEII", + "best_peptide_wt": "KTVEESKII", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-58190707-58190708-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FSSAIIPQMLA": { + "ic50s_MT": [ + "X", + "X", + "X", + 15845.409 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 28.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.194 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16297.425 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 27.822 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.62 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24938.4, + 24214.109, + 10191.11, + 5560.055, + "NA", + "NA", + 21499.709, + 7237.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24876.68, + 25142.4, + 10470.53, + 5805.972, + "NA", + "NA", + 22124.32, + 8908.43 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.635 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.518 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 13.0, + 9.3, + 5.3, + "NA", + "NA", + 42.871, + 15.36, + 5.133 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 14.0, + 9.5, + 5.7, + "NA", + "NA", + 44.889, + 17.95, + 4.195 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.296, + "NA", + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.204, + "NA", + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.194 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.62 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.01, + 0.008, + 0.153 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.007, + 0.007, + 0.137 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 26.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 31.643 + ] + } + }, + "wt_peptide": "YSSAIIPQMLA" + } + }, + "transcripts": [ + "ENST00000641291.1-OR9Q2-Y/F-73" + ], + "transcript_expr": [ + 0.008 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 314 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.008 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.008 + ], + "DNA VAF": 0.514, + "RNA VAF": 0.0, + "gene_expr": 0.008, + "best_peptide_mt": "FSSAIIPQMLA", + "best_peptide_wt": "YSSAIIPQMLA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-59364558-59364559-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VLFTIFLEI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4823.08 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.195 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.345 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.239 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7656.564 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.025 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.766 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.151 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9187.47, + 9703.75, + 9759.45, + 4478.161, + 1492.141, + 3065.985, + 916.828, + 5168.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12928.75, + 9868.08, + 12721.85, + 5441.03, + 3371.398, + 6661.469, + 2529.509, + 8651.66 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.619 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.687 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 3.5, + 9.2, + 16.0, + 13.0, + 19.0, + 2.613, + 12.02, + 0.636 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.0, + 3.6, + 14.0, + 19.0, + 20.0, + 27.0, + 5.419, + 17.55, + 0.756 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.115, + 0.99, + 0.105 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.152, + 0.99, + 0.129 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.239 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.151 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.002, + 0.101, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.003, + 0.038, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 2.891 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.9, + 6.631 + ] + } + }, + "wt_peptide": "VLFTIFLVI" + } + }, + "transcripts": [ + "ENST00000641998.1-OR5AN1-V/E-34", + "ENST00000641850.1-OR5AN1-V/E-34" + ], + "transcript_expr": [ + 0.154, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 311, + 311 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.154 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.154 + ], + "DNA VAF": 0.116, + "RNA VAF": 0.0, + "gene_expr": 0.154, + "best_peptide_mt": "VLFTIFLEI", + "best_peptide_wt": "VLFTIFLVI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-62752450-62752451-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LYLSFEYEA": { + "ic50s_MT": [ + "X", + "X", + "X", + 17402.141 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 18.572 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 26.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.55 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.248 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19820.723 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 24.78 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 27.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.796 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 24.115 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19632.439, + 33800.172, + 28485.48, + 10874.648, + 28629.252, + 13169.521, + 15171.84, + 4956.92 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23647.1, + 34221.52, + 29745.37, + 9865.623, + 28761.399, + 12149.824, + 15994.347, + 2217.65 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.885 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.363 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 26.0, + 35.0, + 37.0, + 49.0, + 37.0, + 23.642, + 11.68, + 7.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 27.0, + 37.0, + 34.0, + 49.0, + 36.0, + 25.445, + 6.82, + 15.937 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.978, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.981, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.248 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.115 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.0, + 0.018, + 0.289 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.01, + 0.138 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.6, + 13.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 22.192 + ] + } + }, + "wt_peptide": "LYLSSEYEA" + } + }, + "transcripts": [ + "ENST00000394807.5-ZBTB3-S/F-405" + ], + "transcript_expr": [ + 7.771 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 524 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.771 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.771 + ], + "DNA VAF": 0.67, + "RNA VAF": 0.601, + "gene_expr": 13.703, + "best_peptide_mt": "LYLSFEYEA", + "best_peptide_wt": "LYLSSEYEA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-63290369-63290370-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSKDALLRI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3047.901 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.424 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.721 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.647 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7716.423 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.3 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.089 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.652 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3394.52, + 13780.4, + 8524.88, + 2314.529, + 1179.804, + 2701.282, + 286.744, + 13095.57 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19799.04, + 20215.97, + 13797.25, + 4062.646, + 1827.301, + 3771.985, + 1842.865, + 11370.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.658 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.086 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 5.2, + 8.1, + 6.0, + 10.0, + 18.0, + 1.024, + 24.79, + 0.702 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.8, + 8.8, + 15.0, + 14.0, + 14.0, + 21.0, + 4.366, + 21.95, + 1.861 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.989, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.992, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.647 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.652 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.069, + 0.005, + 0.567, + 0.407 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.003, + 0.167, + 0.387 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.76, + 0.682 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 2.077 + ] + } + }, + "wt_peptide": "LSEDALLRI" + } + }, + "transcripts": [ + "ENST00000332793.11-SLC22A10-E/K-69", + "ENST00000526800.1-SLC22A10-E/K-17" + ], + "transcript_expr": [ + 0.0, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 541, + 205 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.553, + "RNA VAF": 0.0, + "gene_expr": 0.07, + "best_peptide_mt": "LSKDALLRI", + "best_peptide_wt": "LSEDALLRI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-63544840-63544860-GTGAGCACTTTGTCACCCAGC-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SRNCEIWQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 153.975 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.286 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.1 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.203 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5546.494 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.75 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.816 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.481 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6, 7, 8, 9", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 190.92, + 874.83, + 554.88, + 414.311, + 21.272, + 19.124, + 87.933, + 117.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11521.34, + 15319.21, + 18082.85, + 1619.558, + 488.439, + 290.784, + 9473.431, + 533.42 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.251 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.743 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + 0.32, + 0.73, + 0.4, + 0.4, + 0.4, + 0.252, + 1.02, + 0.042 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.4, + 5.9, + 19.0, + 3.5, + 5.6, + 3.7, + 14.29, + 2.81, + 6.156 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.327, + 0.971, + 0.113 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.969, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.203 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.481 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.402, + 0.219, + 0.915, + 0.677 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.011, + 0.024 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 0.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 20.232 + ] + } + }, + "wt_peptide": "SRNCEHFVT" + } + }, + "transcripts": [ + "ENST00000439013.6-PLAAT4-CEHFVTQL/CX-113-120" + ], + "transcript_expr": [ + 0.063 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 156 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.063 + }, + "Transcript Set 2": { + "peptides": { + "SRNCEIWQVPL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6763.095 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.539 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.954 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.28 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.679 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1598.553 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.247 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.921 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.594 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6, 7, 8, 9, 10", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6341.89, + 29050.4, + 1121.07, + 2339.707, + "NA", + "NA", + 9349.631, + 7184.3 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2636.79, + 19195.54, + 363.86, + 1904.939, + "NA", + "NA", + 1292.168, + 739.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.537 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 18.0, + 1.2, + 1.2, + "NA", + "NA", + 14.156, + 15.27, + 1.954 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.59, + 8.1, + 0.41, + 0.9, + "NA", + "NA", + 3.376, + 3.45, + 0.515 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.054, + "NA", + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.029, + "NA", + 0.029 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.679 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.594 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.001, + 0.016, + 0.117 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.07, + 0.001, + 0.092, + 0.099 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.76, + 3.083 + ] + } + }, + "wt_peptide": "SRNCEHFVTQL" + } + }, + "transcripts": [ + "ENST00000255688.8-PLAAT4-CEHFVTQL/CX-113-120" + ], + "transcript_expr": [ + 36.395 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 164 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 36.395 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 0.063, + 36.395 + ], + "DNA VAF": 0.071, + "RNA VAF": 0.115, + "gene_expr": 43.703, + "best_peptide_mt": "SRNCEIWQVPL", + "best_peptide_wt": "SRNCEHFVTQL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-64320894-64320895-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LGKETDLLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 7252.458 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.2 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.701 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.687 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1911.056 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.965 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.9 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.747 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11610.44, + 13448.09, + 12930.01, + 2496.636, + 2088.382, + 2894.476, + 657.421, + 33006.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4129.7, + 2368.64, + 3548.72, + 1453.472, + 371.373, + 660.04, + 176.549, + 17722.89 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.211 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.798 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 5.0, + 14.0, + 6.6, + 16.0, + 18.0, + 2.04, + 67.95, + 2.385 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.95, + 0.75, + 3.5, + 3.0, + 4.4, + 6.9, + 0.648, + 32.87, + 0.981 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.922, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.089, + 0.904, + 0.052 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.687 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.747 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.004, + 0.134, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.056, + 0.011, + 0.46, + 0.153 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.0, + 2.402 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.89, + 0.91 + ] + } + }, + "wt_peptide": "FGKETDLLL" + } + }, + "transcripts": [ + "ENST00000265462.9-PRDX5-F/L-157" + ], + "transcript_expr": [ + 549.853 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 214 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 549.853 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 549.853 + ], + "DNA VAF": 0.427, + "RNA VAF": 0.439, + "gene_expr": 580.692, + "best_peptide_mt": "LGKETDLLL", + "best_peptide_wt": "FGKETDLLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-64593669-64593670-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ARPLLMTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1700.215 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.955 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.99 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.42 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.594 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 909.275 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.722 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.744 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.236 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.004 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2394.33, + 17066.199, + 1006.1, + 3133.529, + "NA", + "NA", + 117.4, + 102.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1144.36, + 11602.03, + 674.19, + 2751.985, + "NA", + "NA", + 95.701, + 421.14 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.884 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.68 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.53, + 6.8, + 0.99, + 2.2, + "NA", + "NA", + 0.401, + 0.92, + 1.237 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.26, + 4.3, + 0.7, + 1.6, + "NA", + "NA", + 0.294, + 2.42, + 0.744 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + "NA", + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.084, + "NA", + 0.023 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.594 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.004 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.262, + 0.042, + 0.588, + 0.186 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.457, + 0.059, + 0.716, + 0.291 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.2, + 0.639 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.06, + 0.411 + ] + } + }, + "wt_peptide": "ARPLVMTL" + }, + "RARPLLMTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2430.089 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.26 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.23 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.225 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.131 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1273.733 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.091 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.065 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1457.98, + 6209.55, + 2707.68, + 2842.778, + 2321.721, + 2538.458, + 56.184, + 372.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 826.5, + 3202.35, + 1340.18, + 2289.621, + 1207.286, + 1417.653, + 48.438, + 633.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.303 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.028 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.32, + 2.2, + 2.8, + 7.9, + 16.0, + 17.0, + 0.081, + 2.23, + 0.271 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.2, + 1.0, + 1.6, + 6.0, + 11.0, + 13.0, + 0.049, + 3.14, + 0.113 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.951, + 0.137 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.968, + 0.174 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.131 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.256, + 0.042, + 0.824, + 0.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.384, + 0.135, + 0.933, + 0.588 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.21, + 0.241 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.11, + 0.072 + ] + } + }, + "wt_peptide": "RARPLVMTL" + }, + "ARARPLLMT": { + "ic50s_MT": [ + "X", + "X", + "X", + 2730.566 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.382 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.264 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.889 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3228.814 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.7 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.289 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.656 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10274.7, + 8518.98, + 17223.5, + 2192.642, + 1523.386, + 507.657, + 3268.491, + 830.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12062.08, + 11844.42, + 19611.42, + 2607.061, + 1844.208, + 752.61, + 3850.566, + 554.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.639 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.538 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.9, + 3.0, + 18.0, + 5.6, + 13.0, + 5.8, + 6.452, + 3.71, + 5.164 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 4.4, + 21.0, + 7.0, + 15.0, + 7.6, + 7.218, + 2.88, + 4.349 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.039, + 0.984, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.988, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.656 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.007, + 0.039, + 0.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.004, + 0.031, + 0.076 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 6.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 7.778 + ] + } + }, + "wt_peptide": "ARARPLVMT" + } + }, + "transcripts": [ + "ENST00000377574.6-SLC22A12-V/L-233", + "ENST00000336464.7-SLC22A12-V/L-199" + ], + "transcript_expr": [ + 0.0, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 553, + 519 + ], + "transcript_count": 2, + "peptide_count": 3, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "ARPLLMTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1700.215 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.955 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.99 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.42 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.594 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 909.275 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.722 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.744 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.236 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.004 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2394.33, + 17066.199, + 1006.1, + 3133.529, + "NA", + "NA", + 117.4, + 102.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1144.36, + 11602.03, + 674.19, + 2751.985, + "NA", + "NA", + 95.701, + 421.14 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.884 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.68 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.53, + 6.8, + 0.99, + 2.2, + "NA", + "NA", + 0.401, + 0.92, + 1.237 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.26, + 4.3, + 0.7, + 1.6, + "NA", + "NA", + 0.294, + 2.42, + 0.744 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + "NA", + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.084, + "NA", + 0.023 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.594 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.004 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.262, + 0.042, + 0.588, + 0.186 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.457, + 0.059, + 0.716, + 0.291 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.2, + 0.639 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.06, + 0.411 + ] + } + }, + "wt_peptide": "ARPLVMTL" + }, + "ARARPLLMT": { + "ic50s_MT": [ + "X", + "X", + "X", + 2730.566 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.382 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.264 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.889 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3228.814 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.7 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.289 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.656 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10274.7, + 8518.98, + 17223.5, + 2192.642, + 1523.386, + 507.657, + 3268.491, + 830.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12062.08, + 11844.42, + 19611.42, + 2607.061, + 1844.208, + 752.61, + 3850.566, + 554.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.639 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.538 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.9, + 3.0, + 18.0, + 5.6, + 13.0, + 5.8, + 6.452, + 3.71, + 5.164 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 4.4, + 21.0, + 7.0, + 15.0, + 7.6, + 7.218, + 2.88, + 4.349 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.039, + 0.984, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.988, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.656 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.007, + 0.039, + 0.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.004, + 0.031, + 0.076 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 6.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 7.778 + ] + } + }, + "wt_peptide": "ARARPLVMT" + } + }, + "transcripts": [ + "ENST00000473690.5-SLC22A12-V/L-12" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 332 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 3, + 2 + ], + "set_expr": [ + 0.0, + 0.0 + ], + "DNA VAF": 0.155, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "ARPLLMTL", + "best_peptide_wt": "ARPLVMTL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-70087776-70087777-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLNSLSVDL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5793.859 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.673 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.223 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.874 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 20782.764 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 45.359 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 40.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 67.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.058 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19279.631, + 20331.131, + 14963.56, + 7692.158, + 3497.921, + 3895.561, + 3453.579, + 785.3 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43020.27, + 39246.2, + 41599.44, + 16404.995, + 11989.746, + 12751.756, + 23410.019, + 18155.51 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.112 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.59 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.5, + 8.8, + 16.0, + 27.0, + 20.0, + 22.0, + 6.699, + 3.58, + 1.941 + ] + }, + "WT": { + "HLA-C*06:02": [ + 71.0, + 40.0, + 77.0, + 51.0, + 36.0, + 37.0, + 50.718, + 33.67, + 20.419 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.985, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.987, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.874 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.058 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.029, + 0.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.9, + 8.545 + ] + }, + "WT": { + "HLA-C*06:02": [ + 73.0, + 62.745 + ] + } + }, + "wt_peptide": "LLNSLSVDP" + } + }, + "transcripts": [ + "ENST00000355303.10-ANO1-P/L-45" + ], + "transcript_expr": [ + 0.065 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 986 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.065 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.065 + ], + "DNA VAF": 0.187, + "RNA VAF": 0.0, + "gene_expr": 0.764, + "best_peptide_mt": "LLNSLSVDL", + "best_peptide_wt": "LLNSLSVDP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-92982014-92982015-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FAICCAPL": { + "ic50s_MT": [ + "X", + "X", + "X", + 8990.586 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.1 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 16.75 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 60.674 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10680.602 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.08 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.58 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.705 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "4,5", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18937.881, + 34433.602, + 6719.1, + 9865.623, + "NA", + "NA", + 5414.845, + 8115.55 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15574.07, + 23639.67, + 4752.74, + 9346.083, + "NA", + "NA", + 6527.92, + 12015.12 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.385 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 27.0, + 5.2, + 12.0, + "NA", + "NA", + 9.134, + 16.7, + 21.792 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.2, + 13.0, + 3.7, + 12.0, + "NA", + "NA", + 10.549, + 23.01, + 16.365 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.072, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.15, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 60.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.705 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.018, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.015, + 0.011 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 13.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 15.161 + ] + } + }, + "wt_peptide": "FAICWAPL" + } + }, + "transcripts": [ + "ENST00000257068.3-MTNR1B-W/C-264" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 362 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.414, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "FAICCAPL", + "best_peptide_wt": "FAICWAPL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-123943666-123943667-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QRLHIEMYF": { + "ic50s_MT": [ + "X", + "X", + "X", + 1876.09 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.55 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.332 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.228 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 982.519 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.2 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.502 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1400.11, + 1153.11, + 2952.5, + 3343.701, + 1049.083, + 2390.947, + 127.555, + 2352.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 763.88, + 627.81, + 1728.19, + 2390.889, + 864.59, + 1100.449, + 112.256, + 1526.58 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.657 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.32, + 0.39, + 3.0, + 9.8, + 9.4, + 17.0, + 0.443, + 7.09, + 0.566 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.18, + 0.23, + 1.9, + 6.2, + 8.3, + 9.6, + 0.374, + 5.4, + 0.699 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.934, + 0.107 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.881, + 0.068 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.502 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.339, + 0.028, + 0.644, + 0.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.439, + 0.048, + 0.767, + 0.411 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.13, + 0.535 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.07, + 0.33 + ] + } + }, + "wt_peptide": "QRLHIQMYF" + }, + "QRLHIEMY": { + "ic50s_MT": [ + "X", + "X", + "X", + 4936.58 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.839 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.139 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.547 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2867.231 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.046 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.456 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.683 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16008.54, + 4662.59, + 3848.7, + 5210.57, + "NA", + "NA", + 3350.137, + 10861.74 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10390.52, + 1852.58, + 2088.44, + 3646.022, + "NA", + "NA", + 1796.636, + 8456.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.964 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.541 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.4, + 1.6, + 2.9, + 4.8, + "NA", + "NA", + 6.552, + 21.11, + 1.484 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.0, + 0.58, + 1.9, + 2.8, + "NA", + "NA", + 4.264, + 17.24, + 0.521 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + "NA", + 0.055 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.547 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.683 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.002, + 0.108, + 0.408 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.075, + 0.003, + 0.153, + 0.353 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 2.778 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.72, + 2.192 + ] + } + }, + "wt_peptide": "QRLHIQMY" + } + }, + "transcripts": [ + "ENST00000321252.3-OR6T1-Q/E-58" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 323 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.448, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "QRLHIEMYF", + "best_peptide_wt": "QRLHIQMYF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr11-124319973-124319974-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YSFVITPKM": { + "ic50s_MT": [ + "X", + "X", + "X", + 937.56 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.972 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.533 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.233 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1485.98 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.229 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.362 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.228 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1279.95, + 1209.81, + 1709.59, + 1028.11, + 55.694, + 263.372, + 242.096, + 847.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2152.42, + 8805.94, + 4018.93, + 4151.518, + 164.744, + 819.54, + 187.031, + 371.42 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.781 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.095 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.29, + 0.41, + 1.9, + 1.8, + 1.0, + 3.5, + 0.877, + 3.75, + 0.943 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.48, + 3.2, + 3.9, + 14.0, + 2.4, + 8.0, + 0.689, + 2.23, + 1.888 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.982, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + 0.98, + 0.021 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.233 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.228 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.155, + 0.031, + 0.551, + 0.343 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.114, + 0.055, + 0.829, + 0.659 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.35, + 0.715 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.49, + 0.233 + ] + } + }, + "wt_peptide": "YSSVITPKM" + }, + "FVITPKMLV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1094.48 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.241 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.282 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.914 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.361 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3082.057 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.887 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.501 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.792 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1726.34, + 679.2, + 2264.98, + 1362.113, + 151.29, + 132.303, + 826.846, + 1542.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3958.29, + 5474.1, + 5869.13, + 2216.494, + 319.75, + 286.794, + 1675.324, + 3947.62 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.458 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.37, + 0.25, + 2.4, + 2.7, + 2.2, + 2.0, + 2.428, + 5.44, + 2.282 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.92, + 1.9, + 5.4, + 5.7, + 4.0, + 3.7, + 4.067, + 10.01, + 3.775 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.262, + 0.982, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.117, + 0.985, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.361 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.792 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.129, + 0.005, + 0.291, + 0.37 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.073, + 0.002, + 0.146, + 0.316 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.43, + 1.399 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.73, + 2.271 + ] + } + }, + "wt_peptide": "SVITPKMLV" + }, + "YSFVITPKML": { + "ic50s_MT": [ + "X", + "X", + "X", + 4752.917 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.794 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.189 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.373 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.071 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8100.753 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.975 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.32 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.975 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.759 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6559.35, + 15348.08, + 1183.39, + 1989.193, + "NA", + "NA", + 2946.485, + 6922.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10378.5, + 32559.97, + 3133.53, + 8032.377, + "NA", + "NA", + 3964.601, + 8169.13 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.17 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.559 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 5.9, + 1.3, + 1.0, + "NA", + "NA", + 6.003, + 14.85, + 2.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.0, + 23.0, + 2.8, + 8.8, + "NA", + "NA", + 7.32, + 16.78, + 4.517 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.042, + 0.977, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.978, + 0.027 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.071 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.759 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.041, + 0.047, + 0.122 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.03, + 0.05, + 0.218 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 5.347 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 5.149 + ] + } + }, + "wt_peptide": "YSSVITPKML" + } + }, + "transcripts": [ + "ENST00000624618.2-OR8D2-S/F-75" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 311 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 3 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "YSFVITPKM", + "best_peptide_wt": "YSSVITPKM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr12-889169-889170-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DLDAELRRT": { + "ic50s_MT": [ + "X", + "X", + "X", + 14307.51 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 29.909 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 27.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 42.18 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 29.817 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14185.341 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.471 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 43.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 41.109 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 44133.891, + 34203.0, + 40929.75, + 7692.158, + 8352.375, + 12722.428, + 15892.591, + 6374.39 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42619.53, + 31856.06, + 38565.12, + 6978.426, + 7939.808, + 11131.918, + 17238.765, + 11064.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.654 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.539 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 79.0, + 27.0, + 73.0, + 27.0, + 30.0, + 37.0, + 25.445, + 13.94, + 22.157 + ] + }, + "WT": { + "HLA-C*06:02": [ + 68.0, + 22.0, + 62.0, + 25.0, + 30.0, + 35.0, + 28.471, + 21.44, + 19.312 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.995, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.997, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 29.817 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.109 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.007 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 47.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.0, + 46.225 + ] + } + }, + "wt_peptide": "DLDAQLRRT" + } + }, + "transcripts": [ + "ENST00000530271.6-WNK1-Q/E-2212" + ], + "transcript_expr": [ + 0.25 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2833 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.25 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.25 + ], + "DNA VAF": 0.604, + "RNA VAF": 0.7, + "gene_expr": 97.46, + "best_peptide_mt": "DLDAELRRT", + "best_peptide_wt": "DLDAQLRRT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr12-10159995-10159996-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VRGAVSETY": { + "ic50s_MT": [ + "X", + "X", + "X", + 657.589 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.295 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.373 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.075 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 326.696 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.466 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.58 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.188 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.442 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3402.64, + 1853.54, + 4883.05, + 1085.262, + 214.195, + 229.916, + 127.644, + 74.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1164.11, + 520.71, + 2065.97, + 759.397, + 132.681, + 114.175, + 101.933, + 45.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.436 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.583 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.79, + 0.58, + 4.6, + 1.8, + 3.0, + 3.1, + 0.443, + 0.72, + 3.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.27, + 0.19, + 2.2, + 1.1, + 2.0, + 1.8, + 0.323, + 0.49, + 0.58 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.948, + 0.023 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.969, + 0.074 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.075 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.442 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.158, + 0.004, + 0.726, + 0.385 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.387, + 0.027, + 0.802, + 0.442 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.35, + 0.396 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.1, + 0.276 + ] + } + }, + "wt_peptide": "VRGAVSQTY" + } + }, + "transcripts": [ + "ENST00000309539.8-OLR1-Q/E-236" + ], + "transcript_expr": [ + 0.121 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 273 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.121 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.121 + ], + "DNA VAF": 0.195, + "RNA VAF": 0.0, + "gene_expr": 0.273, + "best_peptide_mt": "VRGAVSETY", + "best_peptide_wt": "VRGAVSQTY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr12-31697921-31697922-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SYLNEASL": { + "ic50s_MT": [ + "X", + "X", + "X", + 12671.034 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.922 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 11.187 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.778 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 36.116 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13494.556 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.509 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.389 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.465 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 30.145 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24507.471, + 33734.398, + 5154.5, + 18279.562, + "NA", + "NA", + 7062.506, + 3184.55 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24386.33, + 36107.83, + 6330.92, + 19717.806, + "NA", + "NA", + 7271.307, + 4656.6 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.843 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.674 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 26.0, + 3.9, + 25.0, + "NA", + "NA", + 11.187, + 8.65, + 7.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 31.0, + 4.9, + 27.0, + "NA", + "NA", + 11.389, + 11.19, + 5.49 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.131, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.12, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 36.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.145 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.001, + 0.022, + 0.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.006, + 0.021, + 0.128 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.9, + 10.656 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.3, + 11.63 + ] + } + }, + "wt_peptide": "SYLHEASL" + }, + "SSCSYLNEA": { + "ic50s_MT": [ + "X", + "X", + "X", + 4505.988 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.666 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.55 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.465 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.625 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3751.231 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.224 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.074 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.827 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18590.32, + 15563.12, + 20040.43, + 3890.569, + 956.775, + 491.553, + 5121.408, + 3132.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14367.33, + 17997.75, + 17505.31, + 3454.017, + 691.528, + 353.647, + 4048.445, + 2122.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.875 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.0, + 6.0, + 22.0, + 13.0, + 8.8, + 5.6, + 8.781, + 8.55, + 6.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 7.4, + 19.0, + 12.0, + 7.1, + 4.3, + 7.434, + 6.63, + 7.615 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.994, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.994, + 0.017 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.625 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.827 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.02, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.0, + 0.033, + 0.107 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.3, + 11.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 7.348 + ] + } + }, + "wt_peptide": "SSCSYLHEA" + } + }, + "transcripts": [ + "ENST00000281471.11-AMN1-H/N-118" + ], + "transcript_expr": [ + 1.517 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 258 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 1.517 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 1.517 + ], + "DNA VAF": 0.453, + "RNA VAF": 0.178, + "gene_expr": 15.0, + "best_peptide_mt": "SYLNEASL", + "best_peptide_wt": "SYLHEASL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr12-48693119-48693120-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YLNPRSGGMSS": { + "ic50s_MT": [ + "X", + "X", + "X", + 16413.639 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 21.038 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 33.29 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 21.076 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19560.237 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 22.114 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 22.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 32.309 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.228 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 34149.75, + 32816.398, + 16946.23, + 15881.049, + "NA", + "NA", + 11666.668, + 8590.81 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36461.57, + 38042.53, + 19824.77, + 19295.705, + "NA", + "NA", + 10078.155, + 6717.65 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.395 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.463 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 31.0, + 24.0, + 18.0, + 21.0, + "NA", + "NA", + 17.432, + 17.46, + 16.539 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38.0, + 36.0, + 22.0, + 26.0, + "NA", + "NA", + 15.179, + 14.52, + 17.846 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.058, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.115, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 21.076 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.228 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.009, + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.008, + 0.012, + 0.068 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 42.0, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46.0, + 18.618 + ] + } + }, + "wt_peptide": "YLNPRSGGISS" + } + }, + "transcripts": [ + "ENST00000261900.8-CCNT1-I/M-698" + ], + "transcript_expr": [ + 11.572 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 726 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 11.572 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 11.572 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 23.125, + "best_peptide_mt": "YLNPRSGGMSS", + "best_peptide_wt": "YLNPRSGGISS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr12-49526214-49526215-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HKPRTSQTEAV": { + "ic50s_MT": [ + "X", + "X", + "X", + 19557.055 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 18.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 19.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 22.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 11.42 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19560.241 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 19.68 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 19.895 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 23.43 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.465 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21608.801, + 30322.49, + 17505.311, + 13797.251, + "NA", + "NA", + 17430.734, + 22682.949 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21186.07, + 30770.65, + 17888.25, + 12382.344, + "NA", + "NA", + 19975.001, + 19145.48 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.964 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.569 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.3, + 20.0, + 19.0, + 18.0, + "NA", + "NA", + 28.956, + 42.52, + 8.722 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.0, + 21.0, + 19.0, + 16.0, + "NA", + "NA", + 36.861, + 35.54, + 19.895 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 11.42 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.465 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.006, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.007, + 0.089 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.5, + 37.359 + ] + } + }, + "wt_peptide": "RKPRTSQTEAV" + } + }, + "transcripts": [ + "ENST00000552918.6-SPATS2-R/H-533" + ], + "transcript_expr": [ + 6.225 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 545 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.225 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.225 + ], + "DNA VAF": 0.968, + "RNA VAF": 1.0, + "gene_expr": 23.424, + "best_peptide_mt": "HKPRTSQTEAV", + "best_peptide_wt": "RKPRTSQTEAV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr12-112043094-112043095-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TRGLEDTM": { + "ic50s_MT": [ + "X", + "X", + "X", + 7705.444 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.26 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.52 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.116 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.633 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25056.852 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 29.822 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 32.822 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.071 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26071.279, + 24223.02, + 6682.85, + 5099.027, + "NA", + "NA", + 8728.038, + 3116.74 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40035.35, + 43829.8, + 29745.37, + 20368.333, + "NA", + "NA", + 13524.53, + 11562.84 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.684 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.519 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 13.0, + 5.2, + 4.7, + "NA", + "NA", + 13.234, + 8.52, + 0.751 + ] + }, + "WT": { + "HLA-C*06:02": [ + 53.0, + 64.0, + 37.0, + 28.0, + "NA", + "NA", + 20.654, + 22.27, + 4.2 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.071 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.011, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.0, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.0, + 31.643 + ] + } + }, + "wt_peptide": "TSGLEDTM" + } + }, + "transcripts": [ + "ENST00000261745.9-NAA25-S/R-789" + ], + "transcript_expr": [ + 6.847 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 972 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.847 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.847 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 23.927, + "best_peptide_mt": "TRGLEDTM", + "best_peptide_wt": "TSGLEDTM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-25541936-25541937-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TALMQTREV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1850.97 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.767 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.422 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.674 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 792.81 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.743 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.324 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1833.97, + 1993.52, + 2952.5, + 2842.778, + 458.997, + 570.913, + 142.816, + 1867.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7131.93, + 2761.74, + 4242.33, + 611.631, + 78.852, + 134.763, + 315.552, + 973.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.843 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 0.61, + 3.0, + 7.9, + 5.3, + 6.3, + 0.516, + 6.1, + 0.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 0.86, + 4.1, + 0.7, + 1.3, + 2.0, + 1.118, + 4.09, + 1.113 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.092, + 0.975, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.976, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.324 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.111, + 0.078, + 0.759, + 0.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.006, + 0.795, + 0.741 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 0.286 + ] + } + }, + "wt_peptide": "TADMQTREV" + }, + "IRQGLSHTALM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2188.201 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.596 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.054 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.246 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.492 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4354.772 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.497 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.189 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.173 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3712.62, + 5890.89, + 123.99, + 1785.202, + "NA", + "NA", + 2591.201, + 364.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8547.98, + 13916.15, + 598.54, + 2664.091, + "NA", + "NA", + 6045.453, + 11.07 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.825 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.85, + 2.1, + 0.15, + 0.7, + "NA", + "NA", + 5.5, + 2.2, + 1.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 5.2, + 0.65, + 1.6, + "NA", + "NA", + 9.893, + 0.1, + 2.694 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + "NA", + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.492 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.173 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.004, + 0.037, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.003, + 0.016, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 14.277 + ] + } + }, + "wt_peptide": "IRQGLSHTADM" + }, + "ALMQTREVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2871.535 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.315 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.839 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.911 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11898.507 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.491 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.179 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.113 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19681.15, + 3464.8, + 4478.16, + 5382.477, + 1363.986, + 2087.229, + 1133.125, + 2278.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35822.21, + 11679.74, + 11294.36, + 12117.274, + 5306.522, + 16427.444, + 8244.912, + 17163.97 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.464 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 1.2, + 4.3, + 19.0, + 12.0, + 16.0, + 3.079, + 6.93, + 8.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 4.3, + 12.0, + 41.0, + 25.0, + 40.0, + 12.649, + 31.86, + 17.87 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.975, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.97, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.113 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.003, + 0.271, + 0.429 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.082, + 0.572 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 1.478 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 3.359 + ] + } + }, + "wt_peptide": "ADMQTREVL" + }, + "LMQTREVLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3962.624 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.333 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.873 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.496 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.584 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10896.939 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.721 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.416 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.156 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12416.42, + 5075.69, + 8032.38, + 9047.587, + 1793.949, + 2401.983, + 2849.558, + 550.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23967.79, + 16092.6, + 15967.2, + 17695.746, + 1458.176, + 4629.883, + 5826.677, + 1256.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.611 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.077 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.8, + 1.8, + 7.6, + 32.0, + 14.0, + 17.0, + 5.873, + 2.87, + 4.923 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 6.3, + 17.0, + 54.0, + 13.0, + 23.0, + 9.659, + 4.78, + 10.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.955, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.961, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.584 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.156 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.016, + 0.036, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.054, + 0.35 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 4.732 + ] + } + }, + "wt_peptide": "DMQTREVLM" + } + }, + "transcripts": [ + "ENST00000381655.7-ATP8A2-D/H-224" + ], + "transcript_expr": [ + 0.007 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1188 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 0.007 + }, + "Transcript Set 2": { + "peptides": { + "IRQGLSHTALM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2188.201 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.596 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.054 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.246 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.492 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4354.772 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.497 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.189 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.173 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3712.62, + 5890.89, + 123.99, + 1785.202, + "NA", + "NA", + 2591.201, + 364.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8547.98, + 13916.15, + 598.54, + 2664.091, + "NA", + "NA", + 6045.453, + 11.07 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.825 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.85, + 2.1, + 0.15, + 0.7, + "NA", + "NA", + 5.5, + 2.2, + 1.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 5.2, + 0.65, + 1.6, + "NA", + "NA", + 9.893, + 0.1, + 2.694 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + "NA", + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.492 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.173 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.004, + 0.037, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.003, + 0.016, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 14.277 + ] + } + }, + "wt_peptide": "IRQGLSHTADM" + }, + "ALMQTREVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2871.535 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.315 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.839 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.911 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11898.507 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.491 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.179 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.113 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19681.15, + 3464.8, + 4478.16, + 5382.477, + 1363.986, + 2087.229, + 1133.125, + 2278.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35822.21, + 11679.74, + 11294.36, + 12117.274, + 5306.522, + 16427.444, + 8244.912, + 17163.97 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.464 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 1.2, + 4.3, + 19.0, + 12.0, + 16.0, + 3.079, + 6.93, + 8.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 4.3, + 12.0, + 41.0, + 25.0, + 40.0, + 12.649, + 31.86, + 17.87 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.975, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.97, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.113 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.003, + 0.271, + 0.429 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.082, + 0.572 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 1.478 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 3.359 + ] + } + }, + "wt_peptide": "ADMQTREVL" + }, + "LMQTREVLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3962.624 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.333 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.873 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.496 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.584 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10896.939 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.721 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.416 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.156 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12416.42, + 5075.69, + 8032.38, + 9047.587, + 1793.949, + 2401.983, + 2849.558, + 550.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23967.79, + 16092.6, + 15967.2, + 17695.746, + 1458.176, + 4629.883, + 5826.677, + 1256.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.611 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.077 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.8, + 1.8, + 7.6, + 32.0, + 14.0, + 17.0, + 5.873, + 2.87, + 4.923 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 6.3, + 17.0, + 54.0, + 13.0, + 23.0, + 9.659, + 4.78, + 10.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.955, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.961, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.584 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.156 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.016, + 0.036, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.054, + 0.35 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 4.732 + ] + } + }, + "wt_peptide": "DMQTREVLM" + } + }, + "transcripts": [ + "ENST00000682472.1-ATP8A2-D/H-224" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1163 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.0 + }, + "Transcript Set 3": { + "peptides": { + "IRQGLSHTALM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2188.201 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.596 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.054 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.246 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.492 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4354.772 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.497 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.189 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.173 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3712.62, + 5890.89, + 123.99, + 1785.202, + "NA", + "NA", + 2591.201, + 364.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8547.98, + 13916.15, + 598.54, + 2664.091, + "NA", + "NA", + 6045.453, + 11.07 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.825 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.85, + 2.1, + 0.15, + 0.7, + "NA", + "NA", + 5.5, + 2.2, + 1.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 5.2, + 0.65, + 1.6, + "NA", + "NA", + 9.893, + 0.1, + 2.694 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + "NA", + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.492 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.173 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.004, + 0.037, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.003, + 0.016, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 14.277 + ] + } + }, + "wt_peptide": "IRQGLSHTADM" + }, + "LMQTREVLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3962.624 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.333 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.873 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.496 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.584 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10896.939 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.721 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.416 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.156 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12416.42, + 5075.69, + 8032.38, + 9047.587, + 1793.949, + 2401.983, + 2849.558, + 550.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23967.79, + 16092.6, + 15967.2, + 17695.746, + 1458.176, + 4629.883, + 5826.677, + 1256.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.611 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.077 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.8, + 1.8, + 7.6, + 32.0, + 14.0, + 17.0, + 5.873, + 2.87, + 4.923 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 6.3, + 17.0, + 54.0, + 13.0, + 23.0, + 9.659, + 4.78, + 10.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.955, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.961, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.584 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.156 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.016, + 0.036, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.054, + 0.35 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 4.732 + ] + } + }, + "wt_peptide": "DMQTREVLM" + } + }, + "transcripts": [ + "ENST00000684424.1-ATP8A2-D/H-184" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1148 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 4, + 3, + 2 + ], + "set_expr": [ + 0.007, + 0.0, + 0.0 + ], + "DNA VAF": 0.304, + "RNA VAF": 0.0, + "gene_expr": 0.145, + "best_peptide_mt": "TALMQTREV", + "best_peptide_wt": "TADMQTREV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-25541936-25541938-GA-CT": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IRQGLSHTAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1743.11 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.789 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.927 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.468 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25171.98 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 47.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.79 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2797.29, + 25515.949, + 688.93, + 4936.173, + "NA", + "NA", + 214.051, + 72.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34535.45, + 40044.03, + 28951.56, + 8664.367, + "NA", + "NA", + 21392.399, + 12429.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.895 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.862 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 14.0, + 0.76, + 4.3, + "NA", + "NA", + 0.789, + 0.71, + 1.272 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 43.0, + 36.0, + 9.7, + "NA", + "NA", + 41.926, + 23.7, + 7.457 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.918, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.945, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.468 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.79 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.004, + 0.368, + 0.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.005, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.71, + 1.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 62.745 + ] + } + }, + "wt_peptide": "IRQGLSHTAD" + } + }, + "transcripts": [ + "ENST00000682472.1-ATP8A2-D/L-224", + "ENST00000684424.1-ATP8A2-D/L-184" + ], + "transcript_expr": [ + 0.0, + 0.0 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1163, + 1148 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "QGLSHTALM": { + "ic50s_MT": [ + "X", + "X", + "X", + 7701.703 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.445 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.379 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.572 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9588.191 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.96 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.616 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.584 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11181.04, + 7542.98, + 8664.37, + 7860.427, + 2869.525, + 2664.219, + 1774.458, + 19768.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23525.11, + 16348.11, + 21970.92, + 12790.861, + 4353.214, + 4462.415, + 4097.194, + 6385.52 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.489 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.876 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 2.7, + 8.2, + 28.0, + 18.0, + 18.0, + 4.232, + 36.73, + 3.972 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 6.4, + 25.0, + 43.0, + 23.0, + 23.0, + 7.541, + 13.96, + 7.624 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.898, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.874, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.572 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.584 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.001, + 0.055, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.023, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 4.658 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 10.232 + ] + } + }, + "wt_peptide": "QGLSHTADM" + } + }, + "transcripts": [ + "ENST00000381655.7-ATP8A2-D/L-224" + ], + "transcript_expr": [ + 0.007 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1188 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.007 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 0.0, + 0.007 + ], + "DNA VAF": 0.319, + "RNA VAF": "NA", + "gene_expr": 0.145, + "best_peptide_mt": "QGLSHTALM", + "best_peptide_wt": "QGLSHTADM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-25541937-25541938-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IRQGLSHTAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1743.11 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.789 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.927 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.468 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25171.98 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 47.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.79 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2797.29, + 25515.949, + 688.93, + 4936.173, + "NA", + "NA", + 214.051, + 72.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34535.45, + 40044.03, + 28951.56, + 8664.367, + "NA", + "NA", + 21392.399, + 12429.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.895 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.862 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 14.0, + 0.76, + 4.3, + "NA", + "NA", + 0.789, + 0.71, + 1.272 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 43.0, + 36.0, + 9.7, + "NA", + "NA", + 41.926, + 23.7, + 7.457 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.918, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.945, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.468 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.79 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.004, + 0.368, + 0.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.005, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.71, + 1.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 62.745 + ] + } + }, + "wt_peptide": "IRQGLSHTAD" + }, + "TALMQTREV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1850.97 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.767 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.422 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.674 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 792.81 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.743 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.324 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1833.97, + 1993.52, + 2952.5, + 2842.778, + 458.997, + 570.913, + 142.816, + 1867.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7131.93, + 2761.74, + 4242.33, + 611.631, + 78.852, + 134.763, + 315.552, + 973.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.843 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 0.61, + 3.0, + 7.9, + 5.3, + 6.3, + 0.516, + 6.1, + 0.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 0.86, + 4.1, + 0.7, + 1.3, + 2.0, + 1.118, + 4.09, + 1.113 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.092, + 0.975, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.976, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.324 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.111, + 0.078, + 0.759, + 0.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.006, + 0.795, + 0.741 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 0.286 + ] + } + }, + "wt_peptide": "TADMQTREV" + } + }, + "transcripts": [ + "ENST00000381655.7-ATP8A2-D/V-224" + ], + "transcript_expr": [ + 0.007 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1188 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.007 + }, + "Transcript Set 2": { + "peptides": { + "IRQGLSHTAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1743.11 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.789 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.927 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.468 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25171.98 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 47.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.79 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2797.29, + 25515.949, + 688.93, + 4936.173, + "NA", + "NA", + 214.051, + 72.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34535.45, + 40044.03, + 28951.56, + 8664.367, + "NA", + "NA", + 21392.399, + 12429.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.895 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.862 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 14.0, + 0.76, + 4.3, + "NA", + "NA", + 0.789, + 0.71, + 1.272 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 43.0, + 36.0, + 9.7, + "NA", + "NA", + 41.926, + 23.7, + 7.457 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.918, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.945, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.468 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.79 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.004, + 0.368, + 0.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.005, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.71, + 1.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 62.745 + ] + } + }, + "wt_peptide": "IRQGLSHTAD" + }, + "TALMQTREV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1850.97 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.767 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.422 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.674 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 792.81 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.743 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.324 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1833.97, + 1993.52, + 2952.5, + 2842.778, + 458.997, + 570.913, + 142.816, + 1867.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7131.93, + 2761.74, + 4242.33, + 611.631, + 78.852, + 134.763, + 315.552, + 973.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.843 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 0.61, + 3.0, + 7.9, + 5.3, + 6.3, + 0.516, + 6.1, + 0.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 0.86, + 4.1, + 0.7, + 1.3, + 2.0, + 1.118, + 4.09, + 1.113 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.092, + 0.975, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.976, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.324 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.111, + 0.078, + 0.759, + 0.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.006, + 0.795, + 0.741 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 0.286 + ] + } + }, + "wt_peptide": "TADMQTREV" + }, + "ALMQTREVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2871.535 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.315 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.839 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.911 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11898.507 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.491 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.179 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.113 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19681.15, + 3464.8, + 4478.16, + 5382.477, + 1363.986, + 2087.229, + 1133.125, + 2278.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35822.21, + 11679.74, + 11294.36, + 12117.274, + 5306.522, + 16427.444, + 8244.912, + 17163.97 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.464 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 1.2, + 4.3, + 19.0, + 12.0, + 16.0, + 3.079, + 6.93, + 8.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 4.3, + 12.0, + 41.0, + 25.0, + 40.0, + 12.649, + 31.86, + 17.87 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.975, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.97, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.113 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.003, + 0.271, + 0.429 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.082, + 0.572 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 1.478 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 3.359 + ] + } + }, + "wt_peptide": "ADMQTREVL" + } + }, + "transcripts": [ + "ENST00000682472.1-ATP8A2-D/V-224" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1163 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.0 + }, + "Transcript Set 3": { + "peptides": { + "IRQGLSHTAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1743.11 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.789 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.927 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.468 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25171.98 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 47.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.79 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2797.29, + 25515.949, + 688.93, + 4936.173, + "NA", + "NA", + 214.051, + 72.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34535.45, + 40044.03, + 28951.56, + 8664.367, + "NA", + "NA", + 21392.399, + 12429.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.895 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.862 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 14.0, + 0.76, + 4.3, + "NA", + "NA", + 0.789, + 0.71, + 1.272 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 43.0, + 36.0, + 9.7, + "NA", + "NA", + 41.926, + 23.7, + 7.457 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.918, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.945, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.468 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.79 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.004, + 0.368, + 0.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.005, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.71, + 1.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 62.745 + ] + } + }, + "wt_peptide": "IRQGLSHTAD" + }, + "TALMQTREV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1850.97 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.767 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.422 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.674 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 792.81 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.743 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.324 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1833.97, + 1993.52, + 2952.5, + 2842.778, + 458.997, + 570.913, + 142.816, + 1867.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7131.93, + 2761.74, + 4242.33, + 611.631, + 78.852, + 134.763, + 315.552, + 973.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.843 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 0.61, + 3.0, + 7.9, + 5.3, + 6.3, + 0.516, + 6.1, + 0.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 0.86, + 4.1, + 0.7, + 1.3, + 2.0, + 1.118, + 4.09, + 1.113 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.092, + 0.975, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.976, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.324 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.111, + 0.078, + 0.759, + 0.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.006, + 0.795, + 0.741 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 0.286 + ] + } + }, + "wt_peptide": "TADMQTREV" + }, + "IRQGLSHTALM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2188.201 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.596 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.054 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.246 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.492 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4354.772 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.497 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.189 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.173 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3712.62, + 5890.89, + 123.99, + 1785.202, + "NA", + "NA", + 2591.201, + 364.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8547.98, + 13916.15, + 598.54, + 2664.091, + "NA", + "NA", + 6045.453, + 11.07 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.825 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.85, + 2.1, + 0.15, + 0.7, + "NA", + "NA", + 5.5, + 2.2, + 1.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 5.2, + 0.65, + 1.6, + "NA", + "NA", + 9.893, + 0.1, + 2.694 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + "NA", + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.492 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.173 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.004, + 0.037, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.003, + 0.016, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 14.277 + ] + } + }, + "wt_peptide": "IRQGLSHTADM" + }, + "ALMQTREVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2871.535 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.315 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.839 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.911 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11898.507 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.491 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.179 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.113 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19681.15, + 3464.8, + 4478.16, + 5382.477, + 1363.986, + 2087.229, + 1133.125, + 2278.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35822.21, + 11679.74, + 11294.36, + 12117.274, + 5306.522, + 16427.444, + 8244.912, + 17163.97 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.464 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 1.2, + 4.3, + 19.0, + 12.0, + 16.0, + 3.079, + 6.93, + 8.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 4.3, + 12.0, + 41.0, + 25.0, + 40.0, + 12.649, + 31.86, + 17.87 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.975, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.97, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.113 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.003, + 0.271, + 0.429 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.082, + 0.572 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 1.478 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 3.359 + ] + } + }, + "wt_peptide": "ADMQTREVL" + }, + "LMQTREVLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3962.624 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.333 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.873 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.496 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.584 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10896.939 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.721 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.416 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.156 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12416.42, + 5075.69, + 8032.38, + 9047.587, + 1793.949, + 2401.983, + 2849.558, + 550.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23967.79, + 16092.6, + 15967.2, + 17695.746, + 1458.176, + 4629.883, + 5826.677, + 1256.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.611 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.077 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.8, + 1.8, + 7.6, + 32.0, + 14.0, + 17.0, + 5.873, + 2.87, + 4.923 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 6.3, + 17.0, + 54.0, + 13.0, + 23.0, + 9.659, + 4.78, + 10.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.955, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.961, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.584 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.156 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.016, + 0.036, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.054, + 0.35 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 4.732 + ] + } + }, + "wt_peptide": "DMQTREVLM" + } + }, + "transcripts": [ + "ENST00000684424.1-ATP8A2-D/V-184" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1148 + ], + "transcript_count": 1, + "peptide_count": 5, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 2, + 3, + 5 + ], + "set_expr": [ + 0.007, + 0.0, + 0.0 + ], + "DNA VAF": 0.306, + "RNA VAF": 0.0, + "gene_expr": 0.145, + "best_peptide_mt": "IRQGLSHTAL", + "best_peptide_wt": "IRQGLSHTAD", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-37746421-37746422-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FSKFTPDI": { + "ic50s_MT": [ + "X", + "X", + "X", + 8180.785 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.524 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.097 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.129 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 40.83 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14554.197 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.79 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 52.827 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15113.26, + 33517.941, + 8571.13, + 4106.841, + "NA", + "NA", + 7790.44, + 5758.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23510.35, + 27605.56, + 16404.99, + 7208.657, + "NA", + "NA", + 12703.405, + 6704.83 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.374 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.859 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.9, + 25.0, + 7.0, + 3.3, + "NA", + "NA", + 12.097, + 12.95, + 16.153 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 17.0, + 17.0, + 7.3, + "NA", + "NA", + 19.161, + 14.5, + 27.751 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.265, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 40.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 52.827 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.007, + 0.014, + 0.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.01, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.1, + 16.158 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 24.579 + ] + } + }, + "wt_peptide": "FSEFTPDI" + } + }, + "transcripts": [ + "ENST00000379705.8-TRPC4-E/K-138" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 977 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.507, + "RNA VAF": 0.0, + "gene_expr": 0.053, + "best_peptide_mt": "FSKFTPDI", + "best_peptide_wt": "FSEFTPDI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-45399008-45399009-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VRTRIMNQRVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4097.368 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.22 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.878 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.592 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2358.101 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 9.579 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.898 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5364.98, + 4740.72, + 226.04, + 3454.017, + "NA", + "NA", + 6723.574, + 1890.67 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5041.59, + 1167.64, + 228.5, + 3491.591, + "NA", + "NA", + 8691.735, + 1224.61 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.711 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.799 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.6, + 0.28, + 2.4, + "NA", + "NA", + 10.73, + 6.15, + 5.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 0.4, + 0.28, + 2.5, + "NA", + "NA", + 13.234, + 4.7, + 6.744 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + "NA", + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.592 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.898 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.026, + 0.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.001, + 0.014, + 0.074 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 9.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.0, + 16.158 + ] + } + }, + "wt_peptide": "VRTRMMNQRVL" + } + }, + "transcripts": [ + "ENST00000519676.6-SLC25A30-M/I-228", + "ENST00000539591.5-SLC25A30-M/I-177" + ], + "transcript_expr": [ + 7.417, + 0.023 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 291, + 240 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 7.4399999999999995 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.4399999999999995 + ], + "DNA VAF": 0.451, + "RNA VAF": 0.52, + "gene_expr": 20.311, + "best_peptide_mt": "VRTRIMNQRVL", + "best_peptide_wt": "VRTRMMNQRVL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-98431277-98431278-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LAALAEITEM": { + "ic50s_MT": [ + "X", + "X", + "X", + 18547.066 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.601 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.89 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.594 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 13.965 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16339.945 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.484 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 16.161 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21770.73, + 38401.48, + 16053.81, + 21040.322, + "NA", + "NA", + 6364.926, + 6949.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20772.72, + 39025.58, + 13797.25, + 18882.64, + "NA", + "NA", + 3020.13, + 3992.25 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.279 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.442 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.5, + 37.0, + 16.0, + 28.0, + "NA", + "NA", + 10.293, + 14.89, + 14.312 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.6, + 39.0, + 14.0, + 25.0, + "NA", + "NA", + 6.089, + 10.09, + 17.444 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.991, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.976, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 13.965 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.161 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.019, + 0.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.052, + 0.157 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 12.187 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 4.969 + ] + } + }, + "wt_peptide": "RAALAEITEM" + }, + "FRDCLAAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 755.84 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.307 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.79 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.566 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.358 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 466.611 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.081 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.644 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.447 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3424.84, + 4958.28, + 727.23, + 784.45, + "NA", + "NA", + 349.311, + 5.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3902.75, + 3103.73, + 227.27, + 592.096, + "NA", + "NA", + 341.125, + 7.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.533 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.452 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.79, + 1.7, + 0.76, + 0.3, + "NA", + "NA", + 1.214, + 0.03, + 4.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.9, + 0.97, + 0.19, + 0.2, + "NA", + "NA", + 1.192, + 0.05, + 3.737 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.358 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.447 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.002, + 0.218, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.011, + 0.246, + 0.063 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 1.589 + ] + } + }, + "wt_peptide": "FRDCRAAL" + } + }, + "transcripts": [ + "ENST00000319562.11-FARP1-R/L-714" + ], + "transcript_expr": [ + 0.738 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1045 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.738 + }, + "Transcript Set 2": { + "peptides": { + "FRDCLAAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 755.84 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.307 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.79 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.566 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.358 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 466.611 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.081 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.644 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.447 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3424.84, + 4958.28, + 727.23, + 784.45, + "NA", + "NA", + 349.311, + 5.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3902.75, + 3103.73, + 227.27, + 592.096, + "NA", + "NA", + 341.125, + 7.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.533 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.452 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.79, + 1.7, + 0.76, + 0.3, + "NA", + "NA", + 1.214, + 0.03, + 4.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.9, + 0.97, + 0.19, + 0.2, + "NA", + "NA", + 1.192, + 0.05, + 3.737 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.358 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.447 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.002, + 0.218, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.011, + 0.246, + 0.063 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 1.589 + ] + } + }, + "wt_peptide": "FRDCRAAL" + } + }, + "transcripts": [ + "ENST00000595437.5-FARP1-R/L-714" + ], + "transcript_expr": [ + 4.597 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1076 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.597 + }, + "Transcript Set 3": { + "peptides": { + "FRDCLAAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 755.84 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.307 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.79 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.566 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.358 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 466.611 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.081 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.644 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.447 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3424.84, + 4958.28, + 727.23, + 784.45, + "NA", + "NA", + 349.311, + 5.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3902.75, + 3103.73, + 227.27, + 592.096, + "NA", + "NA", + 341.125, + 7.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.533 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.452 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.79, + 1.7, + 0.76, + 0.3, + "NA", + "NA", + 1.214, + 0.03, + 4.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.9, + 0.97, + 0.19, + 0.2, + "NA", + "NA", + 1.192, + 0.05, + 3.737 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.358 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.447 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.002, + 0.218, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.011, + 0.246, + 0.063 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 1.589 + ] + } + }, + "wt_peptide": "FRDCRAAL" + }, + "FRDCLAALAEI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3535.939 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.732 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.887 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.563 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2540.09 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.103 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.039 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.547 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7425.89, + 12656.09, + 731.18, + 573.186, + "NA", + "NA", + 6340.697, + 52.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4638.08, + 8186.18, + 249.16, + 442.1, + "NA", + "NA", + 7080.706, + 83.14 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.094 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.385 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 4.7, + 0.75, + 0.2, + "NA", + "NA", + 10.293, + 0.54, + 1.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 2.9, + 0.29, + 0.2, + "NA", + "NA", + 11.187, + 0.79, + 3.306 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + "NA", + 0.014 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.563 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.547 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.016, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.0, + 0.016, + 0.048 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.8, + 14.277 + ] + } + }, + "wt_peptide": "FRDCRAALAEI" + } + }, + "transcripts": [ + "ENST00000627049.2-FARP1-R/L-714" + ], + "transcript_expr": [ + 5.332 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1076 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 5.332 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 2, + 1, + 2 + ], + "set_expr": [ + 0.738, + 4.597, + 5.332 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.994, + "gene_expr": 26.19, + "best_peptide_mt": "LAALAEITEM", + "best_peptide_wt": "RAALAEITEM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr13-113425167-113425168-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EYQENWFYF": { + "ic50s_MT": [ + "X", + "X", + "X", + 10237.203 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.455 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.301 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.566 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6772.91 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.725 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.608 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.611 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11043.14, + 8615.38, + 13356.59, + 11355.627, + 3110.355, + 9431.267, + 2135.82, + 22996.58 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8153.38, + 5392.44, + 9602.34, + 10757.622, + 680.472, + 3115.803, + 929.991, + 19485.28 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.738 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.594 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 3.1, + 14.0, + 38.0, + 19.0, + 32.0, + 4.813, + 43.18, + 6.096 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.2, + 1.9, + 9.0, + 37.0, + 7.1, + 19.0, + 2.657, + 36.18, + 4.792 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.099, + 0.978, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.078, + 0.981, + 0.06 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.566 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.611 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.002, + 0.382, + 0.747 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.068, + 0.009, + 0.695, + 0.888 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 1.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.77, + 0.446 + ] + } + }, + "wt_peptide": "EYQEHWFYF" + } + }, + "transcripts": [ + "ENST00000612156.3-ADPRHL1-H/N-220" + ], + "transcript_expr": [ + 0.05 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1967 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.05 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.05 + ], + "DNA VAF": 0.517, + "RNA VAF": 0.917, + "gene_expr": 2.743, + "best_peptide_mt": "EYQENWFYF", + "best_peptide_wt": "EYQEHWFYF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-23425383-23425384-T-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LAEMRDERL": { + "ic50s_MT": [ + "X", + "X", + "X", + 11433.646 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.965 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 22.93 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.764 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 46.118 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 35598.33 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 39.669 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 40.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 21.616 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 65.543 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27502.711, + 17229.1, + 20701.6, + 7692.158, + 5294.318, + 10903.603, + 3993.162, + 11963.69 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39878.86, + 31317.8, + 31229.48, + 44389.61, + 172508.302, + 325514.246, + 11863.487, + 10405.78 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.353 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.233 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 6.9, + 23.0, + 27.0, + 25.0, + 34.0, + 7.376, + 22.93, + 15.743 + ] + }, + "WT": { + "HLA-C*06:02": [ + 52.0, + 21.0, + 40.0, + 80.0, + 76.0, + 82.0, + 17.842, + 20.37, + 39.337 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.936, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.888, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 46.118 + ] + }, + "WT": { + "HLA-C*06:02": [ + 65.543 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.039, + 0.152 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.012, + 0.095 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.2, + 6.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23.0, + 20.232 + ] + } + }, + "wt_peptide": "LEEMRDERL" + } + }, + "transcripts": [ + "ENST00000355349.4-MYH7-E/A-774" + ], + "transcript_expr": [ + 0.005 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1935 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.005 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.005 + ], + "DNA VAF": 0.192, + "RNA VAF": 0.0, + "gene_expr": 0.005, + "best_peptide_mt": "LAEMRDERL", + "best_peptide_wt": "LEEMRDERL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-24068642-24068643-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GKEEKEGTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 27126.836 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 22.924 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 30.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.25 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.848 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 38466.235 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 41.946 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 62.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.094 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 37.892 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 33808.59, + 27413.869, + 26839.801, + 7131.082, + 40908.164, + 11549.682, + 5766.594, + 33867.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41625.12, + 36900.9, + 33504.88, + 29108.612, + 87863.804, + 110552.865, + 6408.698, + 40031.57 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.783 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 30.0, + 16.0, + 32.0, + 25.0, + 55.0, + 35.0, + 9.577, + 70.47, + 9.892 + ] + }, + "WT": { + "HLA-C*06:02": [ + 62.0, + 33.0, + 46.0, + 69.0, + 67.0, + 70.0, + 10.379, + 90.25, + 25.687 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.89, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.952, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.848 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37.892 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.018, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.019, + 0.075 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 13.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 12.187 + ] + } + }, + "wt_peptide": "GEEEKEGTL" + } + }, + "transcripts": [ + "ENST00000342740.6-CARMIL3-E/K-1248" + ], + "transcript_expr": [ + 0.535 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1372 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.535 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.535 + ], + "DNA VAF": 0.185, + "RNA VAF": 0.0, + "gene_expr": 1.601, + "best_peptide_mt": "GKEEKEGTL", + "best_peptide_wt": "GEEEKEGTL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-26448937-26448938-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IVPNSRAGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 12822.233 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.071 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.428 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.842 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13439.185 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.995 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.714 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.791 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12497.97, + 25893.619, + 9812.39, + 4830.504, + 13146.495, + 14607.302, + 300.11, + 29425.881 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9087.22, + 27907.68, + 9706.8, + 5681.683, + 17171.57, + 19659.388, + 225.653, + 23629.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.675 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.266 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.8, + 15.0, + 9.3, + 17.0, + 37.0, + 39.0, + 1.067, + 58.16, + 5.498 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 17.0, + 9.2, + 20.0, + 41.0, + 43.0, + 0.825, + 44.56, + 2.652 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.09, + 0.984, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.054, + 0.971, + 0.017 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.842 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.791 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.005, + 0.364, + 0.187 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.001, + 0.453, + 0.213 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.7, + 1.156 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 0.927 + ] + } + }, + "wt_peptide": "IVPNSTAGL" + } + }, + "transcripts": [ + "ENST00000539517.7-NOVA1-T/R-182" + ], + "transcript_expr": [ + 0.059 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 507 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.059 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.059 + ], + "DNA VAF": 0.462, + "RNA VAF": 0.0, + "gene_expr": 0.694, + "best_peptide_mt": "IVPNSRAGL", + "best_peptide_wt": "IVPNSTAGL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-32600790-32600791-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TGSPMAEV": { + "ic50s_MT": [ + "X", + "X", + "X", + 16756.82 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.403 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 45.438 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16556.151 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.78 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 91.021 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26282.859, + 43568.32, + 15625.39, + 17888.25, + "NA", + "NA", + 5554.885, + 14719.54 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28475.0, + 41399.62, + 15795.37, + 17316.932, + "NA", + "NA", + 6098.025, + 15614.15 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.883 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.765 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 62.0, + 16.0, + 24.0, + "NA", + "NA", + 9.349, + 27.56, + 28.403 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 49.0, + 16.0, + 23.0, + "NA", + "NA", + 9.974, + 29.1, + 25.178 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.061, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 45.438 + ] + }, + "WT": { + "HLA-C*06:02": [ + 91.021 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.018, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.016, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.0, + 12.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.4, + 15.161 + ] + } + }, + "wt_peptide": "TGSPKAEV" + } + }, + "transcripts": [ + "ENST00000280979.9-AKAP6-K/M-910" + ], + "transcript_expr": [ + 0.157 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2319 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.157 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.157 + ], + "DNA VAF": 0.708, + "RNA VAF": 0.25, + "gene_expr": 2.905, + "best_peptide_mt": "TGSPMAEV", + "best_peptide_wt": "TGSPKAEV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-32773880-32773881-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IGKESETL": { + "ic50s_MT": [ + "X", + "X", + "X", + 11339.865 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.649 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.49 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.214 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 25.172 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8491.965 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.174 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.187 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.38 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 44.474 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 31117.16, + 40571.711, + 15625.39, + 7054.341, + "NA", + "NA", + 3659.289, + 6701.2 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27249.45, + 35618.53, + 9919.14, + 5743.492, + "NA", + "NA", + 7064.79, + 1160.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.096 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.849 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 24.0, + 45.0, + 16.0, + 7.1, + "NA", + "NA", + 6.951, + 14.49, + 10.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 30.0, + 8.3, + 5.5, + "NA", + "NA", + 11.187, + 4.55, + 27.478 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.04, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 25.172 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44.474 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.039, + 0.127 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.015, + 0.031 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.1, + 6.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.6, + 15.161 + ] + } + }, + "wt_peptide": "MGKESETL" + } + }, + "transcripts": [ + "ENST00000280979.9-AKAP6-M/I-1192" + ], + "transcript_expr": [ + 0.157 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2319 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.157 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.157 + ], + "DNA VAF": 0.607, + "RNA VAF": 1.0, + "gene_expr": 2.905, + "best_peptide_mt": "IGKESETL", + "best_peptide_wt": "MGKESETL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-39247882-39247883-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KIIETEHQI": { + "ic50s_MT": [ + "X", + "X", + "X", + 9959.264 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.2 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.742 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.487 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17557.256 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 19.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 21.77 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.483 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.888 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13912.22, + 21914.891, + 19191.6, + 6903.328, + 6513.434, + 12840.147, + 449.013, + 7078.38 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29087.2, + 29542.98, + 27875.69, + 9245.506, + 11163.747, + 23854.483, + 3311.225, + 11260.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.704 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.406 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.4, + 10.0, + 21.0, + 25.0, + 27.0, + 37.0, + 1.498, + 15.1, + 0.789 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 19.0, + 34.0, + 32.0, + 35.0, + 46.0, + 6.502, + 21.77, + 3.44 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.048, + 0.991, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.051, + 0.987, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.487 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.888 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.048, + 0.004, + 0.735, + 0.742 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.085, + 0.332 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 0.384 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.7, + 3.266 + ] + } + }, + "wt_peptide": "KIIETEDQI" + } + }, + "transcripts": [ + "ENST00000280082.4-MIA2-D/H-437" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 654 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.984, + "RNA VAF": 0.0, + "gene_expr": 41.15, + "best_peptide_mt": "KIIETEHQI", + "best_peptide_wt": "KIIETEDQI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-55180753-55180754-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "PVMPTLLRM": { + "ic50s_MT": [ + "X", + "X", + "X", + 8379.26 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.25 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.99 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.288 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6766.322 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 15.692 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.785 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.599 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16675.4, + 6999.07, + 9759.45, + 6469.41, + 1022.845, + 5291.393, + 12098.321, + 14870.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18042.39, + 5095.44, + 8208.09, + 5324.554, + 538.034, + 2901.149, + 14787.397, + 14707.91 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.851 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.251 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.8, + 2.5, + 9.2, + 23.0, + 9.3, + 25.0, + 18.048, + 27.82, + 7.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.6, + 1.8, + 7.8, + 18.0, + 6.0, + 18.0, + 22.991, + 27.54, + 13.785 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.993, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.985, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.288 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.599 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.003, + 0.01, + 0.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.002, + 0.007, + 0.024 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.1, + 31.643 + ] + } + }, + "wt_peptide": "PVMPTSLRM" + } + }, + "transcripts": [ + "ENST00000247191.7-DLGAP5-S/L-202" + ], + "transcript_expr": [ + 41.11 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 846 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 41.11 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 41.11 + ], + "DNA VAF": 0.24, + "RNA VAF": 0.224, + "gene_expr": 53.642, + "best_peptide_mt": "PVMPTLLRM", + "best_peptide_wt": "PVMPTSLRM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-60724007-60724008-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QSASEGQEA": { + "ic50s_MT": [ + "X", + "X", + "X", + 10447.068 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 22.807 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 20.79 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 21.614 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21950.088 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 27.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 21.596 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 29.829 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 31399.561, + 32973.699, + 31060.99, + 8950.222, + 4850.762, + 3354.054, + 10690.025, + 10204.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33178.42, + 34993.6, + 32787.64, + 11112.536, + 5725.455, + 4587.436, + 9401.752, + 33643.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.045 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.35 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 24.0, + 24.0, + 40.0, + 31.0, + 24.0, + 20.0, + 15.984, + 20.03, + 9.869 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.0, + 28.0, + 44.0, + 38.0, + 26.0, + 23.0, + 14.156, + 69.81, + 15.678 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.937, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.968, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 21.614 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29.829 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.009, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.01, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 22.192 + ] + } + }, + "wt_peptide": "ESASEGQEA" + } + }, + "transcripts": [ + "ENST00000216513.5-SIX4-E/Q-23" + ], + "transcript_expr": [ + 2.619 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 781 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.619 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.619 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.987, + "gene_expr": 15.017, + "best_peptide_mt": "QSASEGQEA", + "best_peptide_wt": "ESASEGQEA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-70060889-70060890-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ERQQNFFIAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6319.885 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.035 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.032 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.119 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.836 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6663.865 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.021 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.913 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.265 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.471 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7904.35, + 30428.641, + 2122.61, + 13648.772, + "NA", + "NA", + 1105.232, + 4735.42 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7146.3, + 29405.86, + 1222.43, + 9865.623, + "NA", + "NA", + 603.123, + 6181.43 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.069 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.695 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.1, + 20.0, + 2.0, + 18.0, + "NA", + "NA", + 3.032, + 11.32, + 1.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 19.0, + 1.3, + 13.0, + "NA", + "NA", + 1.913, + 13.63, + 0.772 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.072, + 0.991, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.109, + 0.982, + 0.071 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.471 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.002, + 0.095, + 0.064 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.004, + 0.161, + 0.068 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 3.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.4, + 2.129 + ] + } + }, + "wt_peptide": "ERQENFFIAL" + } + }, + "transcripts": [ + "ENST00000356921.7-SLC8A3-E/Q-612" + ], + "transcript_expr": [ + 0.005 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 921 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.005 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.005 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.023, + "best_peptide_mt": "ERQQNFFIAL", + "best_peptide_wt": "ERQENFFIAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-91235009-91235029-GGTACAGCTCATCGAGGAGTT-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GREPAPRVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 526.873 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.336 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.63 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.156 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.177 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1895.79, + 648.43, + 461.65, + 592.096, + 48.956, + 80.458, + 83.764, + 24949.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.42, + 0.24, + 0.63, + 0.7, + 0.9, + 1.3, + 0.228, + 47.47, + 0.064 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.979, + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.177 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.464, + 0.267, + 0.816, + 0.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.253 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "SRRPVLPGV": { + "ic50s_MT": [ + "X", + "X", + "X", + 502.065 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.051 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.252 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.194 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.103 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 344.38, + 3914.93, + 659.75, + 727.232, + 127.002, + 97.402, + 62.009, + 22941.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 1.3, + 0.81, + 1.0, + 1.9, + 1.5, + 0.114, + 43.07, + 1.252 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.075, + 0.974, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.016, + 0.768, + 0.249 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.328 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRHPPVREHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 814.742 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.465 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.43 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.277 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.835 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 471.43, + 1310.53, + 65.13, + 1158.053, + "NA", + "NA", + 77.023, + 7940.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.11, + 0.43, + 0.05, + 0.5, + "NA", + "NA", + 0.194, + 16.43, + 0.971 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.064, + 0.993, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.835 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.576, + 0.066, + 0.65, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "YRAGGGLPGQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 915.715 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.579 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.34 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.554 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.779 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1533.56, + 19114.51, + 282.17, + 3766.311, + "NA", + "NA", + 103.587, + 297.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.084 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 8.1, + 0.34, + 2.8, + "NA", + "NA", + 0.335, + 1.92, + 0.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + "NA", + 0.026 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.779 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.192, + 0.094, + 0.501, + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.29, + 0.819 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRAAARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1255.944 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.839 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.716 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.591 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.839 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2318.06, + 3920.99, + 156.47, + 3236.91, + "NA", + "NA", + 193.829, + 131.17 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.247 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.52, + 1.3, + 0.12, + 2.3, + "NA", + "NA", + 0.716, + 1.1, + 0.231 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + "NA", + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.248, + 0.112, + 0.438, + 0.154 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.22, + 0.962 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "GRRRQRGHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2006.555 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.206 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.206 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.511 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10925.24, + 4982.75, + 2621.2, + 1391.909, + 600.911, + 256.785, + 961.172, + 15740.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.157 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 1.7, + 2.7, + 2.8, + 6.4, + 3.4, + 2.724, + 29.33, + 11.976 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.948, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.511 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.088, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 3.212 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRHPPVREHLH": { + "ic50s_MT": [ + "X", + "X", + "X", + 2223.858 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.512 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.625 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.873 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13215.86, + 1839.95, + 1079.41, + 2240.607, + "NA", + "NA", + 2207.109, + 6609.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.789 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 0.57, + 1.2, + 1.1, + "NA", + "NA", + 4.925, + 14.33, + 6.638 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.873 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.009, + 0.046, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 5.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "QRGLPLLHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2391.204 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.285 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.296 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.573 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2877.47, + 4566.43, + 4727.1, + 1904.939, + 781.286, + 660.04, + 77.368, + 19000.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.65, + 1.6, + 4.5, + 4.6, + 7.8, + 6.9, + 0.194, + 35.25, + 0.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.991, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.273, + 0.141, + 0.729, + 0.252 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.2, + 0.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "RRRQRGHLG": { + "ic50s_MT": [ + "X", + "X", + "X", + 2491.83 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.299 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.696 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 12.124 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11630.68, + 581.27, + 4358.65, + 625.01, + 13.36, + 14.144, + 9344.274, + 12589.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.766 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 0.21, + 4.2, + 0.7, + 0.3, + 0.3, + 14.156, + 23.95, + 6.399 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.937, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 12.124 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.01, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "AVRAAARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2959.212 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.651 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.241 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.703 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6340.86, + 3013.46, + 5530.06, + 2904.965, + 694.72, + 521.879, + 456.181, + 6284.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 0.94, + 5.2, + 8.1, + 7.2, + 5.8, + 1.523, + 13.79, + 0.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.973, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.703 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.049, + 0.002, + 0.27, + 0.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.0, + 1.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "GRPLLHLLA": { + "ic50s_MT": [ + "X", + "X", + "X", + 3291.185 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.225 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.582 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.557 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4718.21, + 27627.08, + 11417.23, + 1864.16, + 1053.926, + 1382.197, + 1610.948, + 22421.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.499 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 17.0, + 12.0, + 4.4, + 9.4, + 12.0, + 3.939, + 41.97, + 4.049 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.171, + 0.997, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.557 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + 0.019, + 0.072, + 0.082 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 3.765 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "HRPYHPPDA": { + "ic50s_MT": [ + "X", + "X", + "X", + 3435.341 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.448 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.449 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.98 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.448 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5580.3, + 5777.83, + 8387.64, + 1290.382, + 140.22, + 177.243, + 835.71, + 30810.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 2.0, + 7.9, + 2.4, + 2.1, + 2.5, + 2.448, + 61.82, + 2.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.079, + 0.998, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.448 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.036, + 0.004, + 0.115, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 2.661 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000535815.5-GPR68-NSSMSCT/X-8-14" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 365 + ], + "transcript_count": 1, + "peptide_count": 12, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "GREPAPRVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 526.873 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.336 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.63 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.156 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.177 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1895.79, + 648.43, + 461.65, + 592.096, + 48.956, + 80.458, + 83.764, + 24949.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.42, + 0.24, + 0.63, + 0.7, + 0.9, + 1.3, + 0.228, + 47.47, + 0.064 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.979, + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.177 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.464, + 0.267, + 0.816, + 0.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.253 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "SRRPVLPGV": { + "ic50s_MT": [ + "X", + "X", + "X", + 502.065 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.051 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.252 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.194 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.103 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 344.38, + 3914.93, + 659.75, + 727.232, + 127.002, + 97.402, + 62.009, + 22941.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 1.3, + 0.81, + 1.0, + 1.9, + 1.5, + 0.114, + 43.07, + 1.252 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.075, + 0.974, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.016, + 0.768, + 0.249 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.328 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "YRAGGGLPGQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 915.715 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.579 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.34 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.554 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.779 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1533.56, + 19114.51, + 282.17, + 3766.311, + "NA", + "NA", + 103.587, + 297.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.084 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 8.1, + 0.34, + 2.8, + "NA", + "NA", + 0.335, + 1.92, + 0.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + "NA", + 0.026 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.779 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.192, + 0.094, + 0.501, + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.29, + 0.819 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRAAARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1255.944 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.839 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.716 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.591 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.839 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2318.06, + 3920.99, + 156.47, + 3236.91, + "NA", + "NA", + 193.829, + 131.17 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.247 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.52, + 1.3, + 0.12, + 2.3, + "NA", + "NA", + 0.716, + 1.1, + 0.231 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + "NA", + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.248, + 0.112, + 0.438, + 0.154 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.22, + 0.962 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "GRRRQRGHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2006.555 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.206 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.206 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.511 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10925.24, + 4982.75, + 2621.2, + 1391.909, + 600.911, + 256.785, + 961.172, + 15740.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.157 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 1.7, + 2.7, + 2.8, + 6.4, + 3.4, + 2.724, + 29.33, + 11.976 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.948, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.511 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.088, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 3.212 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRHPPVREHLH": { + "ic50s_MT": [ + "X", + "X", + "X", + 2223.858 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.512 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.625 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.873 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13215.86, + 1839.95, + 1079.41, + 2240.607, + "NA", + "NA", + 2207.109, + 6609.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.789 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 0.57, + 1.2, + 1.1, + "NA", + "NA", + 4.925, + 14.33, + 6.638 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.873 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.009, + 0.046, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 5.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "QRGLPLLHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2391.204 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.285 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.296 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.573 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2877.47, + 4566.43, + 4727.1, + 1904.939, + 781.286, + 660.04, + 77.368, + 19000.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.65, + 1.6, + 4.5, + 4.6, + 7.8, + 6.9, + 0.194, + 35.25, + 0.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.991, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.273, + 0.141, + 0.729, + 0.252 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.2, + 0.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "RRRQRGHLG": { + "ic50s_MT": [ + "X", + "X", + "X", + 2491.83 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.299 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.696 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 12.124 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11630.68, + 581.27, + 4358.65, + 625.01, + 13.36, + 14.144, + 9344.274, + 12589.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.766 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 0.21, + 4.2, + 0.7, + 0.3, + 0.3, + 14.156, + 23.95, + 6.399 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.937, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 12.124 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.01, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "AVRAAARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2959.212 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.651 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.241 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.703 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6340.86, + 3013.46, + 5530.06, + 2904.965, + 694.72, + 521.879, + 456.181, + 6284.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 0.94, + 5.2, + 8.1, + 7.2, + 5.8, + 1.523, + 13.79, + 0.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.973, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.703 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.049, + 0.002, + 0.27, + 0.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.0, + 1.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "HRPYHPPDA": { + "ic50s_MT": [ + "X", + "X", + "X", + 3435.341 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.448 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.449 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.98 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.448 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5580.3, + 5777.83, + 8387.64, + 1290.382, + 140.22, + 177.243, + 835.71, + 30810.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 2.0, + 7.9, + 2.4, + 2.1, + 2.5, + 2.448, + 61.82, + 2.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.079, + 0.998, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.448 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.036, + 0.004, + 0.115, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 2.661 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VREHLHQRGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3992.664 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.636 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.074 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 19.331 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5398.75, + 14210.72, + 860.02, + 2365.16, + "NA", + "NA", + 2846.689, + 5138.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.531 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 5.4, + 0.94, + 1.3, + "NA", + "NA", + 5.873, + 11.97, + 19.165 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.958, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 19.331 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.007, + 0.033, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000650645.1-GPR68-NSSMSCT/X-8-14" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 365 + ], + "transcript_count": 1, + "peptide_count": 11, + "total_expr": 0.0 + }, + "Transcript Set 3": { + "peptides": { + "GREPAPRVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 526.873 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.336 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.63 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.156 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.177 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1895.79, + 648.43, + 461.65, + 592.096, + 48.956, + 80.458, + 83.764, + 24949.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.42, + 0.24, + 0.63, + 0.7, + 0.9, + 1.3, + 0.228, + 47.47, + 0.064 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.979, + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.177 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.464, + 0.267, + 0.816, + 0.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.253 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "SRRPVLPGV": { + "ic50s_MT": [ + "X", + "X", + "X", + 502.065 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.051 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.252 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.194 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.103 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 344.38, + 3914.93, + 659.75, + 727.232, + 127.002, + 97.402, + 62.009, + 22941.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.889 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 1.3, + 0.81, + 1.0, + 1.9, + 1.5, + 0.114, + 43.07, + 1.252 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.075, + 0.974, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.016, + 0.768, + 0.249 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.328 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRHPPVREHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 814.742 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.465 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.43 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.277 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.835 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 471.43, + 1310.53, + 65.13, + 1158.053, + "NA", + "NA", + 77.023, + 7940.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.11, + 0.43, + 0.05, + 0.5, + "NA", + "NA", + 0.194, + 16.43, + 0.971 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.064, + 0.993, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.835 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.576, + 0.066, + 0.65, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "YRAGGGLPGQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 915.715 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.579 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.34 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.554 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.779 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1533.56, + 19114.51, + 282.17, + 3766.311, + "NA", + "NA", + 103.587, + 297.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.084 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 8.1, + 0.34, + 2.8, + "NA", + "NA", + 0.335, + 1.92, + 0.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + "NA", + 0.026 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.779 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.192, + 0.094, + 0.501, + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.29, + 0.819 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRHPPVREHLH": { + "ic50s_MT": [ + "X", + "X", + "X", + 2223.858 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.512 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.625 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.873 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13215.86, + 1839.95, + 1079.41, + 2240.607, + "NA", + "NA", + 2207.109, + 6609.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.789 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 0.57, + 1.2, + 1.1, + "NA", + "NA", + 4.925, + 14.33, + 6.638 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.873 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.009, + 0.046, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 5.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "RRRQRGHLG": { + "ic50s_MT": [ + "X", + "X", + "X", + 2491.83 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.299 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.696 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 12.124 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11630.68, + 581.27, + 4358.65, + 625.01, + 13.36, + 14.144, + 9344.274, + 12589.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.766 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 0.21, + 4.2, + 0.7, + 0.3, + 0.3, + 14.156, + 23.95, + 6.399 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.937, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 12.124 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.01, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "AVRAAARQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2959.212 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.651 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.241 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.703 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6340.86, + 3013.46, + 5530.06, + 2904.965, + 694.72, + 521.879, + 456.181, + 6284.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.674 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 0.94, + 5.2, + 8.1, + 7.2, + 5.8, + 1.523, + 13.79, + 0.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.973, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.703 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.049, + 0.002, + 0.27, + 0.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.0, + 1.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "GRPLLHLLA": { + "ic50s_MT": [ + "X", + "X", + "X", + 3291.185 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.225 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.582 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.557 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4718.21, + 27627.08, + 11417.23, + 1864.16, + 1053.926, + 1382.197, + 1610.948, + 22421.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.499 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 17.0, + 12.0, + 4.4, + 9.4, + 12.0, + 3.939, + 41.97, + 4.049 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.171, + 0.997, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.557 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + 0.019, + 0.072, + 0.082 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 3.765 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "HRPYHPPDA": { + "ic50s_MT": [ + "X", + "X", + "X", + 3435.341 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.448 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.449 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.98 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.448 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5580.3, + 5777.83, + 8387.64, + 1290.382, + 140.22, + 177.243, + 835.71, + 30810.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 2.0, + 7.9, + 2.4, + 2.1, + 2.5, + 2.448, + 61.82, + 2.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.079, + 0.998, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.448 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.036, + 0.004, + 0.115, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 2.661 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000531499.2-GPR68-NSSMSCT/X-8-14" + ], + "transcript_expr": [ + 0.047 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 365 + ], + "transcript_count": 1, + "peptide_count": 9, + "total_expr": 0.047 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 12, + 11, + 9 + ], + "set_expr": [ + 0.0, + 0.0, + 0.047 + ], + "DNA VAF": 0.093, + "RNA VAF": 0.0, + "gene_expr": 0.177, + "best_peptide_mt": "GREPAPRVL", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-91783159-91783160-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "AVNQWNETVI": { + "ic50s_MT": [ + "X", + "X", + "X", + 16298.127 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.153 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 23.153 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.11 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21060.297 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.425 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.146 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 30116.82, + 30906.779, + 5182.46, + 11233.424, + "NA", + "NA", + 9620.812, + 21362.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30003.32, + 31067.03, + 6903.33, + 12117.274, + "NA", + "NA", + 9554.079, + 30925.13 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.915 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.906 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 21.0, + 4.4, + 14.0, + "NA", + "NA", + 14.433, + 39.83, + 29.26 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 21.0, + 6.1, + 15.0, + "NA", + "NA", + 14.433, + 62.14, + 29.014 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.973, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + 0.956, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.146 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.013, + 0.075 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.024, + 0.25 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 29.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25.0, + 9.849 + ] + } + }, + "wt_peptide": "AVNQWKETVI" + } + }, + "transcripts": [ + "ENST00000360594.9-TC2N-K/N-471" + ], + "transcript_expr": [ + 0.106 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 490 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.106 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.106 + ], + "DNA VAF": 0.151, + "RNA VAF": 0.125, + "gene_expr": 1.985, + "best_peptide_mt": "AVNQWNETVI", + "best_peptide_wt": "AVNQWKETVI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-94382907-94382908-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FNLTDIPEA": { + "ic50s_MT": [ + "X", + "X", + "X", + 10482.491 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.28 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.027 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.328 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.56 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11081.717 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.416 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.307 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 9.666 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 16.833 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23427.061, + 27537.25, + 25564.301, + 13070.666, + 5306.522, + 6317.86, + 7894.315, + 46.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22877.49, + 29024.33, + 25564.3, + 14099.072, + 6836.125, + 8064.362, + 7437.851, + 38.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.42 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.487 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 16.0, + 30.0, + 43.0, + 25.0, + 27.0, + 12.205, + 0.49, + 17.027 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 18.0, + 30.0, + 46.0, + 28.0, + 30.0, + 11.687, + 0.41, + 18.307 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.966, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.981, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.56 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.833 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.023, + 0.179 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.023, + 0.171 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 10.656 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.1, + 10.232 + ] + } + }, + "wt_peptide": "FNLTEIPEA" + } + }, + "transcripts": [ + "ENST00000404814.8-SERPINA1-E/D-110" + ], + "transcript_expr": [ + 0.677 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 418 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.677 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.677 + ], + "DNA VAF": 0.18, + "RNA VAF": 0.0, + "gene_expr": 4.892, + "best_peptide_mt": "FNLTDIPEA", + "best_peptide_wt": "FNLTEIPEA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr14-94463231-94463232-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TAATTNKFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 5811.42 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.556 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.656 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.576 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6163.994 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.907 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.937 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.138 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4256.49, + 8576.41, + 11233.42, + 7366.35, + 3853.097, + 1860.244, + 472.246, + 14678.79 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1830.42, + 6910.35, + 7775.84, + 8032.377, + 5417.638, + 2369.027, + 245.884, + 7986.21 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.879 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.547 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.99, + 3.1, + 12.0, + 26.0, + 21.0, + 15.0, + 1.564, + 27.49, + 1.223 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.4, + 2.5, + 7.3, + 29.0, + 25.0, + 17.0, + 0.894, + 16.5, + 0.53 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.104, + 0.847, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.103, + 0.818, + 0.134 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.576 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.138 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.037, + 0.005, + 0.175, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.098, + 0.052, + 0.315, + 0.069 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 2.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.56, + 1.314 + ] + } + }, + "wt_peptide": "TAATTTKFI" + } + }, + "transcripts": [ + "ENST00000337425.10-SERPINA9-T/N-390" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 435 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.461, + "RNA VAF": 0.0, + "gene_expr": 0.035, + "best_peptide_mt": "TAATTNKFI", + "best_peptide_wt": "TAATTTKFI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-40622778-40622779-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FLKEKQNV": { + "ic50s_MT": [ + "X", + "X", + "X", + 7683.072 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.24 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.066 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 85.918 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13539.701 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.128 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.796 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 89.263 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16425.07, + 15470.79, + 2707.68, + 4429.969, + "NA", + "NA", + 10936.174, + 3093.35 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30120.08, + 33446.21, + 13722.81, + 13356.592, + "NA", + "NA", + 11240.023, + 7653.86 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.297 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.484 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.6, + 6.0, + 2.2, + 3.8, + "NA", + "NA", + 16.328, + 8.48, + 14.654 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 25.0, + 14.0, + 18.0, + "NA", + "NA", + 16.855, + 16.0, + 18.257 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.226, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.432, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 85.918 + ] + }, + "WT": { + "HLA-C*06:02": [ + 89.263 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.005, + 0.012, + 0.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.011, + 0.06 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 22.192 + ] + } + }, + "wt_peptide": "FPKEKQNV" + } + }, + "transcripts": [ + "ENST00000399668.7-KNL1-P/S-839" + ], + "transcript_expr": [ + 7.471 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2316 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.471 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.471 + ], + "DNA VAF": 0.444, + "RNA VAF": 0.492, + "gene_expr": 13.527, + "best_peptide_mt": "FLKEKQNV", + "best_peptide_wt": "FPKEKQNV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-40622778-40622780-CC-TT": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FLKEKQNV": { + "ic50s_MT": [ + "X", + "X", + "X", + 7683.072 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.24 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.066 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 85.918 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13539.701 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.128 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.796 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 89.263 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16425.07, + 15470.79, + 2707.68, + 4429.969, + "NA", + "NA", + 10936.174, + 3093.35 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30120.08, + 33446.21, + 13722.81, + 13356.592, + "NA", + "NA", + 11240.023, + 7653.86 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.297 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.484 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.6, + 6.0, + 2.2, + 3.8, + "NA", + "NA", + 16.328, + 8.48, + 14.654 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 25.0, + 14.0, + 18.0, + "NA", + "NA", + 16.855, + 16.0, + 18.257 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.226, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.432, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 85.918 + ] + }, + "WT": { + "HLA-C*06:02": [ + 89.263 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.005, + 0.012, + 0.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.005, + 0.011, + 0.06 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 22.192 + ] + } + }, + "wt_peptide": "FPKEKQNV" + } + }, + "transcripts": [ + "ENST00000399668.7-KNL1-P/L-839" + ], + "transcript_expr": [ + 7.471 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2316 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.471 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.471 + ], + "DNA VAF": 0.45, + "RNA VAF": "NA", + "gene_expr": 13.527, + "best_peptide_mt": "FLKEKQNV", + "best_peptide_wt": "FPKEKQNV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-40622779-40622780-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ESVQKPKFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 10482.949 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.426 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.928 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 26720.645 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 42.939 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 43.878 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 32.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.31 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11008.3, + 12101.03, + 9972.95, + 10992.949, + 3730.869, + 3300.426, + 657.854, + 22338.289 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39340.16, + 39822.8, + 39622.53, + 23444.561, + 12788.217, + 10803.637, + 21800.694, + 29996.73 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.719 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.197 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 4.5, + 9.4, + 38.0, + 21.0, + 20.0, + 2.04, + 41.81, + 0.819 + ] + }, + "WT": { + "HLA-C*06:02": [ + 49.0, + 42.0, + 67.0, + 63.0, + 37.0, + 34.0, + 43.878, + 59.64, + 12.749 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.991, + 0.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.99, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.928 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.31 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.049, + 0.001, + 0.197, + 0.163 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.058 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.0, + 1.852 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 46.225 + ] + } + }, + "wt_peptide": "ESVQKPKFP" + } + }, + "transcripts": [ + "ENST00000399668.7-KNL1-P/L-839" + ], + "transcript_expr": [ + 7.471 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2316 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.471 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.471 + ], + "DNA VAF": 0.444, + "RNA VAF": 0.492, + "gene_expr": 13.527, + "best_peptide_mt": "ESVQKPKFL", + "best_peptide_wt": "ESVQKPKFP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-43149136-43149137-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DCKDNRRYRIF": { + "ic50s_MT": [ + "X", + "X", + "X", + 23498.811 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 22.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 33.612 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 13.593 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 24930.15 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 19.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.622 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 11.4 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "2", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 33775.309, + 26463.779, + 20589.91, + 26407.713, + "NA", + "NA", + 19928.656, + 2954.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28681.25, + 28359.71, + 21500.59, + 39837.459, + "NA", + "NA", + 18026.851, + 3681.55 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.129 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.993 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 30.0, + 15.0, + 23.0, + 35.0, + "NA", + "NA", + 36.861, + 8.22, + 11.439 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 17.0, + 24.0, + 49.0, + "NA", + "NA", + 30.5, + 9.54, + 9.111 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + "NA", + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 13.593 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.4 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.007, + 0.078 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.6, + 31.643 + ] + } + }, + "wt_peptide": "DWKDNRRYRIF" + } + }, + "transcripts": [ + "ENST00000260403.7-TMEM62-W/C-284" + ], + "transcript_expr": [ + 1.366 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 643 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.366 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.366 + ], + "DNA VAF": 0.96, + "RNA VAF": 1.0, + "gene_expr": 3.179, + "best_peptide_mt": "DCKDNRRYRIF", + "best_peptide_wt": "DWKDNRRYRIF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-44767434-44767452-AAATGGACAGTTGGAGTTG-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IRESIIRKG": { + "ic50s_MT": [ + "X", + "X", + "X", + 4970.114 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.9 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.809 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.564 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5079.23 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.4 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.909 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.681 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18357.85, + 8797.85, + 16583.461, + 864.682, + 1142.378, + 898.607, + 8993.967, + 824.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19453.77, + 8472.2, + 15541.08, + 953.119, + 275.937, + 282.208, + 9183.964, + 1686.26 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.536 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.623 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.8, + 3.2, + 18.0, + 1.3, + 9.8, + 8.5, + 13.61, + 3.69, + 0.514 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.6, + 3.0, + 16.0, + 1.6, + 3.5, + 3.6, + 13.877, + 5.74, + 0.643 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.043, + 0.992, + 0.063 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.991, + 0.055 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.564 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.681 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.004, + 0.012, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.003, + 0.012, + 0.04 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.2, + 18.618 + ] + } + }, + "wt_peptide": "VRESIIRKG" + } + }, + "transcripts": [ + "ENST00000560442.5-TRIM69-KWTVGVV/I-185-191", + "ENST00000561043.5-TRIM69-KWTVGVV/I-152-158" + ], + "transcript_expr": [ + 0.236, + 0.036 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 3.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 296, + 263 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.27199999999999996 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.27199999999999996 + ], + "DNA VAF": 0.299, + "RNA VAF": 0.0, + "gene_expr": 21.208, + "best_peptide_mt": "IRESIIRKG", + "best_peptide_wt": "VRESIIRKG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-44767453-44767453-T-TC": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QRIHHSEGQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5752.564 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.6 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.873 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 18.904 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7353.61, + 14762.54, + 1145.59, + 4151.518, + "NA", + "NA", + 380.449, + 8448.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.267 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 5.6, + 1.3, + 3.3, + "NA", + "NA", + 1.302, + 17.23, + 14.087 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.923, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 18.904 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.006, + 0.199, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 1.845 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000329464.9-TRIM69-V/VX-395" + ], + "transcript_expr": [ + 0.304 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 500 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.304 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.304 + ], + "DNA VAF": 0.324, + "RNA VAF": 0.0, + "gene_expr": 21.208, + "best_peptide_mt": "QRIHHSEGQL", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-45133932-45133933-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HKWGSKGSRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 16468.801 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.328 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 22.957 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.942 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 42.916 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3115.106 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.545 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.642 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 20.613 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18369.77, + 36862.199, + 11172.82, + 19088.055, + "NA", + "NA", + 1960.371, + 14567.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2886.51, + 17172.89, + 638.68, + 3343.702, + "NA", + "NA", + 101.48, + 5743.12 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.683 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.817 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.9, + 33.0, + 9.7, + 25.0, + "NA", + "NA", + 4.539, + 27.3, + 22.957 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.65, + 6.9, + 0.69, + 2.4, + "NA", + "NA", + 0.323, + 12.93, + 6.929 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.996, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.992, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 42.916 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.613 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.001, + 0.088, + 0.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.085, + 0.016, + 0.581, + 0.139 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.7, + 3.185 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.63, + 0.653 + ] + } + }, + "wt_peptide": "HRWGSKGSRL" + } + }, + "transcripts": [ + "ENST00000389037.7-DUOX1-R/K-43" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1551 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 0.947, + "best_peptide_mt": "HKWGSKGSRL", + "best_peptide_wt": "HRWGSKGSRL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-49282070-49282071-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSEEGTAKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 9594.131 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.65 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.335 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.194 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10272.165 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.35 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 10.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.924 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.846 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19295.711, + 23861.949, + 15795.37, + 3343.701, + 2823.644, + 3392.892, + 756.976, + 17546.551 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17230.4, + 19996.89, + 15795.37, + 3380.076, + 5899.429, + 5041.619, + 238.408, + 14644.9 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.283 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.044 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.5, + 13.0, + 17.0, + 9.8, + 18.0, + 20.0, + 2.277, + 32.56, + 2.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 8.6, + 17.0, + 10.0, + 26.0, + 24.0, + 0.869, + 27.43, + 1.732 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.85, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.891, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.194 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.846 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.299, + 0.357 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.002, + 0.694, + 0.513 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.3, + 1.369 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.4, + 0.447 + ] + } + }, + "wt_peptide": "LAEEGTAKL" + } + }, + "transcripts": [ + "ENST00000560031.6-GALK2-A/S-197" + ], + "transcript_expr": [ + 0.717 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 458 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.717 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.717 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 24.473, + "best_peptide_mt": "LSEEGTAKL", + "best_peptide_wt": "LAEEGTAKL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-50643416-50643417-T-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ELHPRITQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2515.01 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.208 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.365 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.616 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2551.67 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.867 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.471 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.915 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3228.27, + 2519.84, + 2510.18, + 7860.427, + 1647.442, + 1561.601, + 75.066, + 18828.131 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3570.52, + 1986.72, + 3116.62, + 6399.79, + 1602.544, + 940.957, + 102.055, + 23719.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.174 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.74, + 0.8, + 2.6, + 28.0, + 14.0, + 13.0, + 0.181, + 34.92, + 0.37 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.82, + 0.61, + 3.2, + 23.0, + 13.0, + 8.8, + 0.329, + 44.75, + 0.185 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.997, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.996, + 0.044 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.616 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.915 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.255, + 0.001, + 0.654, + 0.143 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.236, + 0.001, + 0.548, + 0.102 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.21, + 0.519 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.22, + 0.723 + ] + } + }, + "wt_peptide": "ELHPRIKQL" + } + }, + "transcripts": [ + "ENST00000646667.1-TRPM7-K/T-153", + "ENST00000560955.5-TRPM7-K/T-153" + ], + "transcript_expr": [ + 2.162, + 19.6 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + "NA", + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1865, + 1864 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 21.762 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 21.762 + ], + "DNA VAF": 0.5, + "RNA VAF": 0.45, + "gene_expr": 28.628, + "best_peptide_mt": "ELHPRITQL", + "best_peptide_wt": "ELHPRIKQL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-62819536-62819537-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KFKQQLAAF": { + "ic50s_MT": [ + "X", + "X", + "X", + 18565.994 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.227 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.631 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.265 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 24045.532 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.749 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.361 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 21.318 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13432.39, + 31226.439, + 23699.6, + 11112.536, + 94582.328, + 137901.828, + 761.933, + 6525.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17082.46, + 32038.92, + 28795.36, + 19295.705, + 54051.78, + 85618.97, + 2286.803, + 11513.49 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.806 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.163 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 21.0, + 27.0, + 38.0, + 68.0, + 72.0, + 2.277, + 14.19, + 6.816 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.0, + 23.0, + 36.0, + 56.0, + 59.0, + 66.0, + 5.073, + 22.18, + 12.091 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.994, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.996, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.265 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.318 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + 0.0, + 0.274, + 0.325 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.0, + 0.151, + 0.413 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 1.461 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 2.222 + ] + } + }, + "wt_peptide": "EFKQQLAAF" + } + }, + "transcripts": [ + "ENST00000636159.2-TLN2-E/K-2265" + ], + "transcript_expr": [ + 4.469 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2542 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.469 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 4.469 + ], + "DNA VAF": 0.452, + "RNA VAF": 0.351, + "gene_expr": 20.006, + "best_peptide_mt": "KFKQQLAAF", + "best_peptide_wt": "EFKQQLAAF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-69049033-69049034-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MHQAEEAQY": { + "ic50s_MT": [ + "X", + "X", + "X", + 16561.52 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.6 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.257 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 26.593 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 39080.06 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 39.744 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 48.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.596 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 45.488 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18870.59, + 30586.41, + 11541.43, + 14252.448, + 124110.922, + 24297.971, + 3448.697, + 671.56 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38963.99, + 37356.06, + 39196.13, + 44389.61, + 91371.341, + 180123.344, + 10324.732, + 4412.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.774 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.386 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 20.0, + 12.0, + 46.0, + 71.0, + 47.0, + 6.699, + 3.26, + 6.479 + ] + }, + "WT": { + "HLA-C*06:02": [ + 48.0, + 34.0, + 65.0, + 80.0, + 67.0, + 76.0, + 15.497, + 10.8, + 16.367 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.871, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.919, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 26.593 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45.488 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.0, + 0.203, + 0.628 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.01, + 0.021 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 1.814 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 22.192 + ] + } + }, + "wt_peptide": "MDQAEEAQY" + } + }, + "transcripts": [ + "ENST00000388866.8-NOX5-D/H-659" + ], + "transcript_expr": [ + 0.013 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 765 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.013 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.013 + ], + "DNA VAF": 0.396, + "RNA VAF": 0.0, + "gene_expr": 0.16, + "best_peptide_mt": "MHQAEEAQY", + "best_peptide_wt": "MDQAEEAQY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-74280668-74280669-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YYSSTSIKG": { + "ic50s_MT": [ + "X", + "X", + "X", + 11018.344 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.983 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 22.53 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.667 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12356.66 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.034 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 26.562 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.368 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20467.301, + 18929.279, + 24882.07, + 5324.554, + 1034.689, + 1360.097, + 16712.133, + 2904.05 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15807.16, + 14142.46, + 19717.81, + 3975.676, + 747.842, + 775.479, + 17700.562, + 10570.86 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.595 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.82 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.4, + 7.9, + 29.0, + 18.0, + 9.3, + 12.0, + 27.088, + 8.13, + 4.796 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.3, + 5.3, + 22.0, + 14.0, + 7.5, + 7.7, + 29.959, + 20.65, + 6.968 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.981, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.035, + 0.919, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.667 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.368 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.007, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.006, + 0.013 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.9, + 46.225 + ] + } + }, + "wt_peptide": "YYSSTSMKG" + } + }, + "transcripts": [ + "ENST00000398814.8-CCDC33-M/I-297" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 755 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.585, + "RNA VAF": 1.0, + "gene_expr": 0.158, + "best_peptide_mt": "YYSSTSIKG", + "best_peptide_wt": "YYSSTSMKG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-84036950-84036951-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VQKKKPFSW": { + "ic50s_MT": [ + "X", + "X", + "X", + 29851.287 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 29.35 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 41.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.51 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 19.7 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21162.929 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 24.456 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 40.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.066 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.912 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17242.891, + 38882.711, + 31740.461, + 20813.898, + 48956.461, + 27962.113, + 4964.388, + 40297.379 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16198.1, + 37870.45, + 30893.41, + 16053.811, + 25281.917, + 17043.94, + 2744.267, + 38557.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.644 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 39.0, + 41.0, + 59.0, + 58.0, + 49.0, + 8.572, + 91.1, + 9.281 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.5, + 36.0, + 40.0, + 50.0, + 47.0, + 41.0, + 5.742, + 85.36, + 5.211 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.992, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.996, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 19.7 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.912 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.043, + 0.0, + 0.187, + 0.699 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065, + 0.001, + 0.307, + 0.721 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.92 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.79, + 1.342 + ] + } + }, + "wt_peptide": "VQKKKPISW" + } + }, + "transcripts": [ + "ENST00000286744.10-ADAMTSL3-I/F-1645" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1691 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.366, + "RNA VAF": 0.0, + "gene_expr": 2.043, + "best_peptide_mt": "VQKKKPFSW", + "best_peptide_wt": "VQKKKPISW", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-94399982-94399983-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RFVEDSRNL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3164.351 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.071 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.44 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.714 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.641 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4033.896 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.22 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.564 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.94 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5975.56, + 4515.72, + 6829.04, + 4018.926, + 2253.253, + 2309.777, + 184.456, + 1115.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5770.34, + 4053.86, + 5681.68, + 4778.521, + 3234.521, + 4013.932, + 151.405, + 1654.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.871 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.674 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 1.5, + 6.2, + 14.0, + 16.0, + 16.0, + 0.674, + 4.44, + 1.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.4, + 5.2, + 16.0, + 19.0, + 22.0, + 0.546, + 5.66, + 0.732 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + 0.981, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.974, + 0.017 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.641 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.94 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + 0.002, + 0.559, + 0.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.114, + 0.002, + 0.583, + 0.25 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.73, + 0.697 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.48, + 0.649 + ] + } + }, + "wt_peptide": "RFVEDSRKL" + }, + "FVEDSRNL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3404.077 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.854 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.19 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.854 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 32.063 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3333.225 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.836 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.772 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.599 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 36.013 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21185.84, + 8719.38, + 2649.72, + 3766.311, + "NA", + "NA", + 3041.843, + 649.59 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20537.63, + 7988.43, + 2469.77, + 4196.68, + "NA", + "NA", + 987.264, + 288.6 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.704 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.273 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.0, + 3.1, + 2.2, + 2.9, + "NA", + "NA", + 6.13, + 3.19, + 5.771 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 2.9, + 2.1, + 3.4, + "NA", + "NA", + 2.772, + 1.88, + 2.685 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.253, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.095, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 32.063 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.013 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.064, + 0.054, + 0.169 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.12, + 0.176, + 0.235 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.9, + 4.807 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 1.998 + ] + } + }, + "wt_peptide": "FVEDSRKL" + }, + "SRNLSKKI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4676.745 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.288 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.688 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.214 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5326.3 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.551 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.124 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 34.633 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7253.72, + 17364.211, + 1097.07, + 2099.77, + "NA", + "NA", + 954.297, + 8498.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9525.87, + 21879.82, + 2289.62, + 1709.588, + "NA", + "NA", + 1936.597, + 8362.98 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.237 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 7.0, + 1.2, + 1.0, + "NA", + "NA", + 2.703, + 17.31, + 0.768 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 10.0, + 2.0, + 0.7, + "NA", + "NA", + 4.501, + 17.09, + 2.513 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.214 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.633 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.078, + 0.015, + 0.113, + 0.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.049, + 0.007, + 0.048, + 0.014 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 2.677 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.0, + 5.248 + ] + } + }, + "wt_peptide": "SRKLSKKI" + } + }, + "transcripts": [ + "ENST00000557742.1-MCTP2-K/N-239" + ], + "transcript_expr": [ + 0.025 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 306 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.025 + }, + "Transcript Set 2": { + "peptides": { + "RFVEDSRNL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3164.351 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.071 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.44 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.714 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.641 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4033.896 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.22 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.564 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.94 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5975.56, + 4515.72, + 6829.04, + 4018.926, + 2253.253, + 2309.777, + 184.456, + 1115.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5770.34, + 4053.86, + 5681.68, + 4778.521, + 3234.521, + 4013.932, + 151.405, + 1654.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.871 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.674 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 1.5, + 6.2, + 14.0, + 16.0, + 16.0, + 0.674, + 4.44, + 1.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.4, + 5.2, + 16.0, + 19.0, + 22.0, + 0.546, + 5.66, + 0.732 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + 0.981, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.974, + 0.017 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.641 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.94 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + 0.002, + 0.559, + 0.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.114, + 0.002, + 0.583, + 0.25 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.73, + 0.697 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.48, + 0.649 + ] + } + }, + "wt_peptide": "RFVEDSRKL" + }, + "SRNLSKKI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4676.745 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.288 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.688 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.214 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5326.3 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.551 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.124 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 34.633 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7253.72, + 17364.211, + 1097.07, + 2099.77, + "NA", + "NA", + 954.297, + 8498.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9525.87, + 21879.82, + 2289.62, + 1709.588, + "NA", + "NA", + 1936.597, + 8362.98 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.237 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 7.0, + 1.2, + 1.0, + "NA", + "NA", + 2.703, + 17.31, + 0.768 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 10.0, + 2.0, + 0.7, + "NA", + "NA", + 4.501, + 17.09, + 2.513 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.214 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.633 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.078, + 0.015, + 0.113, + 0.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.049, + 0.007, + 0.048, + 0.014 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 2.677 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.0, + 5.248 + ] + } + }, + "wt_peptide": "SRKLSKKI" + } + }, + "transcripts": [ + "ENST00000357742.10-MCTP2-K/N-651", + "ENST00000451018.7-MCTP2-K/N-651" + ], + "transcript_expr": [ + 0.082, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 878, + 823 + ], + "transcript_count": 2, + "peptide_count": 2, + "total_expr": 0.082 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 2 + ], + "peptide_counts": [ + 3, + 2 + ], + "set_expr": [ + 0.025, + 0.082 + ], + "DNA VAF": 0.203, + "RNA VAF": 0.0, + "gene_expr": 0.138, + "best_peptide_mt": "RFVEDSRNL", + "best_peptide_wt": "RFVEDSRKL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr15-100900576-100900577-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DADLYLAVE": { + "ic50s_MT": [ + "X", + "X", + "X", + 15990.246 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 33.147 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 34.65 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 40.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.006 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 20515.195 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 43.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 47.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 35.079 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 21.747 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 43416.328, + 40443.32, + 42051.98, + 5267.254, + 6306.813, + 7880.794, + 13292.491, + 18688.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45685.23, + 43295.77, + 44389.61, + 6195.392, + 14022.001, + 15979.751, + 6614.454, + 25050.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.336 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.523 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 74.0, + 45.0, + 79.0, + 18.0, + 27.0, + 30.0, + 20.123, + 34.65, + 42.857 + ] + }, + "WT": { + "HLA-C*06:02": [ + 90.0, + 60.0, + 93.0, + 22.0, + 38.0, + 40.0, + 10.638, + 47.7, + 49.392 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.998, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.997, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.747 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.008, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.015, + 0.008 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 50.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 54.0, + 16.158 + ] + } + }, + "wt_peptide": "DADLDLAVE" + } + }, + "transcripts": [ + "ENST00000329841.10-ALDH1A3-D/Y-296" + ], + "transcript_expr": [ + 13.653 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 512 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 13.653 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 13.653 + ], + "DNA VAF": 0.359, + "RNA VAF": 0.542, + "gene_expr": 15.852, + "best_peptide_mt": "DADLYLAVE", + "best_peptide_wt": "DADLDLAVE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-2295600-2295601-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ILPRDSTHRF": { + "ic50s_MT": [ + "X", + "X", + "X", + 19481.0 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.721 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.873 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.087 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 20018.715 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.74 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.58 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.473 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.495 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19561.619, + 42427.641, + 19400.381, + 48403.09, + "NA", + "NA", + 8577.54, + 17992.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20741.73, + 42183.21, + 19295.7, + 50000.0, + "NA", + "NA", + 10694.7, + 8668.9 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.229 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.254 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 55.0, + 21.0, + 56.0, + "NA", + "NA", + 13.117, + 33.38, + 13.356 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.6, + 53.0, + 21.0, + 57.0, + "NA", + "NA", + 15.984, + 17.58, + 13.833 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.956, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.962, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.087 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.495 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.048, + 0.42 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.047, + 0.477 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.4, + 5.347 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.6, + 5.347 + ] + } + }, + "wt_peptide": "ILPRESTHRF" + } + }, + "transcripts": [ + "ENST00000301732.10-ABCA3-E/D-801" + ], + "transcript_expr": [ + 4.203 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1704 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.203 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 4.203 + ], + "DNA VAF": 0.578, + "RNA VAF": 0.628, + "gene_expr": 6.12, + "best_peptide_mt": "ILPRDSTHRF", + "best_peptide_wt": "ILPRESTHRF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-3745299-3745300-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QYDIIWPSGFV": { + "ic50s_MT": [ + "X", + "X", + "X", + 22496.904 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 21.653 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 35.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 17.153 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 10.15 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17537.855 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.654 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.425 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.072 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25510.141, + 37509.961, + 22451.539, + 4727.097, + "NA", + "NA", + 21030.404, + 22542.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18220.91, + 37470.21, + 16854.8, + 3416.846, + "NA", + "NA", + 13588.3, + 28219.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.336 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.768 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 35.0, + 26.0, + 4.2, + "NA", + "NA", + 40.993, + 42.23, + 42.852 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.8, + 34.0, + 18.0, + 2.4, + "NA", + "NA", + 20.654, + 55.12, + 25.263 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.077, + "NA", + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 10.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.072 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.013, + 0.294 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.025, + 0.354 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 9.849 + ] + } + }, + "wt_peptide": "HYDIIWPSGFV" + } + }, + "transcripts": [ + "ENST00000262367.10-CREBBP-H/Q-1297" + ], + "transcript_expr": [ + 7.351 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2442 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.351 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.351 + ], + "DNA VAF": 0.239, + "RNA VAF": 0.303, + "gene_expr": 54.323, + "best_peptide_mt": "QYDIIWPSGFV", + "best_peptide_wt": "HYDIIWPSGFV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-25221522-25221523-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MLIGGLNLVI": { + "ic50s_MT": [ + "X", + "X", + "X", + 13229.69 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.179 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.279 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.953 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10058.093 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.165 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.191 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20946.52, + 34442.551, + 8571.13, + 17888.25, + "NA", + "NA", + 3265.838, + 5291.51 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21234.26, + 31551.11, + 6903.33, + 13212.856, + "NA", + "NA", + 1714.125, + 6084.43 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.188 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.242 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.8, + 27.0, + 7.5, + 23.0, + "NA", + "NA", + 6.452, + 12.22, + 2.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.0, + 22.0, + 6.1, + 17.0, + "NA", + "NA", + 4.13, + 13.48, + 2.537 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.931, + 0.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.975, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.953 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.191 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.032, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.061, + 0.048 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 7.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 4.33 + ] + } + }, + "wt_peptide": "MLIGGLNLVM" + } + }, + "transcripts": [ + "ENST00000219660.6-AQP8-M/I-109" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 261 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.247, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "MLIGGLNLVI", + "best_peptide_wt": "MLIGGLNLVM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-25246937-25246938-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FFKDMDALL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1469.265 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.038 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.54 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.545 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.711 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2971.534 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.058 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.39 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.841 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.518 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1173.77, + 2368.64, + 1804.62, + 2169.046, + 1405.432, + 1533.098, + 102.472, + 211.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8626.3, + 5087.79, + 3766.31, + 3807.283, + 2176.757, + 2140.77, + 208.501, + 718.13 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.913 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.34 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.27, + 0.75, + 2.0, + 5.5, + 13.0, + 13.0, + 0.329, + 1.54, + 1.326 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 1.8, + 3.7, + 13.0, + 16.0, + 16.0, + 0.772, + 3.39, + 3.015 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.16, + 0.967, + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.054, + 0.963, + 0.03 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.711 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.518 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 0.018, + 0.647, + 0.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.005, + 0.617, + 0.379 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.56, + 0.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 0.583 + ] + } + }, + "wt_peptide": "FFEDMDALL" + } + }, + "transcripts": [ + "ENST00000328086.12-ZKSCAN2-E/K-420" + ], + "transcript_expr": [ + 3.754 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 967 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.754 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.754 + ], + "DNA VAF": 0.454, + "RNA VAF": 0.441, + "gene_expr": 4.925, + "best_peptide_mt": "FFKDMDALL", + "best_peptide_wt": "FFEDMDALL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-49281350-49281351-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NSNPTSDPT": { + "ic50s_MT": [ + "X", + "X", + "X", + 17484.131 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 32.345 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 31.305 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 40.612 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.595 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25848.946 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 47.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 51.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 53.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 25.357 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 35174.289, + 37626.199, + 38150.109, + 6262.789, + 994.97, + 1881.785, + 18954.471, + 16013.79 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40030.16, + 41676.93, + 41151.77, + 9759.454, + 3671.217, + 8801.77, + 21336.353, + 30361.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.983 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.613 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 34.0, + 35.0, + 60.0, + 22.0, + 9.1, + 15.0, + 33.385, + 29.79, + 31.305 + ] + }, + "WT": { + "HLA-C*06:02": [ + 53.0, + 51.0, + 74.0, + 34.0, + 21.0, + 31.0, + 41.926, + 60.61, + 52.587 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.969, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.982, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.595 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25.357 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 35.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44.0, + 62.745 + ] + } + }, + "wt_peptide": "DSNPTSDPT" + } + }, + "transcripts": [ + "ENST00000219197.11-CBLN1-D/N-39" + ], + "transcript_expr": [ + 0.331 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 193 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.331 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.331 + ], + "DNA VAF": 0.215, + "RNA VAF": 0.4, + "gene_expr": 0.713, + "best_peptide_mt": "NSNPTSDPT", + "best_peptide_wt": "DSNPTSDPT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-58516554-58516555-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LANIHSEYQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 11367.018 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 18.462 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.225 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 26.309 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.27 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14816.372 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 23.922 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.843 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 36.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.694 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29846.92, + 10274.37, + 27875.689, + 2842.778, + 767.026, + 537.737, + 12459.666, + 24089.869 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31167.03, + 11614.46, + 30068.96, + 2873.703, + 1745.059, + 791.717, + 18018.284, + 23155.47 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.716 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 3.8, + 34.0, + 7.9, + 7.7, + 6.0, + 18.699, + 45.55, + 18.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 4.3, + 38.0, + 8.0, + 14.0, + 7.8, + 30.5, + 43.53, + 23.843 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.045, + 0.961, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.945, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.694 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.008, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.024 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 25.0, + 27.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.0, + 46.225 + ] + } + }, + "wt_peptide": "LANIRSEYQ" + } + }, + "transcripts": [ + "ENST00000219315.9-SETD6-R/H-185" + ], + "transcript_expr": [ + 1.607 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 473 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.607 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.607 + ], + "DNA VAF": 0.335, + "RNA VAF": 0.34, + "gene_expr": 11.622, + "best_peptide_mt": "LANIHSEYQ", + "best_peptide_wt": "LANIRSEYQ", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-74391670-74391671-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YLLVPLPL": { + "ic50s_MT": [ + "X", + "X", + "X", + 22304.596 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.527 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.635 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 35.52 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 41493.725 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 65.608 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 67.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 42.309 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 65.215 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27815.74, + 37327.762, + 14023.0, + 50000.0, + "NA", + "NA", + 8522.064, + 16793.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43578.7, + 46248.74, + 39408.75, + 50000.0, + "NA", + "NA", + 27385.587, + 28987.67 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.421 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.965 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 34.0, + 14.0, + 58.0, + "NA", + "NA", + 13.001, + 31.18, + 17.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + 75.0, + 83.0, + 67.0, + 58.0, + "NA", + "NA", + 75.138, + 57.06, + 64.967 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 35.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 65.215 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.029, + 0.273 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.012, + 0.346 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 8.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + 66.0, + 18.618 + ] + } + }, + "wt_peptide": "YLLVPLPP" + } + }, + "transcripts": [ + "ENST00000692376.1-NPIPB15-P/L-308" + ], + "transcript_expr": [ + 9.491 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 443 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 9.491 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 9.491 + ], + "DNA VAF": 0.409, + "RNA VAF": 0.015, + "gene_expr": 10.432, + "best_peptide_mt": "YLLVPLPL", + "best_peptide_wt": "YLLVPLPP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr16-87417563-87417564-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SSVQTPQTQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 12405.247 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 17.309 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.774 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14310.489 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.338 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.675 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.809 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.879 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 35820.281, + 28058.77, + 32085.75, + 10641.854, + 1329.872, + 2603.574, + 7810.574, + 14168.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37455.2, + 23648.62, + 29584.89, + 8853.904, + 704.385, + 1369.525, + 11164.558, + 17456.42 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.876 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.188 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 36.0, + 17.0, + 42.0, + 37.0, + 12.0, + 18.0, + 12.097, + 26.62, + 7.623 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.0, + 13.0, + 37.0, + 31.0, + 7.2, + 12.0, + 16.675, + 32.39, + 12.567 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.952, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.959, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.774 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.879 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.012, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.009, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 27.617 + ] + } + }, + "wt_peptide": "SSLQTPQTQ" + } + }, + "transcripts": [ + "ENST00000671377.2-ZCCHC14-L/V-427" + ], + "transcript_expr": [ + 3.421 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1086 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.421 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.421 + ], + "DNA VAF": 0.277, + "RNA VAF": 0.248, + "gene_expr": 12.705, + "best_peptide_mt": "SSVQTPQTQ", + "best_peptide_wt": "SSLQTPQTQ", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-3433668-3433669-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HLHTHVYLF": { + "ic50s_MT": [ + "X", + "X", + "X", + 1916.175 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.214 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.66 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.424 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6718.765 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.115 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.637 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.328 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3088.53, + 1253.34, + 2579.01, + 8119.757, + 915.82, + 1090.36, + 455.378, + 20397.949 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8014.84, + 5422.69, + 9499.0, + 8664.367, + 4895.646, + 4938.215, + 1619.703, + 23578.79 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.764 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.526 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 0.41, + 2.7, + 29.0, + 8.6, + 9.6, + 1.523, + 37.93, + 0.905 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 1.9, + 8.9, + 31.0, + 24.0, + 24.0, + 3.97, + 44.45, + 4.261 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.999, + 0.076 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.999, + 0.021 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.424 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.328 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.108, + 0.018, + 0.505, + 0.465 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.068, + 0.007, + 0.126, + 0.258 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.51, + 0.811 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.77, + 2.504 + ] + } + }, + "wt_peptide": "HLHTPVYLF" + } + }, + "transcripts": [ + "ENST00000248384.1-OR1E2-P/H-58" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 323 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.312, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "HLHTHVYLF", + "best_peptide_wt": "HLHTPVYLF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-4545724-4545725-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "WVEVLVGIL": { + "ic50s_MT": [ + "X", + "X", + "X", + 16151.965 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 25.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 26.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 34.112 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.953 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9173.022 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.79 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.624 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 32041.0, + 30291.33, + 25426.369, + 6903.328, + 5282.141, + 7170.839, + 16844.73, + 15459.2 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31090.24, + 25678.79, + 19191.6, + 5932.98, + 2522.377, + 5099.998, + 11111.345, + 7234.7 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.964 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 26.0, + 20.0, + 30.0, + 25.0, + 25.0, + 28.0, + 27.539, + 28.85, + 14.132 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 15.0, + 21.0, + 21.0, + 17.0, + 24.0, + 16.675, + 15.36, + 8.729 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.985, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.982, + 0.018 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.953 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.624 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.009, + 0.01 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 24.579 + ] + } + }, + "wt_peptide": "WVEVLVEIL" + } + }, + "transcripts": [ + "ENST00000254718.9-MYBBP1A-E/G-653" + ], + "transcript_expr": [ + 23.899 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1328 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 23.899 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 23.899 + ], + "DNA VAF": 0.352, + "RNA VAF": 0.319, + "gene_expr": 47.493, + "best_peptide_mt": "WVEVLVGIL", + "best_peptide_wt": "WVEVLVEIL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-4818361-4818376-TGGACAGAATCCTGAA-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KVGDEIVA": { + "ic50s_MT": [ + "X", + "X", + "X", + 28033.615 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 38.885 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 34.693 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 43.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 40.411 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 34364.274 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 55.046 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 38.442 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 74.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 47.347 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 44317.141, + 46613.961, + 34798.02, + 21269.211, + "NA", + "NA", + 19398.527, + 10657.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 47447.45, + 46873.42, + 43439.36, + 25289.189, + "NA", + "NA", + 20555.664, + 14506.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.183 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.418 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 80.0, + 86.0, + 49.0, + 29.0, + "NA", + "NA", + 34.693, + 20.79, + 12.466 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 88.0, + 89.0, + 34.0, + "NA", + "NA", + 38.442, + 27.19, + 16.988 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.215, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.138, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 40.411 + ] + }, + "WT": { + "HLA-C*06:02": [ + 47.347 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.007, + 0.068 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.005, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 50.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 86.0, + 62.745 + ] + } + }, + "wt_peptide": "KVGDEIVD" + } + }, + "transcripts": [ + "ENST00000572940.5-PLD2-VDRILK/V-662-667" + ], + "transcript_expr": [ + 9.105 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 922 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 9.105 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 9.105 + ], + "DNA VAF": 0.225, + "RNA VAF": 0.012, + "gene_expr": 35.11, + "best_peptide_mt": "KVGDEIVA", + "best_peptide_wt": "KVGDEIVD", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-5007046-5007047-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FSPNTEFQI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4187.998 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.513 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.303 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.532 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3598.131 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.682 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.217 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.464 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3849.12, + 9274.26, + 9706.8, + 4526.876, + 598.15, + 1838.95, + 367.235, + 7729.19 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4532.17, + 5298.41, + 6978.43, + 2664.091, + 272.151, + 750.879, + 208.874, + 6617.77 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.451 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 3.3, + 9.2, + 16.0, + 6.4, + 15.0, + 1.268, + 16.11, + 0.43 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 1.9, + 6.4, + 7.2, + 3.5, + 7.5, + 0.772, + 14.34, + 0.406 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.143, + 0.964, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.075, + 0.909, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.532 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.464 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.058, + 0.002, + 0.219, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.046, + 0.001, + 0.309, + 0.017 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 1.726 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 1.334 + ] + } + }, + "wt_peptide": "FSPNTESQI" + } + }, + "transcripts": [ + "ENST00000320785.10-KIF1C-S/F-433" + ], + "transcript_expr": [ + 43.138 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1103 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 43.138 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 43.138 + ], + "DNA VAF": 0.316, + "RNA VAF": 0.297, + "gene_expr": 121.453, + "best_peptide_mt": "FSPNTEFQI", + "best_peptide_wt": "FSPNTESQI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-7588499-7588500-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SLPESDPRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 12722.974 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.052 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.003 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.103 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18041.982 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.822 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.882 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.643 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13588.07, + 22493.6, + 14023.0, + 11857.879, + 7617.457, + 18179.0, + 197.394, + 10254.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17032.99, + 23997.37, + 18578.65, + 17505.314, + 10041.764, + 21506.513, + 474.13, + 18879.94 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.525 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.3, + 12.0, + 15.0, + 40.0, + 29.0, + 42.0, + 0.725, + 20.12, + 3.113 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.0, + 13.0, + 20.0, + 53.0, + 33.0, + 45.0, + 1.564, + 35.02, + 4.249 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.982, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.975, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.643 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + 0.004, + 0.847, + 0.712 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.004, + 0.576, + 0.556 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 0.205 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 0.664 + ] + } + }, + "wt_peptide": "SLPQSDPRL" + } + }, + "transcripts": [ + "ENST00000538513.6-SOX15-Q/E-194" + ], + "transcript_expr": [ + 0.106 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 233 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.106 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.106 + ], + "DNA VAF": 0.722, + "RNA VAF": 0.692, + "gene_expr": 0.58, + "best_peptide_mt": "SLPESDPRL", + "best_peptide_wt": "SLPQSDPRL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-7675087-7675088-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QHMTEVVRH": { + "ic50s_MT": [ + "X", + "X", + "X", + 29413.66 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.8 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 22.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.296 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.589 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 35355.42 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 20.255 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 27.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.361 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.574 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 32046.211, + 31841.93, + 17791.74, + 26985.391, + 100881.141, + 95404.75, + 9859.638, + 8056.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32517.37, + 38193.47, + 19717.81, + 50000.0, + 3530286.891, + 890368.937, + 2736.564, + 9256.62 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.862 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.81 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 26.0, + 22.0, + 19.0, + 67.0, + 68.0, + 68.0, + 14.877, + 16.6, + 7.458 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.0, + 37.0, + 22.0, + 83.0, + 97.0, + 90.0, + 5.703, + 18.51, + 6.853 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.987, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.992, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.589 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.574 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.113, + 0.719 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.285, + 0.69 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.9, + 2.692 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.3, + 1.421 + ] + } + }, + "wt_peptide": "QHMTEVVRR" + } + }, + "transcripts": [ + "ENST00000445888.6-TP53-R/H-175" + ], + "transcript_expr": [ + 0.561 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 393 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.561 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.561 + ], + "DNA VAF": 0.989, + "RNA VAF": 1.0, + "gene_expr": 165.032, + "best_peptide_mt": "QHMTEVVRH", + "best_peptide_wt": "QHMTEVVRR", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-10499040-10499041-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EKDTLVSQLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 23369.74 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 26.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.519 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 35646.835 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 57.581 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 61.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 55.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.299 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29608.9, + 41405.012, + 17130.58, + 5044.154, + "NA", + "NA", + 15344.582, + 30473.74 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42983.97, + 45506.65, + 40489.28, + 9972.946, + "NA", + "NA", + 23783.953, + 30804.39 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 49.0, + 18.0, + 4.5, + "NA", + "NA", + 23.974, + 60.91, + 7.664 + ] + }, + "WT": { + "HLA-C*06:02": [ + 71.0, + 76.0, + 73.0, + 13.0, + "NA", + "NA", + 53.361, + 61.8, + 40.736 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.955, + 0.014 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.967, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.519 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.299 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.004, + 0.007, + 0.023 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.004, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 49.0, + 62.745 + ] + } + }, + "wt_peptide": "EKDTLVSQLS" + } + }, + "transcripts": [ + "ENST00000226207.6-MYH1-S/L-1306" + ], + "transcript_expr": [ + 0.009 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1939 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.009 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.009 + ], + "DNA VAF": 0.988, + "RNA VAF": 0.0, + "gene_expr": 0.009, + "best_peptide_mt": "EKDTLVSQLL", + "best_peptide_wt": "EKDTLVSQLS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-11784434-11784435-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SIPPLIHLA": { + "ic50s_MT": [ + "X", + "X", + "X", + 4212.402 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.054 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.256 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.292 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10200.093 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.75 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.277 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.125 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5657.27, + 31702.699, + 13872.1, + 4242.334, + 3774.07, + 2745.175, + 521.429, + 4182.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16261.5, + 37866.34, + 22330.41, + 5681.683, + 6468.596, + 5099.998, + 1913.297, + 13931.59 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.729 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.431 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 22.0, + 15.0, + 15.0, + 21.0, + 18.0, + 1.697, + 10.41, + 0.837 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.5, + 36.0, + 25.0, + 20.0, + 27.0, + 24.0, + 4.464, + 26.21, + 3.601 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.262, + 0.999, + 0.094 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.103, + 0.995, + 0.038 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.292 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.125 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.061, + 0.016, + 0.224, + 0.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.05, + 0.023 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.82, + 1.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.5, + 5.054 + ] + } + }, + "wt_peptide": "SIPPLIDLA" + } + }, + "transcripts": [ + "ENST00000454412.6-DNAH9-D/H-2653" + ], + "transcript_expr": [ + 0.001 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 4410 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.001 + }, + "Transcript Set 2": { + "peptides": { + "QKSIPPLIHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 22522.551 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.006 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 25.61 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.559 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.47 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27791.37 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.96 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 29.959 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.63 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 11.382 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18350.109, + 43724.18, + 26694.99, + 34237.816, + "NA", + "NA", + 12865.053, + 13577.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25676.01, + 43473.21, + 29906.73, + 30068.96, + "NA", + "NA", + 17820.288, + 12594.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.378 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.435 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.8, + 63.0, + 32.0, + 43.0, + "NA", + "NA", + 19.395, + 25.61, + 16.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 61.0, + 38.0, + 39.0, + "NA", + "NA", + 29.959, + 23.96, + 17.317 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.036, + 0.991, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.078, + 0.989, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.382 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.075, + 0.012, + 0.135 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.017, + 0.007, + 0.046 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.9, + 37.359 + ] + } + }, + "wt_peptide": "QKSIPPLIDL" + } + }, + "transcripts": [ + "ENST00000262442.9-DNAH9-D/H-2653" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 4486 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 0.001, + 0.0 + ], + "DNA VAF": 0.349, + "RNA VAF": 0.0, + "gene_expr": 0.061, + "best_peptide_mt": "QKSIPPLIHL", + "best_peptide_wt": "QKSIPPLIDL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-29286059-29286060-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SAKEQRYQT": { + "ic50s_MT": [ + "X", + "X", + "X", + 14069.192 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 21.13 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 57.496 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27877.5 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 28.35 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 35.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 7.415 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 60.735 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 22825.07, + 21530.85, + 26265.23, + 2054.82, + 2295.144, + 1090.36, + 15760.225, + 12378.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25848.27, + 30955.97, + 29906.73, + 13501.892, + 80317.466, + 49495.988, + 4628.005, + 19233.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.041 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.128 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 9.7, + 32.0, + 5.1, + 16.0, + 9.6, + 25.056, + 23.61, + 9.811 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 21.0, + 38.0, + 44.0, + 65.0, + 58.0, + 8.179, + 35.7, + 11.42 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.949, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.949, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 57.496 + ] + }, + "WT": { + "HLA-C*06:02": [ + 60.735 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.0, + 0.006, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.021, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.9, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 11.63 + ] + } + }, + "wt_peptide": "SAKEQRYQR" + } + }, + "transcripts": [ + "ENST00000225388.9-NUFIP2-R/T-645" + ], + "transcript_expr": [ + 21.43 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 695 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 21.43 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 21.43 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.998, + "gene_expr": 31.008, + "best_peptide_mt": "SAKEQRYQT", + "best_peptide_wt": "SAKEQRYQR", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-41771694-41771736-GTGTACTGGCGCCCGCAGGCCTCATCCTCCTCCATGATGCCCT-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "STLKKTTTY": { + "ic50s_MT": [ + "X", + "X", + "X", + 11824.36 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.675 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.678 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.749 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4673.742 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.399 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.337 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.886 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8961.08, + 12465.42, + 9447.76, + 18679.436, + 20408.449, + 11183.301, + 343.04, + 19722.561 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3994.82, + 2209.79, + 3116.62, + 11986.875, + 10442.633, + 5352.664, + 209.903, + 12049.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.393 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.103 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 4.6, + 8.9, + 56.0, + 44.0, + 35.0, + 1.202, + 36.64, + 3.352 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.92, + 0.69, + 3.2, + 40.0, + 34.0, + 25.0, + 0.772, + 23.06, + 1.913 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.98, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.974, + 0.017 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.749 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.886 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.081, + 0.0, + 0.565, + 0.454 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.182, + 0.003, + 0.746, + 0.55 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.67, + 0.685 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.31, + 0.364 + ] + } + }, + "wt_peptide": "YTLKKTTTY" + } + }, + "transcripts": [ + "ENST00000310706.9-JUP-KGIMEEDEACGRQYT/T-40-54" + ], + "transcript_expr": [ + 4.061 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 745 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.061 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 4.061 + ], + "DNA VAF": 0.224, + "RNA VAF": 0.0, + "gene_expr": 7.21, + "best_peptide_mt": "STLKKTTTY", + "best_peptide_wt": "YTLKKTTTY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-45119014-45119029-TAGACGGTCGTTGTTG-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HSEGAEIEE": { + "ic50s_MT": [ + "X", + "X", + "X", + 20202.129 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 31.947 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 33.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 32.08 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.895 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 33730.239 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 50.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 53.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 44.809 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 34.782 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1, 2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 44553.211, + 44238.578, + 42740.039, + 7131.082, + 4062.656, + 9967.127, + 6295.204, + 30437.131 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45856.58, + 43253.62, + 43204.99, + 17505.314, + 24255.487, + 55663.435, + 12025.582, + 20088.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.495 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.653 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 82.0, + 66.0, + 83.0, + 25.0, + 22.0, + 33.0, + 10.212, + 60.81, + 18.477 + ] + }, + "WT": { + "HLA-C*06:02": [ + 92.0, + 60.0, + 86.0, + 53.0, + 47.0, + 60.0, + 18.048, + 37.33, + 22.147 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.98, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032, + 0.976, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.895 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.782 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.015, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.009, + 0.026 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 49.0, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 62.0, + 27.617 + ] + } + }, + "wt_peptide": "RLEGAEIEE" + } + }, + "transcripts": [ + "ENST00000619929.5-PLCD3-SNNDRL/S-233-238" + ], + "transcript_expr": [ + 3.769 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 789 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.769 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.769 + ], + "DNA VAF": 0.941, + "RNA VAF": 1.0, + "gene_expr": 26.946, + "best_peptide_mt": "HSEGAEIEE", + "best_peptide_wt": "RLEGAEIEE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-78484882-78484883-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QHKDHRHWY": { + "ic50s_MT": [ + "X", + "X", + "X", + 3477.809 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.116 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.431 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.734 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.792 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1938.914 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.828 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.795 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.443 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.847 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7054.57, + 4112.84, + 1407.05, + 2842.778, + 7921.547, + 1533.098, + 1891.422, + 19882.211 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4842.49, + 919.57, + 605.05, + 2968.512, + 2876.14, + 503.002, + 1001.687, + 8402.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.819 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.847 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 1.4, + 1.7, + 7.9, + 30.0, + 13.0, + 4.431, + 36.94, + 1.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 0.33, + 0.79, + 8.4, + 18.0, + 5.7, + 2.795, + 17.16, + 1.122 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.996, + 0.049 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.957, + 0.047 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.792 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.847 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.109, + 0.001, + 0.051, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.103, + 0.003, + 0.137, + 0.156 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 4.969 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.53, + 2.357 + ] + } + }, + "wt_peptide": "QHMDHRHWY" + } + }, + "transcripts": [ + "ENST00000389840.7-DNAH17-M/K-2545" + ], + "transcript_expr": [ + 0.066 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 4462 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.066 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.066 + ], + "DNA VAF": 0.232, + "RNA VAF": 0.0, + "gene_expr": 0.134, + "best_peptide_mt": "QHKDHRHWY", + "best_peptide_wt": "QHMDHRHWY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-80086142-80086143-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VTQEQDEQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 7955.613 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.285 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.27 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.53 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 33.581 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6905.93 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.775 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.601 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 23.176 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23548.289, + 14186.6, + 8806.13, + 11355.627, + 3279.518, + 7105.097, + 952.339, + 5324.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22141.55, + 14929.11, + 8758.62, + 9654.428, + 1848.46, + 5053.241, + 618.583, + 2435.93 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.689 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.303 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 5.4, + 8.3, + 38.0, + 20.0, + 28.0, + 2.703, + 12.27, + 5.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.8, + 5.7, + 8.3, + 33.0, + 15.0, + 24.0, + 1.944, + 7.25, + 2.83 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.986, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + 0.97, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 33.581 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23.176 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.001, + 0.094, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.002, + 0.134, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 3.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 2.402 + ] + } + }, + "wt_peptide": "VTQEQEEQL" + } + }, + "transcripts": [ + "ENST00000397545.9-CCDC40-E/D-792" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1142 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.181, + "RNA VAF": 0.3, + "gene_expr": 5.546, + "best_peptide_mt": "VTQEQDEQL", + "best_peptide_wt": "VTQEQEEQL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr17-82961144-82961145-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLFFYEHV": { + "ic50s_MT": [ + "X", + "X", + "X", + 16664.893 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.895 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.79 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 23.809 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.559 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13813.334 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 19.29 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.731 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27618.699, + 30551.029, + 12183.0, + 8853.904, + "NA", + "NA", + 21146.787, + 6889.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27431.98, + 28406.69, + 11730.27, + 10992.949, + "NA", + "NA", + 15896.399, + 6328.8 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.2 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 20.0, + 12.0, + 9.5, + "NA", + "NA", + 40.993, + 14.79, + 14.437 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 18.0, + 12.0, + 14.0, + "NA", + "NA", + 25.445, + 13.87, + 12.804 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + "NA", + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.559 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.731 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.009, + 0.167 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.009, + 0.117 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 27.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 24.579 + ] + } + }, + "wt_peptide": "LLFFYEHL" + } + }, + "transcripts": [ + "ENST00000320865.4-B3GNTL1-L/V-198" + ], + "transcript_expr": [ + 1.555 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 346 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.555 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.555 + ], + "DNA VAF": 0.221, + "RNA VAF": 0.235, + "gene_expr": 10.001, + "best_peptide_mt": "LLFFYEHV", + "best_peptide_wt": "LLFFYEHL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr18-14106118-14106119-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IAMNKYQHKFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 11799.63 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.46 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.344 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 26.712 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.719 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 29763.92 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 33.427 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 46.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 31.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 16.015 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13464.11, + 27971.471, + 2240.61, + 5044.154, + "NA", + "NA", + 19677.957, + 10135.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27670.74, + 40666.65, + 12584.95, + 41151.772, + "NA", + "NA", + 23267.371, + 31857.1 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.658 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.606 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 17.0, + 2.2, + 4.6, + "NA", + "NA", + 35.386, + 19.92, + 5.344 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 46.0, + 13.0, + 50.0, + "NA", + "NA", + 50.718, + 64.7, + 20.855 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.037, + "NA", + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.719 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.015 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.006, + 0.006, + 0.038 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.006, + 0.089 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 46.225 + ] + } + }, + "wt_peptide": "IPMNKYQHKFL" + } + }, + "transcripts": [ + "ENST00000590202.3-ZNF519-P/A-141" + ], + "transcript_expr": [ + 0.746 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 540 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.746 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.746 + ], + "DNA VAF": 0.453, + "RNA VAF": 0.35, + "gene_expr": 8.05, + "best_peptide_mt": "IAMNKYQHKFL", + "best_peptide_wt": "IPMNKYQHKFL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr18-36067341-36067342-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSNSQHSVQTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4364.217 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.375 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.062 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.42 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.911 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4341.209 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.328 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.002 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.828 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.553 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23335.74, + 29924.211, + 2416.9, + 4989.872, + "NA", + "NA", + 3738.563, + 954.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24774.62, + 30976.74, + 2510.18, + 4196.68, + "NA", + "NA", + 4485.738, + 2069.91 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.383 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 19.0, + 2.4, + 4.5, + "NA", + "NA", + 7.062, + 4.04, + 9.992 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 21.0, + 2.5, + 3.4, + "NA", + "NA", + 8.002, + 6.52, + 16.311 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.553 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.011, + 0.028, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.022, + 0.02 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 8.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 10.656 + ] + } + }, + "wt_peptide": "LSNSQQSVQTL" + } + }, + "transcripts": [ + "ENST00000357384.8-RPRD1A-Q/H-21" + ], + "transcript_expr": [ + 2.747 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 312 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.747 + }, + "Transcript Set 2": { + "peptides": { + "SQHSVQTLSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6768.18 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.34 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.98 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.991 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.045 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13614.6 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.755 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.67 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.02 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 32.315 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10175.02, + 39697.191, + 3033.45, + 18082.848, + "NA", + "NA", + 1288.9, + 3361.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17869.88, + 43530.16, + 8853.9, + 35752.131, + "NA", + "NA", + 3671.769, + 9359.32 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.37 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.445 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.9, + 42.0, + 2.7, + 24.0, + "NA", + "NA", + 3.376, + 8.98, + 44.049 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.5, + 62.0, + 7.7, + 45.0, + "NA", + "NA", + 6.952, + 18.67, + 46.656 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.995, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.976, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.045 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.315 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.003, + 0.144, + 0.241 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.027, + 0.023 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.7, + 2.282 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.2, + 8.839 + ] + } + }, + "wt_peptide": "SQQSVQTLSL" + }, + "LSNSQHSVQTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4364.217 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.375 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.062 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.42 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.911 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4341.209 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.328 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.002 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.828 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.553 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23335.74, + 29924.211, + 2416.9, + 4989.872, + "NA", + "NA", + 3738.563, + 954.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24774.62, + 30976.74, + 2510.18, + 4196.68, + "NA", + "NA", + 4485.738, + 2069.91 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.383 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 19.0, + 2.4, + 4.5, + "NA", + "NA", + 7.062, + 4.04, + 9.992 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 21.0, + 2.5, + 3.4, + "NA", + "NA", + 8.002, + 6.52, + 16.311 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.553 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.011, + 0.028, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.022, + 0.02 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 8.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 10.656 + ] + } + }, + "wt_peptide": "LSNSQQSVQTL" + } + }, + "transcripts": [ + "ENST00000399022.9-RPRD1A-Q/H-21" + ], + "transcript_expr": [ + 17.082 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 312 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 17.082 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 1, + 2 + ], + "set_expr": [ + 2.747, + 17.082 + ], + "DNA VAF": 0.417, + "RNA VAF": 0.5, + "gene_expr": 57.249, + "best_peptide_mt": "SQHSVQTLSL", + "best_peptide_wt": "SQQSVQTLSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr18-60371739-60371740-T-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MFFTLLALM": { + "ic50s_MT": [ + "X", + "X", + "X", + 1311.905 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.55 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.507 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.635 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 839.106 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.056 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.911 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.977 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.575 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6440.43, + 1374.64, + 2920.72, + 1249.169, + 313.192, + 364.393, + 1406.977, + 37.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6004.54, + 569.21, + 1999.98, + 1109.003, + 243.114, + 231.51, + 1515.204, + 44.11 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.975 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.102 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 0.44, + 3.0, + 2.3, + 3.9, + 4.4, + 3.595, + 0.4, + 1.518 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 0.21, + 2.2, + 1.9, + 3.2, + 3.1, + 3.796, + 0.46, + 1.911 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.057, + 0.991, + 0.058 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.992, + 0.062 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.635 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.575 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.004, + 0.063, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.003, + 0.059, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 4.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.5, + 4.455 + ] + } + }, + "wt_peptide": "MFFTMLALM" + } + }, + "transcripts": [ + "ENST00000299766.5-MC4R-M/L-204" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 332 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "MFFTLLALM", + "best_peptide_wt": "MFFTMLALM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr18-80136551-80136552-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSQPVGLV": { + "ic50s_MT": [ + "X", + "X", + "X", + 11014.047 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.026 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 11.583 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 16.596 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 18.66 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18566.095 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 23.149 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 22.677 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 24.322 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.665 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21566.061, + 32237.83, + 8998.77, + 7287.077, + "NA", + "NA", + 13029.324, + 6689.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26453.18, + 43343.59, + 20368.33, + 16763.86, + "NA", + "NA", + 14576.75, + 12382.76 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.137 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.742 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.3, + 23.0, + 7.4, + 7.4, + "NA", + "NA", + 19.636, + 14.47, + 11.583 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 60.0, + 22.0, + 22.0, + "NA", + "NA", + 22.677, + 23.62, + 24.57 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.056, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 18.66 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.665 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.002, + 0.011, + 0.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.007, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 31.643 + ] + } + }, + "wt_peptide": "LSQPVGPV" + } + }, + "transcripts": [ + "ENST00000262198.9-ADNP2-P/L-380" + ], + "transcript_expr": [ + 10.673 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1131 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 10.673 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 10.673 + ], + "DNA VAF": 0.932, + "RNA VAF": 1.0, + "gene_expr": 19.521, + "best_peptide_mt": "LSQPVGLV", + "best_peptide_wt": "LSQPVGPV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr18-80138228-80138229-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ISAPKDSSS": { + "ic50s_MT": [ + "X", + "X", + "X", + 28038.854 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 29.959 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 34.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 26.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 25.919 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 22403.804 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.629 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 35.386 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 33.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 29.873 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 31085.189, + 37233.371, + 36534.219, + 18882.639, + 24992.518, + 31229.857, + 15992.873, + 9581.55 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31865.02, + 34358.42, + 36337.11, + 19295.705, + 17734.135, + 25151.854, + 19655.755, + 4344.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.065 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.201 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 24.0, + 34.0, + 55.0, + 56.0, + 47.0, + 50.0, + 25.445, + 19.03, + 10.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25.0, + 27.0, + 54.0, + 56.0, + 42.0, + 47.0, + 35.386, + 10.68, + 12.813 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.975, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.923, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 25.919 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29.873 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 46.225 + ] + } + }, + "wt_peptide": "RSAPKDSSS" + } + }, + "transcripts": [ + "ENST00000262198.9-ADNP2-R/I-939" + ], + "transcript_expr": [ + 10.673 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1131 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 10.673 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 10.673 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.959, + "gene_expr": 19.521, + "best_peptide_mt": "ISAPKDSSS", + "best_peptide_wt": "RSAPKDSSS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-422192-422193-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DAGQPKHLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 8069.426 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.926 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.952 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.767 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.82 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2645.181 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.05 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.766 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.531 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26501.301, + 12205.96, + 23444.561, + 3932.892, + 585.882, + 969.549, + 834.539, + 36378.781 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10607.83, + 3279.53, + 11417.23, + 2010.833, + 1246.838, + 909.013, + 102.702, + 33773.84 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.981 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.334 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 4.5, + 27.0, + 14.0, + 6.4, + 8.9, + 2.448, + 78.23, + 8.952 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 1.2, + 12.0, + 5.0, + 12.0, + 8.6, + 0.329, + 70.2, + 2.983 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.949, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + 0.965, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.531 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.013, + 0.14, + 0.111 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.073, + 0.028, + 0.509, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 2.335 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.73, + 0.802 + ] + } + }, + "wt_peptide": "HAGQPKHLL" + } + }, + "transcripts": [ + "ENST00000264554.11-SHC2-H/D-525" + ], + "transcript_expr": [ + 4.79 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 582 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.79 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 4.79 + ], + "DNA VAF": 0.11, + "RNA VAF": 0.07, + "gene_expr": 8.139, + "best_peptide_mt": "DAGQPKHLL", + "best_peptide_wt": "HAGQPKHLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-5928080-5928081-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "AADEEKQPQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 16974.881 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 33.418 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 32.836 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 22.815 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 52.331 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 23327.545 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 51.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 61.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 26.328 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 65.615 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 44840.48, + 39530.031, + 42280.102, + 2099.77, + 5646.899, + 6450.153, + 4684.978, + 27499.609 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46015.64, + 43409.27, + 43911.91, + 3000.805, + 9116.119, + 12988.829, + 4264.399, + 33666.26 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.884 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 84.0, + 41.0, + 80.0, + 5.2, + 25.0, + 27.0, + 8.239, + 53.34, + 32.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 93.0, + 61.0, + 90.0, + 8.5, + 32.0, + 37.0, + 7.712, + 69.87, + 62.174 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.982, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.976, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 52.331 + ] + }, + "WT": { + "HLA-C*06:02": [ + 65.615 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.021, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.022, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 34.0, + 11.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 10.656 + ] + } + }, + "wt_peptide": "AADEEKEPQ" + } + }, + "transcripts": [ + "ENST00000439268.6-RANBP3-E/Q-229" + ], + "transcript_expr": [ + 1.724 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 562 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.724 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.724 + ], + "DNA VAF": 0.987, + "RNA VAF": 1.0, + "gene_expr": 36.036, + "best_peptide_mt": "AADEEKQPQ", + "best_peptide_wt": "AADEEKEPQ", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-6044262-6044263-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GSSNPKGAQM": { + "ic50s_MT": [ + "X", + "X", + "X", + 24089.654 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 20.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.334 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 48.952 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18666.695 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 15.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.439 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 43.652 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25969.381, + 39645.691, + 22209.93, + 12249.092, + "NA", + "NA", + 1730.584, + 27449.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22140.12, + 39617.39, + 16493.98, + 10527.332, + "NA", + "NA", + 773.214, + 20839.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.864 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.639 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 42.0, + 25.0, + 16.0, + "NA", + "NA", + 4.165, + 53.23, + 27.873 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.8, + 42.0, + 17.0, + 13.0, + "NA", + "NA", + 2.314, + 38.8, + 21.759 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.964, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.962, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 48.952 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43.652 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.052, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.108, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.7, + 4.969 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 2.778 + ] + } + }, + "wt_peptide": "ASSNPKGAQM" + } + }, + "transcripts": [ + "ENST00000303657.10-RFX2-A/G-37" + ], + "transcript_expr": [ + 2.749 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 723 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.749 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.749 + ], + "DNA VAF": 0.989, + "RNA VAF": 1.0, + "gene_expr": 15.809, + "best_peptide_mt": "GSSNPKGAQM", + "best_peptide_wt": "ASSNPKGAQM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-6755017-6755018-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EAEEDEGEEN": { + "ic50s_MT": [ + "X", + "X", + "X", + 42235.07 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 75.176 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 86.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 55.116 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 53.783 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 42403.82 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 78.496 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 87.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 55.558 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 56.992 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 48257.711, + 47932.988, + 42740.039, + 19505.613, + "NA", + "NA", + 3948.547, + 41730.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 48808.57, + 48082.07, + 42971.89, + 22209.933, + "NA", + "NA", + 4347.807, + 41835.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.947 + ] + }, + "WT": { + "HLA-C*06:02": [ + -4.112 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 100.0, + 98.0, + 86.0, + 26.0, + "NA", + "NA", + 7.319, + 95.34, + 64.352 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 99.0, + 87.0, + 29.0, + "NA", + "NA", + 7.824, + 95.61, + 69.993 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.931, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.948, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 53.783 + ] + }, + "WT": { + "HLA-C*06:02": [ + 56.992 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.024, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.022, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 100.0, + 10.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 11.116 + ] + } + }, + "wt_peptide": "EAEEDEEEEN" + } + }, + "transcripts": [ + "ENST00000245908.11-SH2D3A-E/G-265" + ], + "transcript_expr": [ + 1.041 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 576 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.041 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.041 + ], + "DNA VAF": 0.985, + "RNA VAF": 1.0, + "gene_expr": 3.82, + "best_peptide_mt": "EAEEDEGEEN", + "best_peptide_wt": "EAEEDEEEEN", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-8955983-8955984-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "STMGHTTVF": { + "ic50s_MT": [ + "X", + "X", + "X", + 1002.415 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.84 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.206 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.201 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.561 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10709.648 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.3 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.996 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.488 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1211.85, + 2263.02, + 792.98, + 6062.767, + 462.179, + 715.435, + 89.126, + 11971.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15264.61, + 15884.49, + 10414.04, + 6682.848, + 580.51, + 954.048, + 11005.256, + 18497.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.874 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.759 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.28, + 0.71, + 0.97, + 21.0, + 5.3, + 7.3, + 0.255, + 22.94, + 1.206 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 6.2, + 9.9, + 24.0, + 6.3, + 8.8, + 16.501, + 34.31, + 6.325 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.99, + 0.063 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.986, + 0.019 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.561 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.488 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.184, + 0.021, + 0.913, + 0.675 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.011, + 0.049 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.3, + 0.101 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.8, + 22.192 + ] + } + }, + "wt_peptide": "STMGHTTVS" + } + }, + "transcripts": [ + "ENST00000397910.8-MUC16-S/F-6929" + ], + "transcript_expr": [ + 0.003 + ], + "mane_select": [ + false + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 14507 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.003 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.003 + ], + "DNA VAF": 0.471, + "RNA VAF": 0.0, + "gene_expr": 0.003, + "best_peptide_mt": "STMGHTTVF", + "best_peptide_wt": "STMGHTTVS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-8969814-8969831-ACGTGGAATTTCCTTGTG-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HRNHITNQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 212.282 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.134 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.57 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.089 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.016 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 98.57, + 218.23, + 403.25, + 645.631, + 237.58, + 206.334, + 43.422, + 158.19 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.04, + 0.1, + 0.57, + 0.8, + 3.2, + 2.9, + 0.032, + 1.26, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.171, + 0.927, + 0.235 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.805, + 0.898, + 0.871, + 0.353 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.167 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VYHSQNHEL": { + "ic50s_MT": [ + "X", + "X", + "X", + 705.025 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.517 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.67 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.175 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.679 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1531.5, + 914.76, + 495.29, + 1534.27, + 122.408, + 119.831, + 55.795, + 1627.38 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.409 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.33, + 0.67, + 3.3, + 1.9, + 1.8, + 0.081, + 5.61, + 0.364 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.094, + 0.991, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.679 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.381, + 0.088, + 0.825, + 0.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.11, + 0.24 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "SRHIPRKPRNV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2391.014 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.65 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.979 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 13.148 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6793.08, + 12521.52, + 412.08, + 1332.954, + "NA", + "NA", + 3449.075, + 500.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.572 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 4.6, + 0.45, + 0.5, + "NA", + "NA", + 6.699, + 2.7, + 4.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.187, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 13.148 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.006, + 0.032, + 0.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 7.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "PRKWQHQHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2474.58 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.371 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.342 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.4 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.091 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8162.3, + 2622.08, + 2327.08, + 1262.758, + 155.171, + 601.963, + 4489.736, + 37411.379 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.202 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 0.84, + 2.4, + 2.3, + 2.3, + 6.4, + 8.002, + 81.55, + 2.342 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.043, + 0.993, + 0.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.091 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.052, + 0.083, + 0.024, + 0.041 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.95, + 9.849 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "TIKMSSQAV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4853.856 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.172 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.903 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.644 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17336.119 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.812 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 27.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 27.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 24.024 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10603.81, + 15243.48, + 12183.0, + 3307.719, + 3067.68, + 3824.459, + 5883.253, + 905.91 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25392.29, + 34191.18, + 30560.95, + 6062.767, + 16361.006, + 12149.824, + 18311.233, + 1467.61 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.685 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.818 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.1, + 5.9, + 13.0, + 9.7, + 19.0, + 21.0, + 9.734, + 3.9, + 5.599 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 27.0, + 39.0, + 21.0, + 40.0, + 36.0, + 31.607, + 5.27, + 26.623 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.942, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.931, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.644 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.024 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.018, + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.043 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 12.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 37.359 + ] + } + }, + "wt_peptide": "TIKMSSQAA" + }, + "HIPRKPRNV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4895.781 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.759 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.966 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.007 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4801.69, + 17241.77, + 10470.53, + 4989.872, + 7617.457, + 3806.887, + 224.323, + 1581.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.417 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 6.9, + 9.9, + 17.0, + 29.0, + 21.0, + 0.818, + 5.51, + 0.372 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.16, + 0.994, + 0.023 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.104, + 0.102, + 0.29, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.53, + 1.403 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000397910.8-MUC16-AQGNST/X-3175-3180" + ], + "transcript_expr": [ + 0.003 + ], + "mane_select": [ + false + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 14507 + ], + "transcript_count": 1, + "peptide_count": 6, + "total_expr": 0.003 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 6 + ], + "set_expr": [ + 0.003 + ], + "DNA VAF": 0.75, + "RNA VAF": 0.0, + "gene_expr": 0.003, + "best_peptide_mt": "HRNHITNQV", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-12580947-12580948-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EAFKSSSF": { + "ic50s_MT": [ + "X", + "X", + "X", + 13407.749 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.483 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.768 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 30931.912 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 52.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 51.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 68.143 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 59.887 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24392.4, + 34422.051, + 14252.45, + 9146.011, + "NA", + "NA", + 12563.049, + 9530.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41195.0, + 42317.16, + 35176.57, + 10081.437, + "NA", + "NA", + 26687.254, + 10238.86 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.082 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.219 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 27.0, + 14.0, + 9.9, + "NA", + "NA", + 18.921, + 18.95, + 10.535 + ] + }, + "WT": { + "HLA-C*06:02": [ + 59.0, + 54.0, + 51.0, + 13.0, + "NA", + "NA", + 71.313, + 20.09, + 38.884 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.768 + ] + }, + "WT": { + "HLA-C*06:02": [ + 59.887 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.0, + 0.085, + 0.699 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.7, + 3.266 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37.0, + 99.287 + ] + } + }, + "wt_peptide": "EAFKSSSS" + } + }, + "transcripts": [ + "ENST00000311437.11-ZNF490-S/F-376" + ], + "transcript_expr": [ + 8.962 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 529 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 8.962 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 8.962 + ], + "DNA VAF": 0.351, + "RNA VAF": 0.257, + "gene_expr": 15.981, + "best_peptide_mt": "EAFKSSSF", + "best_peptide_wt": "EAFKSSSS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-13765994-13765995-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LEKDLTDNRSI": { + "ic50s_MT": [ + "X", + "X", + "X", + 24315.523 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 25.891 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 31.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 17.653 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.61 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 22895.83 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 32.123 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 33.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 19.79 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 32.247 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 34280.82, + 43018.859, + 20589.91, + 25564.297, + "NA", + "NA", + 9242.162, + 23066.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35031.85, + 43065.91, + 20701.6, + 23957.42, + "NA", + "NA", + 11194.724, + 21834.24 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.897 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.039 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 31.0, + 58.0, + 23.0, + 34.0, + "NA", + "NA", + 14.011, + 43.34, + 28.781 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.0, + 59.0, + 23.0, + 32.0, + "NA", + "NA", + 16.675, + 40.78, + 33.1 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.247 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.011, + 0.014, + 0.073 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.01, + 0.036 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 24.579 + ] + } + }, + "wt_peptide": "LEKDLRDNRSI" + } + }, + "transcripts": [ + "ENST00000040663.8-MRI1-R/T-138" + ], + "transcript_expr": [ + 16.191 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 369 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 16.191 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 16.191 + ], + "DNA VAF": 0.224, + "RNA VAF": 0.201, + "gene_expr": 24.532, + "best_peptide_mt": "LEKDLTDNRSI", + "best_peptide_wt": "LEKDLRDNRSI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-13931970-13931971-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "STPRLRALL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5933.687 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.257 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.636 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.614 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13326.803 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.904 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.416 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.407 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4540.66, + 25945.5, + 4018.93, + 6128.721, + 5738.653, + 7701.406, + 220.482, + 29411.73 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6035.41, + 33306.45, + 8901.93, + 10992.949, + 15660.658, + 20538.56, + 989.991, + 37115.49 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.202 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.657 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 15.0, + 3.9, + 22.0, + 26.0, + 29.0, + 0.812, + 58.12, + 2.341 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 25.0, + 8.4, + 38.0, + 40.0, + 44.0, + 2.772, + 80.61, + 5.336 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.984, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.985, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.614 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.407 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.008, + 0.298, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.004, + 0.09, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 1.373 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 3.133 + ] + } + }, + "wt_peptide": "STPRLRALF" + } + }, + "transcripts": [ + "ENST00000588872.3-PODNL1-F/L-523" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 3.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 574 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.142, + "RNA VAF": 0.0, + "gene_expr": 7.123, + "best_peptide_mt": "STPRLRALL", + "best_peptide_wt": "STPRLRALF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-14049194-14049195-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DVPPGTPAI": { + "ic50s_MT": [ + "X", + "X", + "X", + 18374.32 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 30.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.346 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.85 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14436.495 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.781 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.003 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.563 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15131.42, + 35821.82, + 21617.221, + 11730.271, + 13577.193, + 23151.014, + 171.058, + 22083.369 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11829.05, + 34697.64, + 21500.59, + 8297.38, + 8826.936, + 17043.94, + 94.13, + 33013.15 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.485 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.288 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 30.0, + 24.0, + 40.0, + 38.0, + 46.0, + 0.627, + 41.27, + 3.949 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.5, + 28.0, + 24.0, + 29.0, + 31.0, + 41.0, + 0.283, + 67.97, + 2.757 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.993, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.034, + 0.99, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.85 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.563 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.001, + 0.561, + 0.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + 0.003, + 0.605, + 0.146 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 0.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 0.606 + ] + } + }, + "wt_peptide": "DAPPGTPAI" + } + }, + "transcripts": [ + "ENST00000263379.4-IL27RA-A/V-428" + ], + "transcript_expr": [ + 6.809 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 636 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.809 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.809 + ], + "DNA VAF": 0.262, + "RNA VAF": 0.305, + "gene_expr": 13.617, + "best_peptide_mt": "DVPPGTPAI", + "best_peptide_wt": "DAPPGTPAI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-14049194-14049196-CC-TT": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "PTLWRLQDV": { + "ic50s_MT": [ + "X", + "X", + "X", + 15144.356 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 29.18 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.809 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 24958.072 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 45.552 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 44.88 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 52.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 37.471 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 30161.51, + 9750.27, + 19400.381, + 13356.592, + 862.601, + 3806.887, + 17465.721, + 16932.119 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39290.39, + 28042.07, + 35752.13, + 24481.498, + 4600.553, + 12094.001, + 25434.646, + 23778.14 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.163 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 3.5, + 21.0, + 44.0, + 8.3, + 21.0, + 28.956, + 31.44, + 9.655 + ] + }, + "WT": { + "HLA-C*06:02": [ + 49.0, + 17.0, + 52.0, + 64.0, + 23.0, + 36.0, + 62.437, + 44.88, + 37.079 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.059, + 0.955, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.974, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37.471 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.075 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 59.0, + 46.225 + ] + } + }, + "wt_peptide": "PTLWRLQDA" + } + }, + "transcripts": [ + "ENST00000263379.4-IL27RA-A/V-428" + ], + "transcript_expr": [ + 6.809 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 636 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.809 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.809 + ], + "DNA VAF": 0.268, + "RNA VAF": "NA", + "gene_expr": 13.617, + "best_peptide_mt": "PTLWRLQDV", + "best_peptide_wt": "PTLWRLQDA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-16093698-16093699-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TRAQFAERTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 630.944 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.804 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.63 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.804 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.647 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 498.055 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.41 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.077 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.41 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.342 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 741.49, + 7796.65, + 280.65, + 4196.68, + "NA", + "NA", + 520.398, + 231.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 467.72, + 7073.99, + 165.16, + 3033.45, + "NA", + "NA", + 301.242, + 528.39 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.236 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.17, + 2.8, + 0.28, + 3.3, + "NA", + "NA", + 1.697, + 1.63, + 0.622 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.1, + 2.5, + 0.21, + 2.0, + "NA", + "NA", + 1.077, + 2.8, + 0.222 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.084, + 0.812, + 0.057 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.144, + 0.77, + 0.087 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.647 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.342 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.077, + 0.099, + 0.461, + 0.451 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.153, + 0.265, + 0.687, + 0.568 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 0.908 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.36, + 0.46 + ] + } + }, + "wt_peptide": "TRAEFAERTV" + }, + "RAQFAERTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4788.496 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.152 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.384 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3913.891 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.35 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.726 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.942 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6977.9, + 7613.09, + 13648.77, + 3529.574, + 2551.585, + 6047.418, + 333.039, + 212.17 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15291.22, + 12736.03, + 18180.94, + 2289.621, + 2727.784, + 5099.998, + 1121.968, + 682.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.748 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.924 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 2.7, + 14.0, + 12.0, + 17.0, + 26.0, + 1.171, + 1.54, + 0.874 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.1, + 4.7, + 20.0, + 6.0, + 18.0, + 24.0, + 3.058, + 3.29, + 1.36 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.146, + 0.86, + 0.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.027, + 0.884, + 0.024 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.384 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.942 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.071, + 0.606, + 0.495 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.01, + 0.277, + 0.435 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 0.604 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.0, + 1.452 + ] + } + }, + "wt_peptide": "RAEFAERTV" + } + }, + "transcripts": [ + "ENST00000643579.2-TPM4-E/Q-204", + "ENST00000646974.2-TPM4-E/Q-240" + ], + "transcript_expr": [ + 134.169, + 184.766 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 248, + 284 + ], + "transcript_count": 2, + "peptide_count": 2, + "total_expr": 318.935 + }, + "Transcript Set 2": { + "peptides": { + "AQFAERTVA": { + "ic50s_MT": [ + "X", + "X", + "X", + 4995.307 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.909 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.674 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 22.82 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 31870.426 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 31.358 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 31.506 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 9.591 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.719 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18143.99, + 25496.619, + 24747.82, + 3685.685, + 3835.394, + 2025.676, + 6155.219, + 3646.56 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31562.04, + 32669.01, + 35946.07, + 9047.586, + 59677.415, + 32178.812, + 16909.748, + 16808.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.201 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.989 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.7, + 14.0, + 29.0, + 13.0, + 21.0, + 15.0, + 10.053, + 9.48, + 12.818 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25.0, + 24.0, + 53.0, + 32.0, + 61.0, + 51.0, + 27.539, + 31.21, + 31.506 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.946, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.976, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 22.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.719 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.003, + 0.255, + 0.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.155, + 0.971 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.8, + 1.549 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 2.183 + ] + } + }, + "wt_peptide": "AEFAERTVA" + } + }, + "transcripts": [ + "ENST00000586833.7-TPM4-E/Q-201", + "ENST00000344824.11-TPM4-E/Q-114", + "ENST00000642221.1-TPM4-E/Q-182" + ], + "transcript_expr": [ + 0.24, + 0.187, + 0.171 + ], + "mane_select": [ + false, + false, + false + ], + "canonical": [ + false, + false, + false + ], + "tsl": [ + 5.0, + 5.0, + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 245, + 158, + 226 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.598 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 3 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 318.935, + 0.598 + ], + "DNA VAF": 0.48, + "RNA VAF": 0.654, + "gene_expr": 370.472, + "best_peptide_mt": "TRAQFAERTV", + "best_peptide_wt": "TRAEFAERTV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-16572288-16572289-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ARQGARVAAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2792.363 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.294 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.788 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.306 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.945 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2041.078 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.64 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.58 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.403 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.656 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4872.18, + 23892.439, + 592.1, + 4526.876, + "NA", + "NA", + 147.651, + 1057.85 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9719.3, + 27381.57, + 1145.59, + 2936.567, + "NA", + "NA", + 318.271, + 466.71 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.294 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.91 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 13.0, + 0.63, + 3.8, + "NA", + "NA", + 0.534, + 4.3, + 2.788 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 16.0, + 1.3, + 1.9, + "NA", + "NA", + 1.129, + 2.58, + 8.03 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.944, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.934, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.656 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.002, + 0.504, + 0.154 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.003, + 0.382, + 0.224 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 0.813 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 1.106 + ] + } + }, + "wt_peptide": "AREGARVAAL" + } + }, + "transcripts": [ + "ENST00000595753.6-SLC35E1-E/Q-26" + ], + "transcript_expr": [ + 15.461 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 410 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 15.461 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 15.461 + ], + "DNA VAF": 0.698, + "RNA VAF": 0.816, + "gene_expr": 38.81, + "best_peptide_mt": "ARQGARVAAL", + "best_peptide_wt": "AREGARVAAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-17052841-17052842-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TAKNDLEL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6367.606 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.869 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.107 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.816 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 49.809 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9384.394 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.7 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.782 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 40.67 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25739.15, + 33561.129, + 6866.08, + 5869.133, + "NA", + "NA", + 3202.637, + 5740.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25427.47, + 37015.67, + 10992.95, + 7775.837, + "NA", + "NA", + 1911.016, + 7739.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.992 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.732 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 25.0, + 5.4, + 5.6, + "NA", + "NA", + 6.364, + 12.92, + 9.107 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 33.0, + 9.3, + 8.1, + "NA", + "NA", + 4.464, + 16.13, + 6.037 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 49.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40.67 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.038, + 0.079 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.004, + 0.072, + 0.128 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 6.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.8, + 3.765 + ] + } + }, + "wt_peptide": "TAKKDLEL" + } + }, + "transcripts": [ + "ENST00000253669.10-HAUS8-K/N-304" + ], + "transcript_expr": [ + 6.2 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 410 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.2 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.2 + ], + "DNA VAF": 0.548, + "RNA VAF": 0.602, + "gene_expr": 10.348, + "best_peptide_mt": "TAKNDLEL", + "best_peptide_wt": "TAKKDLEL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-19336157-19336158-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VKFEAARLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 212.075 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.396 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.448 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.221 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.105 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 484.278 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.951 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.202 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.784 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.49 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 328.27, + 71.12, + 392.49, + 388.269, + 73.928, + 48.705, + 128.55, + 295.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1017.39, + 315.69, + 973.97, + 625.01, + 229.514, + 155.085, + 343.547, + 706.0 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.312 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.304 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.07, + 0.04, + 0.56, + 0.4, + 1.2, + 0.9, + 0.448, + 1.92, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.24, + 0.12, + 1.3, + 0.7, + 3.1, + 2.3, + 1.202, + 3.35, + 0.271 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.058, + 0.975, + 0.149 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.062, + 0.97, + 0.069 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.105 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.49 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.529, + 0.302, + 0.729, + 0.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.209, + 0.042, + 0.313, + 0.159 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + 0.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.25, + 1.318 + ] + } + }, + "wt_peptide": "VKFEAASLL" + } + }, + "transcripts": [ + "ENST00000262815.13-MAU2-S/R-111" + ], + "transcript_expr": [ + 13.642 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 613 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 13.642 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 13.642 + ], + "DNA VAF": 0.345, + "RNA VAF": 0.437, + "gene_expr": 34.844, + "best_peptide_mt": "VKFEAARLL", + "best_peptide_wt": "VKFEAASLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-35841840-35841841-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YHQCGVHSSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4576.203 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.359 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.552 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.97 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.327 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5194.68 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.797 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.39 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.024 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.794 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5813.08, + 38591.43, + 1384.4, + 15710.146, + "NA", + "NA", + 3339.325, + 719.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6915.14, + 34932.7, + 631.81, + 16404.995, + "NA", + "NA", + 515.696, + 3474.22 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.829 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.543 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 38.0, + 1.5, + 20.0, + "NA", + "NA", + 6.552, + 3.39, + 7.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 28.0, + 0.67, + 21.0, + "NA", + "NA", + 1.68, + 9.18, + 4.39 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.986, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.971, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.794 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.005, + 0.337, + 0.814 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.279, + 0.819, + 0.919 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 1.24 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 0.248 + ] + } + }, + "wt_peptide": "YHQGGVHSSL" + } + }, + "transcripts": [ + "ENST00000378910.10-NPHS1-G/C-897" + ], + "transcript_expr": [ + 0.129 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1241 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.129 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.129 + ], + "DNA VAF": 0.081, + "RNA VAF": 1.0, + "gene_expr": 0.377, + "best_peptide_mt": "YHQCGVHSSL", + "best_peptide_wt": "YHQGGVHSSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-38802098-38802099-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HINPCMGNGTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 16999.26 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.094 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 18.094 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.753 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16715.266 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.75 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.456 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "5", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 30533.85, + 44476.16, + 7818.02, + 10992.949, + "NA", + "NA", + 5232.851, + 23005.57 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25391.45, + 41007.75, + 5774.65, + 10301.972, + "NA", + "NA", + 6680.331, + 23128.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.851 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.806 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 68.0, + 6.9, + 14.0, + "NA", + "NA", + 8.92, + 43.2, + 7.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 47.0, + 5.0, + 13.0, + "NA", + "NA", + 10.73, + 43.47, + 6.819 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.093, + "NA", + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.753 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.456 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.02, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.043, + 0.018, + 0.065 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 24.0, + 12.187 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 13.501 + ] + } + }, + "wt_peptide": "HINPRMGNGTV" + } + }, + "transcripts": [ + "ENST00000307751.9-LGALS4-R/C-240" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 323 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.232, + "best_peptide_mt": "HINPCMGNGTV", + "best_peptide_wt": "HINPRMGNGTV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-50625545-50625546-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FSDPYVKAF": { + "ic50s_MT": [ + "X", + "X", + "X", + 1417.643 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.96 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.202 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.353 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4654.364 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.381 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.62 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.689 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4501.48, + 1902.57, + 2216.49, + 932.715, + 143.486, + 178.883, + 93.256, + 2234.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23491.28, + 12612.62, + 19824.77, + 1028.11, + 180.223, + 238.545, + 4539.687, + 4769.04 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.667 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.553 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 0.58, + 2.3, + 1.6, + 2.1, + 2.5, + 0.277, + 6.85, + 0.719 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 4.7, + 22.0, + 1.8, + 2.6, + 3.2, + 8.063, + 11.37, + 4.471 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.991, + 0.085 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + 0.994, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.353 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.689 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.176, + 0.025, + 0.925, + 0.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.003, + 0.027, + 0.082 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.32, + 0.085 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.4, + 8.839 + ] + } + }, + "wt_peptide": "FSDPYVKAS" + }, + "FSDPYVKAFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1491.696 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.416 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.894 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.049 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.938 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1860.656 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.773 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 11.722 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6388.79, + 17231.52, + 1576.34, + 1407.051, + "NA", + "NA", + 597.985, + 592.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9266.13, + 24906.31, + 1936.11, + 1785.201, + "NA", + "NA", + 255.47, + 1159.68 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.496 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.9, + 1.6, + 0.6, + "NA", + "NA", + 1.894, + 3.01, + 8.485 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 14.0, + 1.9, + 0.8, + "NA", + "NA", + 0.917, + 4.55, + 18.497 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.986, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.991, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.938 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.722 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.044, + 0.665, + 0.727 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.015, + 0.758, + 0.622 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.6, + 0.499 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 0.346 + ] + } + }, + "wt_peptide": "FSDPYVKASL" + } + }, + "transcripts": [ + "ENST00000338916.8-SYT3-S/F-474" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 590 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "FSDPYVKAFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1491.696 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.416 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.894 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.049 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.938 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1860.656 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.773 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 11.722 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6388.79, + 17231.52, + 1576.34, + 1407.051, + "NA", + "NA", + 597.985, + 592.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9266.13, + 24906.31, + 1936.11, + 1785.201, + "NA", + "NA", + 255.47, + 1159.68 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.496 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.9, + 1.6, + 0.6, + "NA", + "NA", + 1.894, + 3.01, + 8.485 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 14.0, + 1.9, + 0.8, + "NA", + "NA", + 0.917, + 4.55, + 18.497 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.986, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.991, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.938 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.722 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.044, + 0.665, + 0.727 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.015, + 0.758, + 0.622 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.6, + 0.499 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 0.346 + ] + } + }, + "wt_peptide": "FSDPYVKASL" + }, + "FLISEGRRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1666.225 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.672 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.727 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.482 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5024.2 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.015 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.56 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.35 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.231 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2106.1, + 1497.92, + 2216.49, + 4196.68, + 1781.599, + 1550.851, + 256.789, + 481.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6283.01, + 10277.81, + 7054.34, + 6829.038, + 3765.39, + 3361.786, + 494.097, + 1607.84 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.485 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.754 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.46, + 0.48, + 2.3, + 15.0, + 14.0, + 13.0, + 0.927, + 2.63, + 0.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 3.8, + 6.5, + 24.0, + 21.0, + 20.0, + 1.619, + 5.56, + 0.885 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.962, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.977, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.231 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.136, + 0.004, + 0.405, + 0.193 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.059, + 0.001, + 0.2, + 0.089 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.41, + 1.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.86, + 1.839 + ] + } + }, + "wt_peptide": "SLISEGRRL" + } + }, + "transcripts": [ + "ENST00000600079.6-SYT3-S/F-474" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 590 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + }, + "Transcript Set 3": { + "peptides": { + "FSDPYVKAFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1491.696 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.416 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.894 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.049 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.938 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1860.656 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.773 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 11.722 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6388.79, + 17231.52, + 1576.34, + 1407.051, + "NA", + "NA", + 597.985, + 592.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9266.13, + 24906.31, + 1936.11, + 1785.201, + "NA", + "NA", + 255.47, + 1159.68 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.496 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 6.9, + 1.6, + 0.6, + "NA", + "NA", + 1.894, + 3.01, + 8.485 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 14.0, + 1.9, + 0.8, + "NA", + "NA", + 0.917, + 4.55, + 18.497 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.986, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.991, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.938 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.722 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.044, + 0.665, + 0.727 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.015, + 0.758, + 0.622 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.6, + 0.499 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 0.346 + ] + } + }, + "wt_peptide": "FSDPYVKASL" + } + }, + "transcripts": [ + "ENST00000593901.5-SYT3-S/F-474" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 590 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 2, + 2, + 1 + ], + "set_expr": [ + 0.0, + 0.0, + 0.0 + ], + "DNA VAF": 0.54, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "FSDPYVKAF", + "best_peptide_wt": "FSDPYVKAS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr19-57397065-57397066-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VVFEYVAIY": { + "ic50s_MT": [ + "X", + "X", + "X", + 740.015 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.137 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.017 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.052 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1571.649 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.616 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.566 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.317 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5229.66, + 539.22, + 1709.59, + 810.331, + 44.855, + 77.906, + 669.699, + 14275.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8625.46, + 2190.18, + 4600.95, + 953.119, + 99.726, + 157.968, + 901.264, + 10483.91 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.262 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.45 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 0.2, + 1.9, + 1.2, + 0.8, + 1.3, + 2.059, + 26.8, + 0.241 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 0.69, + 4.4, + 1.6, + 1.5, + 2.3, + 2.591, + 20.5, + 0.405 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.098, + 0.991, + 0.183 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.062, + 0.987, + 0.09 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.052 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.317 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.052, + 0.053, + 0.394, + 0.442 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.028, + 0.012, + 0.236, + 0.314 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.96, + 1.073 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.633 + ] + } + }, + "wt_peptide": "VVFEDVAIY" + }, + "VVFEYVAIYF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4494.961 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.396 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.796 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.915 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3295.323 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.7 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.639 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.868 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13962.75, + 12730.94, + 1804.62, + 3529.574, + "NA", + "NA", + 5460.348, + 2011.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14908.45, + 24094.42, + 2904.96, + 3685.685, + "NA", + "NA", + 2099.988, + 447.27 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.226 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.4, + 4.7, + 1.8, + 2.6, + "NA", + "NA", + 9.209, + 6.4, + 2.929 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.9, + 13.0, + 2.6, + 2.8, + "NA", + "NA", + 4.78, + 2.51, + 2.458 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.061, + 0.989, + 0.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.036, + 0.986, + 0.025 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.915 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.868 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.008, + 0.06, + 0.362 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.007, + 0.21, + 0.503 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 4.392 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.5, + 1.779 + ] + } + }, + "wt_peptide": "VVFEDVAIYF" + } + }, + "transcripts": [ + "ENST00000336128.12-ZNF548-D/Y-24", + "ENST00000366197.9-ZNF548-D/Y-12", + "ENST00000597400.5-ZNF548-D/Y-24" + ], + "transcript_expr": [ + 5.419, + 0.286, + 0.614 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 2.0, + 1.0, + 3.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 545, + 533, + 63 + ], + "transcript_count": 3, + "peptide_count": 2, + "total_expr": 6.319 + }, + "Transcript Set 2": { + "peptides": { + "VVFEYVAIYF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4494.961 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.396 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.796 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.915 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3295.323 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.7 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.639 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.868 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13962.75, + 12730.94, + 1804.62, + 3529.574, + "NA", + "NA", + 5460.348, + 2011.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14908.45, + 24094.42, + 2904.96, + 3685.685, + "NA", + "NA", + 2099.988, + 447.27 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.226 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.4, + 4.7, + 1.8, + 2.6, + "NA", + "NA", + 9.209, + 6.4, + 2.929 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.9, + 13.0, + 2.6, + 2.8, + "NA", + "NA", + 4.78, + 2.51, + 2.458 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.061, + 0.989, + 0.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.036, + 0.986, + 0.025 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.915 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.868 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.008, + 0.06, + 0.362 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.007, + 0.21, + 0.503 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.2, + 4.392 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.5, + 1.779 + ] + } + }, + "wt_peptide": "VVFEDVAIYF" + } + }, + "transcripts": [ + "ENST00000598895.5-ZNF548-D/Y-24" + ], + "transcript_expr": [ + 0.672 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 4.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 87 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.672 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 3, + 1 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 6.319, + 0.672 + ], + "DNA VAF": 0.468, + "RNA VAF": 0.378, + "gene_expr": 13.433, + "best_peptide_mt": "VVFEYVAIY", + "best_peptide_wt": "VVFEDVAIY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-669669-669670-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NAMIIVVIW": { + "ic50s_MT": [ + "X", + "X", + "X", + 9816.856 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.695 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.29 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.179 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.826 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14300.477 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.242 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.103 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.703 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 22729.939, + 25291.641, + 31912.641, + 5681.684, + 10158.042, + 5464.746, + 9475.67, + 6032.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23056.16, + 17098.54, + 31398.89, + 4576.122, + 9074.235, + 3408.553, + 11502.415, + 22300.08 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.342 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.299 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 14.0, + 42.0, + 20.0, + 33.0, + 25.0, + 14.29, + 13.39, + 3.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 6.9, + 41.0, + 16.0, + 31.0, + 20.0, + 17.242, + 41.73, + 2.812 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.18, + 0.968, + 0.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.078, + 0.986, + 0.054 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.826 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.703 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.063, + 0.089, + 0.635 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.041, + 0.091, + 0.695 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 3.159 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 3.107 + ] + } + }, + "wt_peptide": "NAMIIVVMW" + } + }, + "transcripts": [ + "ENST00000281017.8-TMEM18-M/I-111" + ], + "transcript_expr": [ + 3.288 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 140 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.288 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.288 + ], + "DNA VAF": 0.262, + "RNA VAF": 0.306, + "gene_expr": 55.263, + "best_peptide_mt": "NAMIIVVIW", + "best_peptide_wt": "NAMIIVVMW", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-26458127-26458128-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TRYKWLIIKTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2133.93 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.657 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.85 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.379 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.914 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3145.375 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.404 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.689 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.707 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2859.81, + 2693.86, + 45.33, + 1276.495, + "NA", + "NA", + 7769.58, + 1574.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5660.88, + 2912.71, + 80.43, + 1183.386, + "NA", + "NA", + 16420.349, + 3378.04 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.487 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.408 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.65, + 0.85, + 0.03, + 0.4, + "NA", + "NA", + 12.097, + 5.5, + 3.959 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 0.9, + 0.08, + 0.4, + "NA", + "NA", + 26.658, + 9.0, + 3.449 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.091, + "NA", + 0.024 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.126, + "NA", + 0.027 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.914 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.707 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.035, + 0.011, + 0.083, + 0.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.008, + 0.016, + 0.286 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 3.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 14.277 + ] + } + }, + "wt_peptide": "TRYKWLIIKIV" + } + }, + "transcripts": [ + "ENST00000339598.8-OTOF-I/T-1202", + "ENST00000403946.7-OTOF-I/T-1969" + ], + "transcript_expr": [ + 0.231, + 0.0 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1230, + 1997 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.231 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.231 + ], + "DNA VAF": 0.995, + "RNA VAF": 0.0, + "gene_expr": 0.281, + "best_peptide_mt": "TRYKWLIIKTV", + "best_peptide_wt": "TRYKWLIIKIV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-31366060-31366061-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NRIVVGVKRM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3050.971 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.21 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.42 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.838 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.524 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2349.515 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.493 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.428 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.329 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.287 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5060.28, + 27128.25, + 2169.05, + 3932.892, + "NA", + "NA", + 603.843, + 421.31 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4311.23, + 14445.89, + 932.72, + 3766.311, + "NA", + "NA", + 830.23, + 135.9 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.43 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.556 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 16.0, + 2.0, + 3.1, + "NA", + "NA", + 1.913, + 2.42, + 3.59 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 5.5, + 0.99, + 2.9, + "NA", + "NA", + 2.428, + 1.13, + 4.492 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.989, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.959, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.287 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.003, + 0.179, + 0.106 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.001, + 0.122, + 0.066 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 1.975 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 2.557 + ] + } + }, + "wt_peptide": "NRIVVRVKRM" + } + }, + "transcripts": [ + "ENST00000379416.4-XDH-R/G-791" + ], + "transcript_expr": [ + 6.987 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1333 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.987 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.987 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 9.677, + "best_peptide_mt": "NRIVVGVKRM", + "best_peptide_wt": "NRIVVRVKRM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-47806319-47806320-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HYHSLVENY": { + "ic50s_MT": [ + "X", + "X", + "X", + 3123.5 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.43 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.199 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.634 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2151.916 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.45 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.57 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.704 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.841 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4184.26, + 10626.9, + 7692.16, + 2842.778, + 2997.851, + 2155.609, + 72.487, + 3249.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7669.22, + 8207.11, + 9706.8, + 2693.073, + 1278.822, + 1391.778, + 124.658, + 1610.76 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.823 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.96, + 3.9, + 7.2, + 7.9, + 19.0, + 16.0, + 0.166, + 8.78, + 0.622 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 2.9, + 9.2, + 7.3, + 12.0, + 12.0, + 0.431, + 5.57, + 1.049 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + 0.995, + 0.058 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.043, + 0.993, + 0.047 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.634 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.841 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.198, + 0.01, + 0.895, + 0.561 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.059, + 0.004, + 0.631, + 0.254 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.27, + 0.129 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.85, + 0.558 + ] + } + }, + "wt_peptide": "HYHSLVEDY" + } + }, + "transcripts": [ + "ENST00000234420.11-MSH6-D/N-1255", + "ENST00000614496.4-MSH6-D/N-953", + "ENST00000540021.6-MSH6-D/N-1125", + "ENST00000538136.1-MSH6-D/N-953" + ], + "transcript_expr": [ + 31.46, + 1.278, + 0.0, + 0.481 + ], + "mane_select": [ + true, + false, + false, + false + ], + "canonical": [ + true, + false, + false, + false + ], + "tsl": [ + 1.0, + 1.0, + 2.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 1360, + 1058, + 1230, + 1058 + ], + "transcript_count": 4, + "peptide_count": 1, + "total_expr": 33.219 + }, + "Transcript Set 2": { + "peptides": { + "LVENYSQNV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2732.917 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.953 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.508 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2178.02 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.116 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.024 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 14341.7, + 3320.13, + 5411.67, + 2145.704, + 548.037, + 370.314, + 7025.298, + 759.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12839.53, + 3224.36, + 3911.67, + 1637.176, + 492.958, + 274.517, + 2718.863, + 709.77 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.209 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.989 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.6, + 1.2, + 5.1, + 5.4, + 6.0, + 4.4, + 11.094, + 3.5, + 2.379 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 1.1, + 3.8, + 3.6, + 5.7, + 3.5, + 5.703, + 3.36, + 1.562 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.985, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.98, + 0.041 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.024 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.014, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.001, + 0.037, + 0.029 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.6, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 6.631 + ] + } + }, + "wt_peptide": "LVEDYSQNV" + } + }, + "transcripts": [ + "ENST00000673637.1-MSH6-D/N-1156" + ], + "transcript_expr": [ + 14.14 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1261 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 14.14 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 4, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 33.219, + 14.14 + ], + "DNA VAF": 0.318, + "RNA VAF": 0.338, + "gene_expr": 48.832, + "best_peptide_mt": "HYHSLVENY", + "best_peptide_wt": "HYHSLVEDY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-53901384-53901385-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DRQYETIGLDF": { + "ic50s_MT": [ + "X", + "X", + "X", + 15332.364 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.91 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 15.579 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.346 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6384.983 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.285 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.63 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.508 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26358.619, + 32442.51, + 15290.89, + 15373.837, + "NA", + "NA", + 10557.85, + 2353.05 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16679.01, + 29251.63, + 4909.54, + 7860.427, + "NA", + "NA", + 1391.253, + 1048.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.597 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.04 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 23.0, + 16.0, + 20.0, + "NA", + "NA", + 15.821, + 7.09, + 4.815 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.8, + 19.0, + 4.3, + 8.3, + "NA", + "NA", + 3.567, + 4.27, + 1.718 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.067, + "NA", + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.061, + "NA", + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.346 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.508 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.007, + 0.015, + 0.139 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.015, + 0.093, + 0.123 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 16.158 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.2, + 3.06 + ] + } + }, + "wt_peptide": "HRQYETIGLDF" + } + }, + "transcripts": [ + "ENST00000404125.6-PSME4-H/D-1084" + ], + "transcript_expr": [ + 27.665 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1843 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 27.665 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 27.665 + ], + "DNA VAF": 0.35, + "RNA VAF": 0.276, + "gene_expr": 57.847, + "best_peptide_mt": "DRQYETIGLDF", + "best_peptide_wt": "HRQYETIGLDF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-61348284-61348285-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ALKEEHEDD": { + "ic50s_MT": [ + "X", + "X", + "X", + 16504.939 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 39.68 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 42.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 61.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 35.72 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19988.133 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 48.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 47.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 65.822 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 49.549 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 46869.34, + 41336.98, + 43911.91, + 9550.532, + 11035.957, + 17888.338, + 15121.542, + 12811.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 47963.61, + 41271.71, + 44872.5, + 11479.159, + 15552.851, + 24242.087, + 12483.579, + 15734.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.654 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.605 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 97.0, + 49.0, + 90.0, + 33.0, + 35.0, + 42.0, + 23.642, + 24.33, + 54.066 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 49.0, + 96.0, + 39.0, + 40.0, + 47.0, + 18.699, + 29.31, + 52.29 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.045, + 0.976, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.978, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 35.72 + ] + }, + "WT": { + "HLA-C*06:02": [ + 49.549 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.007, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.008, + 0.004 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 86.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 100.0, + 31.643 + ] + } + }, + "wt_peptide": "ALKEEDEDD" + } + }, + "transcripts": [ + "ENST00000398571.7-USP34-D/H-624" + ], + "transcript_expr": [ + 33.212 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3546 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 33.212 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 33.212 + ], + "DNA VAF": 0.284, + "RNA VAF": 0.355, + "gene_expr": 47.363, + "best_peptide_mt": "ALKEEHEDD", + "best_peptide_wt": "ALKEEDEDD", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-63942505-63942506-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HIFSKFTIF": { + "ic50s_MT": [ + "X", + "X", + "X", + 7387.553 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.124 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 10.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.097 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.723 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9390.906 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.294 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.92 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.395 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.465 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6385.68, + 9430.7, + 10584.44, + 5382.477, + 15445.785, + 7121.476, + 432.348, + 7653.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16709.17, + 24733.09, + 21617.22, + 10527.332, + 7257.884, + 7595.738, + 3919.222, + 8254.48 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.953 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 3.4, + 10.0, + 19.0, + 40.0, + 28.0, + 1.454, + 16.0, + 2.847 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.8, + 14.0, + 24.0, + 36.0, + 29.0, + 29.0, + 7.267, + 16.92, + 8.587 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.97, + 0.027 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.045, + 0.979, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.723 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.465 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.051, + 0.008, + 0.342, + 0.26 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.003, + 0.127, + 0.503 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.97, + 1.224 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 2.489 + ] + } + }, + "wt_peptide": "DIFSKFTIF" + } + }, + "transcripts": [ + "ENST00000272322.9-VPS54-D/H-453" + ], + "transcript_expr": [ + 3.862 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 977 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.862 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.862 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 12.384, + "best_peptide_mt": "HIFSKFTIF", + "best_peptide_wt": "DIFSKFTIF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-71611503-71611504-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRNMKSYQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 158.255 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.502 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.331 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.324 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 174.595 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.423 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.456 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.125 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.974 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "HLA-C*06:02", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 207.55, + 169.01, + 466.68, + 638.683, + 23.868, + 25.152, + 126.12, + 147.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 201.08, + 148.11, + 294.65, + 792.984, + 37.137, + 37.981, + 81.005, + 979.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.529 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.491 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.08, + 0.65, + 0.8, + 0.4, + 0.5, + 0.437, + 1.19, + 0.504 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.07, + 0.39, + 1.2, + 0.7, + 0.7, + 0.212, + 4.11, + 0.456 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.928, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.914, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.974 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.427, + 0.116, + 0.618, + 0.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.598, + 0.101, + 0.838, + 0.448 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 0.582 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + 0.22 + ] + } + }, + "wt_peptide": "LRNMKSYQL" + } + }, + "transcripts": [ + "ENST00000429174.6-DYSF-L/V-1349", + "ENST00000410041.1-DYSF-L/V-1367", + "ENST00000258104.8-DYSF-L/V-1349" + ], + "transcript_expr": [ + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + false, + false, + false + ], + "canonical": [ + false, + false, + false + ], + "tsl": [ + 1.0, + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 2101, + 2098, + 2080 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "MKSYQVANI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4895.797 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.819 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.303 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.974 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.633 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6188.429 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.333 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.974 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.75 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.693 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3094.38, + 8431.14, + 9972.95, + 5044.154, + 14119.197, + 2396.459, + 4747.439, + 2987.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4629.81, + 13045.09, + 15541.08, + 6262.789, + 27152.511, + 4291.113, + 6114.068, + 2080.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.943 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.218 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 3.0, + 9.4, + 17.0, + 38.0, + 17.0, + 8.303, + 8.29, + 1.419 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 4.9, + 16.0, + 22.0, + 48.0, + 22.0, + 9.974, + 6.54, + 2.42 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.974, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.974, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.693 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.033, + 0.149 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.018, + 0.037 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.0, + 13.501 + ] + } + }, + "wt_peptide": "MKSYQLANI" + }, + "LRNMKSYQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 158.255 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.502 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.331 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.324 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 174.595 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.423 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.456 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.125 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.974 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "HLA-C*06:02", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 207.55, + 169.01, + 466.68, + 638.683, + 23.868, + 25.152, + 126.12, + 147.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 201.08, + 148.11, + 294.65, + 792.984, + 37.137, + 37.981, + 81.005, + 979.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.529 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.491 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.08, + 0.65, + 0.8, + 0.4, + 0.5, + 0.437, + 1.19, + 0.504 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.07, + 0.39, + 1.2, + 0.7, + 0.7, + 0.212, + 4.11, + 0.456 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.928, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.914, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.974 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.427, + 0.116, + 0.618, + 0.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.598, + 0.101, + 0.838, + 0.448 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 0.582 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + 0.22 + ] + } + }, + "wt_peptide": "LRNMKSYQL" + } + }, + "transcripts": [ + "ENST00000410020.8-DYSF-L/V-1367", + "ENST00000409762.5-DYSF-L/V-1366" + ], + "transcript_expr": [ + 0.0, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 2119, + 2097 + ], + "transcript_count": 2, + "peptide_count": 2, + "total_expr": 0.0 + }, + "Transcript Set 3": { + "peptides": { + "VANISSPSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5227.402 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.371 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.969 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.735 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7429.249 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.162 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.437 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.719 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7549.84, + 19074.02, + 15373.84, + 2904.965, + 2232.595, + 1414.393, + 126.931, + 19375.721 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8239.23, + 19557.6, + 17695.75, + 3000.805, + 6619.269, + 2441.012, + 179.193, + 19609.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.588 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.721 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 8.0, + 16.0, + 8.1, + 16.0, + 13.0, + 0.443, + 35.98, + 4.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.2, + 8.4, + 19.0, + 8.5, + 27.0, + 17.0, + 0.66, + 36.42, + 5.925 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.04, + 0.971, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.975, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.735 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.719 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.041, + 0.001, + 0.54, + 0.153 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.001, + 0.476, + 0.175 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 0.738 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 0.875 + ] + } + }, + "wt_peptide": "LANISSPSL" + }, + "LRNMKSYQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 158.255 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.502 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.331 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.324 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 174.595 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.423 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.456 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.125 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.974 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "HLA-C*06:02", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 207.55, + 169.01, + 466.68, + 638.683, + 23.868, + 25.152, + 126.12, + 147.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 201.08, + 148.11, + 294.65, + 792.984, + 37.137, + 37.981, + 81.005, + 979.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.529 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.491 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.08, + 0.65, + 0.8, + 0.4, + 0.5, + 0.437, + 1.19, + 0.504 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.07, + 0.39, + 1.2, + 0.7, + 0.7, + 0.212, + 4.11, + 0.456 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.076, + 0.928, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.914, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.974 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.427, + 0.116, + 0.618, + 0.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.598, + 0.101, + 0.838, + 0.448 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 0.582 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.03, + 0.22 + ] + } + }, + "wt_peptide": "LRNMKSYQL" + } + }, + "transcripts": [ + "ENST00000413539.6-DYSF-L/V-1380" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2111 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + }, + "Transcript Set 4": { + "peptides": { + "MKSYQVANI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4895.797 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.819 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.303 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.974 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.633 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6188.429 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.333 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.974 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.75 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.693 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3094.38, + 8431.14, + 9972.95, + 5044.154, + 14119.197, + 2396.459, + 4747.439, + 2987.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4629.81, + 13045.09, + 15541.08, + 6262.789, + 27152.511, + 4291.113, + 6114.068, + 2080.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.943 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.218 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.7, + 3.0, + 9.4, + 17.0, + 38.0, + 17.0, + 8.303, + 8.29, + 1.419 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 4.9, + 16.0, + 22.0, + 48.0, + 22.0, + 9.974, + 6.54, + 2.42 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.974, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.974, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.693 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.033, + 0.149 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.018, + 0.037 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.0, + 13.501 + ] + } + }, + "wt_peptide": "MKSYQLANI" + } + }, + "transcripts": [ + "ENST00000409582.7-DYSF-L/V-1366", + "ENST00000409651.5-DYSF-L/V-1381", + "ENST00000409744.5-DYSF-L/V-1336" + ], + "transcript_expr": [ + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + false, + false, + false + ], + "canonical": [ + false, + false, + false + ], + "tsl": [ + 1.0, + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 2118, + 2112, + 2088 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3", + "Transcript Set 4" + ], + "transcript_counts": [ + 3, + 2, + 1, + 3 + ], + "peptide_counts": [ + 1, + 2, + 2, + 1 + ], + "set_expr": [ + 0.0, + 0.0, + 0.0, + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 0.119, + "best_peptide_mt": "VANISSPSL", + "best_peptide_wt": "LANISSPSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-94874875-94874876-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NLRVLVDSI": { + "ic50s_MT": [ + "X", + "X", + "X", + 14663.015 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.03 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.696 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.276 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16041.251 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.698 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.24 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 16.903 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.271 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19120.92, + 31129.619, + 23192.26, + 22209.934, + 2156.801, + 6332.424, + 3624.59, + 10205.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24649.48, + 29665.34, + 25017.04, + 21269.211, + 2156.801, + 5788.553, + 10813.292, + 8453.53 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.511 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.634 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.4, + 21.0, + 27.0, + 61.0, + 16.0, + 27.0, + 6.901, + 20.03, + 4.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 19.0, + 30.0, + 60.0, + 16.0, + 26.0, + 16.156, + 17.24, + 5.122 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.996, + 0.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.996, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.276 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.271 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.06, + 0.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.019, + 0.21 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 4.392 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 12.805 + ] + } + }, + "wt_peptide": "NLRVLVDCI" + } + }, + "transcripts": [ + "ENST00000295201.5-TEKT4-C/S-272" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 435 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.446, + "RNA VAF": 0.0, + "gene_expr": 0.614, + "best_peptide_mt": "NLRVLVDSI", + "best_peptide_wt": "NLRVLVDCI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-102015965-102015966-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FISYPQILI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2755.746 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.535 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.16 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.796 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.939 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12392.797 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.646 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 32.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.494 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5560.05, + 5352.8, + 6755.55, + 3807.283, + 465.382, + 569.6, + 1704.21, + 1416.43 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26627.49, + 19955.62, + 25564.3, + 4830.504, + 1308.609, + 940.957, + 19955.089, + 2134.83 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.267 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.244 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.9, + 6.2, + 13.0, + 5.4, + 6.3, + 4.13, + 5.16, + 2.656 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 8.6, + 30.0, + 17.0, + 12.0, + 8.8, + 36.861, + 6.65, + 13.646 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.209, + 0.993, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.164, + 0.995, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.494 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.009, + 0.097, + 0.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.006, + 0.03 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 2.992 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 46.225 + ] + } + }, + "wt_peptide": "FISYPQILT" + }, + "ISYPQILI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3204.348 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.05 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.467 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 10.631 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17824.913 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.78 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 43.554 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8771.33, + 18730.84, + 1517.76, + 2812.186, + "NA", + "NA", + 1884.982, + 3596.51 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26673.33, + 37087.83, + 13284.53, + 3567.971, + "NA", + "NA", + 22365.296, + 2601.23 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.799 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 7.8, + 1.5, + 1.8, + "NA", + "NA", + 4.431, + 9.39, + 0.868 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 33.0, + 13.0, + 2.7, + "NA", + "NA", + 45.966, + 7.56, + 6.741 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.068, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.107, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 10.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43.554 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.024, + 0.308, + 0.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.004, + 0.006, + 0.085 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.334 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.2, + 37.359 + ] + } + }, + "wt_peptide": "ISYPQILT" + }, + "FISYPQILIL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4813.53 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.709 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.424 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.618 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2222.862 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.315 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.13 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.505 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.82 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2742.44, + 12889.92, + 4382.3, + 9865.623, + "NA", + "NA", + 5244.759, + 173.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1610.59, + 12320.74, + 2737.14, + 10641.854, + "NA", + "NA", + 1708.584, + 68.09 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.647 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.725 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.62, + 4.8, + 3.8, + 13.0, + "NA", + "NA", + 8.92, + 1.34, + 5.238 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.35, + 4.6, + 2.5, + 13.0, + "NA", + "NA", + 4.13, + 0.67, + 5.97 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.294, + 0.99, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.172, + 0.996, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.82 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.014, + 0.033, + 0.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.087, + 0.012, + 0.135, + 0.296 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.62, + 2.39 + ] + } + }, + "wt_peptide": "FISYPQILTL" + } + }, + "transcripts": [ + "ENST00000332549.8-IL1R2-T/I-143", + "ENST00000393414.6-IL1R2-T/I-143" + ], + "transcript_expr": [ + 0.169, + 0.021 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 398, + 398 + ], + "transcript_count": 2, + "peptide_count": 3, + "total_expr": 0.19 + }, + "Transcript Set 2": { + "peptides": { + "FISYPQILI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2755.746 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.535 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.16 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.796 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.939 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12392.797 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.646 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 32.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.494 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5560.05, + 5352.8, + 6755.55, + 3807.283, + 465.382, + 569.6, + 1704.21, + 1416.43 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26627.49, + 19955.62, + 25564.3, + 4830.504, + 1308.609, + 940.957, + 19955.089, + 2134.83 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.267 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.244 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.9, + 6.2, + 13.0, + 5.4, + 6.3, + 4.13, + 5.16, + 2.656 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 8.6, + 30.0, + 17.0, + 12.0, + 8.8, + 36.861, + 6.65, + 13.646 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.209, + 0.993, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.164, + 0.995, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.494 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.009, + 0.097, + 0.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.006, + 0.03 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 2.992 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 46.225 + ] + } + }, + "wt_peptide": "FISYPQILT" + } + }, + "transcripts": [ + "ENST00000441002.1-IL1R2-T/I-143" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 296 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 3, + 1 + ], + "set_expr": [ + 0.19, + 0.0 + ], + "DNA VAF": 0.2, + "RNA VAF": 0.3, + "gene_expr": 0.517, + "best_peptide_mt": "FISYPQILI", + "best_peptide_wt": "FISYPQILT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-106830076-106830077-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "PSCGFIGIL": { + "ic50s_MT": [ + "X", + "X", + "X", + 17000.176 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 19.153 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.693 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14773.614 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.579 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.958 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27761.619, + 30247.449, + 25702.971, + 8297.38, + 892.915, + 3455.97, + 7527.805, + 30847.66 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21068.34, + 32824.21, + 21852.38, + 8478.888, + 392.473, + 2205.82, + 6866.975, + 27188.23 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.236 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.847 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 20.0, + 31.0, + 29.0, + 8.5, + 20.0, + 11.787, + 61.92, + 13.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.9, + 24.0, + 24.0, + 30.0, + 4.6, + 16.0, + 10.91, + 52.62, + 7.283 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.051, + 0.994, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.113, + 0.945, + 0.043 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.958 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.014, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.003, + 0.015, + 0.013 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 16.158 + ] + } + }, + "wt_peptide": "PSSGFIGIL" + } + }, + "transcripts": [ + "ENST00000409382.8-ST6GAL2-S/C-436" + ], + "transcript_expr": [ + 0.048 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 529 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.048 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.048 + ], + "DNA VAF": 0.694, + "RNA VAF": 0.0, + "gene_expr": 0.08, + "best_peptide_mt": "PSCGFIGIL", + "best_peptide_wt": "PSSGFIGIL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-110933496-110933497-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SRYAEALL": { + "ic50s_MT": [ + "X", + "X", + "X", + 704.111 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.56 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.878 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.14 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 497.515 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.377 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.31 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.357 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.344 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2139.91, + 3029.78, + 49.97, + 1097.068, + "NA", + "NA", + 311.154, + 54.42 + ] + }, + "WT": { + "HLA-C*06:02": [ + 901.18, + 2688.65, + 30.87, + 864.682, + "NA", + "NA", + 130.349, + 28.43 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.143 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 0.94, + 0.04, + 0.4, + "NA", + "NA", + 1.107, + 0.56, + 1.611 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.22, + 0.85, + 0.04, + 0.3, + "NA", + "NA", + 0.456, + 0.31, + 2.059 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.121, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.059, + "NA", + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.344 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.117, + 0.073, + 0.323, + 0.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.198, + 0.063, + 0.696, + 0.349 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 1.286 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.27, + 0.444 + ] + } + }, + "wt_peptide": "SRYAGALL" + }, + "FVSRYAEAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2794.335 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.564 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.031 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.16 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4873.36 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.4 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.022 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.742 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.403 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5736.47, + 2505.59, + 3083.08, + 5997.522, + 1013.468, + 1240.424, + 321.048, + 10719.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5587.68, + 4993.98, + 4752.74, + 6978.426, + 2122.316, + 1744.094, + 1005.318, + 19707.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.731 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 0.79, + 3.2, + 21.0, + 9.2, + 12.0, + 1.129, + 20.88, + 3.564 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.7, + 4.5, + 25.0, + 16.0, + 14.0, + 2.819, + 36.62, + 6.022 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.043, + 0.877, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.034, + 0.831, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.403 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.006, + 0.33, + 0.163 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.003, + 0.089, + 0.018 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 1.263 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.3, + 3.185 + ] + } + }, + "wt_peptide": "FVSRYAGAL" + } + }, + "transcripts": [ + "ENST00000439055.6-ACOXL-G/E-305", + "ENST00000389811.8-ACOXL-G/E-305" + ], + "transcript_expr": [ + 0.008, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 2.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 580, + 547 + ], + "transcript_count": 2, + "peptide_count": 2, + "total_expr": 0.008 + }, + "Transcript Set 2": { + "peptides": { + "SRYAEALL": { + "ic50s_MT": [ + "X", + "X", + "X", + 704.111 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.56 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.878 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.14 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 497.515 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.377 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.31 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.357 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.344 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2139.91, + 3029.78, + 49.97, + 1097.068, + "NA", + "NA", + 311.154, + 54.42 + ] + }, + "WT": { + "HLA-C*06:02": [ + 901.18, + 2688.65, + 30.87, + 864.682, + "NA", + "NA", + 130.349, + 28.43 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.143 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 0.94, + 0.04, + 0.4, + "NA", + "NA", + 1.107, + 0.56, + 1.611 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.22, + 0.85, + 0.04, + 0.3, + "NA", + "NA", + 0.456, + 0.31, + 2.059 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.121, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.059, + "NA", + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.344 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.117, + 0.073, + 0.323, + 0.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.198, + 0.063, + 0.696, + 0.349 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 1.286 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.27, + 0.444 + ] + } + }, + "wt_peptide": "SRYAGALL" + }, + "FVSRYAEAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2794.335 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.564 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.031 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.16 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4873.36 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.4 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.022 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.742 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.403 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5736.47, + 2505.59, + 3083.08, + 5997.522, + 1013.468, + 1240.424, + 321.048, + 10719.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5587.68, + 4993.98, + 4752.74, + 6978.426, + 2122.316, + 1744.094, + 1005.318, + 19707.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.731 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 0.79, + 3.2, + 21.0, + 9.2, + 12.0, + 1.129, + 20.88, + 3.564 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.7, + 4.5, + 25.0, + 16.0, + 14.0, + 2.819, + 36.62, + 6.022 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.043, + 0.877, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.034, + 0.831, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.403 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.006, + 0.33, + 0.163 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.003, + 0.089, + 0.018 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 1.263 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.3, + 3.185 + ] + } + }, + "wt_peptide": "FVSRYAGAL" + }, + "SRYAEALLD": { + "ic50s_MT": [ + "X", + "X", + "X", + 4424.035 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.157 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.976 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 15.746 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.613 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3590.27 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.636 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.437 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.989 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.972 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16511.49, + 2315.53, + 9550.53, + 560.916, + 29.772, + 22.728, + 10139.761, + 6532.54 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11355.63, + 2361.63, + 8252.61, + 476.884, + 31.975, + 22.781, + 8699.372, + 4818.91 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.123 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.949 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.7, + 0.73, + 9.0, + 0.7, + 0.6, + 0.4, + 15.179, + 14.2, + 1.976 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 0.75, + 7.8, + 0.5, + 0.6, + 0.4, + 13.234, + 11.46, + 1.437 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.065, + 0.946, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.11, + 0.978, + 0.024 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.613 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.972 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.004, + 0.011, + 0.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.006, + 0.017, + 0.118 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.3, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.7, + 14.277 + ] + } + }, + "wt_peptide": "SRYAGALLD" + } + }, + "transcripts": [ + "ENST00000676595.1-ACOXL-G/E-305" + ], + "transcript_expr": [ + 0.002 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 610 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.002 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 2, + 3 + ], + "set_expr": [ + 0.008, + 0.002 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.188, + "best_peptide_mt": "SRYAEALL", + "best_peptide_wt": "SRYAGALL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-160107761-160107762-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FWKLLVSF": { + "ic50s_MT": [ + "X", + "X", + "X", + 25711.09 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.612 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 22.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.739 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 32.37 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 31790.845 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 28.401 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 32.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 16.04 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.945 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 30608.279, + 39875.852, + 20813.9, + 47366.922, + "NA", + "NA", + 7520.283, + 1351.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34630.13, + 45265.53, + 28951.56, + 50000.0, + "NA", + "NA", + 12830.411, + 1458.1 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.43 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.751 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 23.0, + 43.0, + 22.0, + 56.0, + "NA", + "NA", + 11.787, + 5.01, + 17.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 74.0, + 35.0, + 58.0, + "NA", + "NA", + 19.395, + 5.24, + 24.802 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 32.37 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.945 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.003, + 0.016, + 0.069 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.01, + 0.062 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.2, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.5, + 24.579 + ] + } + }, + "wt_peptide": "IWKLLVSF" + } + }, + "transcripts": [ + "ENST00000283249.7-ITGB6-I/F-729" + ], + "transcript_expr": [ + 0.022 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 788 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.022 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.022 + ], + "DNA VAF": 0.225, + "RNA VAF": 0.0, + "gene_expr": 0.093, + "best_peptide_mt": "FWKLLVSF", + "best_peptide_wt": "IWKLLVSF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-175093191-175093192-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "AANEDPHEK": { + "ic50s_MT": [ + "X", + "X", + "X", + 15444.168 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.561 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.445 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21254.191 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 29.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.824 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.676 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29393.461, + 22855.961, + 26839.801, + 8032.377, + 2843.217, + 4088.556, + 222.968, + 38502.621 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36701.83, + 31750.76, + 33686.63, + 10757.622, + 4873.152, + 7595.738, + 291.46, + 36966.94 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.864 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.567 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 12.0, + 32.0, + 29.0, + 18.0, + 22.0, + 0.818, + 85.18, + 1.177 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.0, + 22.0, + 46.0, + 37.0, + 24.0, + 29.0, + 1.034, + 80.12, + 4.575 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.056, + 0.988, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.056, + 0.987, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.445 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.676 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.285, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.234, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.7, + 1.421 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 1.647 + ] + } + }, + "wt_peptide": "AANEDPDEK" + } + }, + "transcripts": [ + "ENST00000264110.7-ATF2-D/H-352" + ], + "transcript_expr": [ + 13.081 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 505 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 13.081 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 13.081 + ], + "DNA VAF": 0.461, + "RNA VAF": 0.445, + "gene_expr": 100.906, + "best_peptide_mt": "AANEDPHEK", + "best_peptide_wt": "AANEDPDEK", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-190982493-190982494-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSFFLTPA": { + "ic50s_MT": [ + "X", + "X", + "X", + 26050.477 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 42.777 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 29.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 50.372 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 51.931 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 33378.509 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 60.007 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 60.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 64.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 57.13 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 32195.98, + 46143.27, + 25426.369, + 8297.38, + "NA", + "NA", + 26674.584, + 553.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39577.53, + 47160.84, + 37944.28, + 11986.875, + "NA", + "NA", + 28812.737, + 9065.61 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.471 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.821 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 26.0, + 82.0, + 29.0, + 8.8, + "NA", + "NA", + 69.476, + 2.88, + 47.555 + ] + }, + "WT": { + "HLA-C*06:02": [ + 50.0, + 91.0, + 60.0, + 15.0, + "NA", + "NA", + 84.437, + 18.2, + 60.014 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.035, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.026, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 51.931 + ] + }, + "WT": { + "HLA-C*06:02": [ + 57.13 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.056 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.095 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 38.0, + 62.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + 66.0, + 62.745 + ] + } + }, + "wt_peptide": "LSFFLTPP" + } + }, + "transcripts": [ + "ENST00000361099.8-STAT1-P/A-491" + ], + "transcript_expr": [ + 79.567 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 750 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 79.567 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 79.567 + ], + "DNA VAF": 0.583, + "RNA VAF": 0.52, + "gene_expr": 172.622, + "best_peptide_mt": "LSFFLTPA", + "best_peptide_wt": "LSFFLTPP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-195816717-195816718-T-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LANIAPMY": { + "ic50s_MT": [ + "X", + "X", + "X", + 17898.955 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.805 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.61 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.429 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.281 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18676.445 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.409 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.654 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 9.328 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.817 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23123.359, + 34900.199, + 18578.65, + 8119.757, + "NA", + "NA", + 8942.381, + 17219.26 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28273.0, + 39220.31, + 23444.56, + 8950.221, + "NA", + "NA", + 13561.467, + 13908.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.931 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.631 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 28.0, + 19.0, + 8.6, + "NA", + "NA", + 13.61, + 31.97, + 8.302 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 40.0, + 26.0, + 9.6, + "NA", + "NA", + 20.654, + 26.17, + 5.091 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.281 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.817 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.055, + 0.472 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.022, + 0.321 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.2, + 4.658 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.0, + 10.656 + ] + } + }, + "wt_peptide": "LANIEPMY" + } + }, + "transcripts": [ + "ENST00000312428.11-DNAH7-E/A-3224" + ], + "transcript_expr": [ + 0.009 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 4024 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.009 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.009 + ], + "DNA VAF": 0.167, + "RNA VAF": 0.0, + "gene_expr": 0.478, + "best_peptide_mt": "LANIAPMY", + "best_peptide_wt": "LANIEPMY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-201835739-201835740-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ATDYSSEL": { + "ic50s_MT": [ + "X", + "X", + "X", + 9438.418 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.527 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.976 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 55.804 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16082.683 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 15.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.25 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 65.71 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26646.221, + 27090.42, + 12721.85, + 4335.137, + "NA", + "NA", + 6154.985, + 1004.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27891.38, + 25899.78, + 15541.08, + 11986.875, + "NA", + "NA", + 16624.286, + 5578.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.433 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.818 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 16.0, + 13.0, + 3.7, + "NA", + "NA", + 10.053, + 4.17, + 17.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 15.0, + 16.0, + 15.0, + "NA", + "NA", + 27.088, + 12.67, + 26.622 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 55.804 + ] + }, + "WT": { + "HLA-C*06:02": [ + 65.71 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.198, + 0.778 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.017, + 0.3 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.1, + 1.852 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 13.501 + ] + } + }, + "wt_peptide": "ATEYSSEL" + } + }, + "transcripts": [ + "ENST00000260967.6-CDK15-E/D-225" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 384 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.574, + "RNA VAF": 0.0, + "gene_expr": 0.204, + "best_peptide_mt": "ATDYSSEL", + "best_peptide_wt": "ATEYSSEL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-216428741-216428742-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EVDPKVVSNLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 16585.061 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.964 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.544 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.336 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.928 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18065.375 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.542 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 17.289 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.777 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.795 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 35230.27, + 33363.441, + 8664.37, + 3932.892, + "NA", + "NA", + 7574.961, + 24505.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35575.39, + 35255.82, + 11172.82, + 4382.296, + "NA", + "NA", + 9383.571, + 24957.93 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.343 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.434 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 34.0, + 25.0, + 7.8, + 3.1, + "NA", + "NA", + 11.787, + 46.47, + 15.544 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35.0, + 29.0, + 12.0, + 3.7, + "NA", + "NA", + 14.156, + 47.49, + 17.289 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.928 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.795 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.045, + 0.365 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.046, + 0.43 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 5.672 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 5.555 + ] + } + }, + "wt_peptide": "EVDPKLVSNLM" + } + }, + "transcripts": [ + "ENST00000357276.9-SMARCAL1-L/V-432" + ], + "transcript_expr": [ + 3.727 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 954 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.727 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.727 + ], + "DNA VAF": 0.457, + "RNA VAF": 0.52, + "gene_expr": 14.405, + "best_peptide_mt": "EVDPKVVSNLM", + "best_peptide_wt": "EVDPKLVSNLM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-219471924-219471925-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "CKSVIANKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 15426.078 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.31 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 16.04 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.484 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.221 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4180.749 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.887 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.25 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.341 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "1", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7057.39, + 17922.15, + 26694.99, + 12930.007, + 34979.211, + 31737.301, + 3943.837, + 7683.21 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1110.73, + 3847.41, + 10246.39, + 7446.484, + 7207.921, + 4514.088, + 135.103, + 377.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.516 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 7.3, + 32.0, + 43.0, + 52.0, + 51.0, + 7.319, + 16.04, + 0.487 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.26, + 1.3, + 9.7, + 26.0, + 29.0, + 23.0, + 0.474, + 2.25, + 0.094 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + 0.949, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + 0.95, + 0.087 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.341 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + 0.024, + 0.052, + 0.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.335, + 0.535, + 0.919, + 0.81 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 4.969 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.13, + 0.093 + ] + } + }, + "wt_peptide": "YKSVIANKL" + } + }, + "transcripts": [ + "ENST00000312358.12-SPEG-Y/C-1258" + ], + "transcript_expr": [ + 0.702 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3267 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.702 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.702 + ], + "DNA VAF": 0.333, + "RNA VAF": 0.397, + "gene_expr": 66.211, + "best_peptide_mt": "CKSVIANKL", + "best_peptide_wt": "YKSVIANKL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-222689427-222689428-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SYLHVLPLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4079.734 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.751 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.249 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.864 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18674.56 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.082 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 22.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.514 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.48 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3732.6, + 9684.35, + 4526.88, + 3975.676, + 5872.324, + 4183.791, + 201.17, + 2610.77 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14156.86, + 27130.6, + 23192.26, + 6330.919, + 27277.841, + 10979.182, + 7092.39, + 27916.38 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.132 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.375 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.86, + 3.5, + 4.3, + 14.0, + 26.0, + 22.0, + 0.74, + 7.58, + 2.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.5, + 16.0, + 27.0, + 22.0, + 48.0, + 34.0, + 11.187, + 54.36, + 16.164 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.069, + 0.953, + 0.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.962, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.864 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.48 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.139, + 0.008, + 0.915, + 0.907 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.027, + 0.002, + 0.283, + 0.949 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 0.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 1.429 + ] + } + }, + "wt_peptide": "SYLHVLPLW" + } + }, + "transcripts": [ + "ENST00000446656.4-MOGAT1-W/L-146" + ], + "transcript_expr": [ + 0.091 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 335 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.091 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.091 + ], + "DNA VAF": 0.349, + "RNA VAF": 0.0, + "gene_expr": 0.091, + "best_peptide_mt": "SYLHVLPLL", + "best_peptide_wt": "SYLHVLPLW", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-227893862-227893863-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ASGEELNML": { + "ic50s_MT": [ + "X", + "X", + "X", + 3768.321 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.4 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.66 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.572 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6667.913 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.15 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.117 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.781 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24549.93, + 5344.0, + 14722.66, + 2192.642, + 710.902, + 578.855, + 483.401, + 14256.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21089.1, + 10335.02, + 14329.76, + 3000.805, + 920.047, + 1214.982, + 134.334, + 11930.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.766 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.766 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 1.9, + 16.0, + 5.6, + 7.2, + 6.3, + 1.59, + 26.77, + 0.911 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.9, + 3.8, + 15.0, + 8.5, + 8.7, + 11.0, + 0.474, + 22.88, + 0.91 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.931, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.935, + 0.05 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.572 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.781 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.161, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.001, + 0.409, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.2, + 2.12 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 1.034 + ] + } + }, + "wt_peptide": "ASGEELNTL" + } + }, + "transcripts": [ + "ENST00000309931.3-DAW1-T/M-129" + ], + "transcript_expr": [ + 0.016 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 415 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.016 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.016 + ], + "DNA VAF": 0.336, + "RNA VAF": 0.0, + "gene_expr": 0.488, + "best_peptide_mt": "ASGEELNML", + "best_peptide_wt": "ASGEELNTL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr2-236392010-236392011-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VDRERKRPV": { + "ic50s_MT": [ + "X", + "X", + "X", + 7632.566 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.08 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 11.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.48 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.111 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10814.392 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.403 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.903 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.508 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26453.18, + 10376.81, + 10699.58, + 8664.367, + 2778.497, + 5815.271, + 6600.764, + 4331.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27204.97, + 12293.57, + 13141.57, + 11730.27, + 2470.643, + 9898.514, + 6655.974, + 1654.11 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.897 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.646 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 3.8, + 11.0, + 31.0, + 18.0, + 26.0, + 10.638, + 10.66, + 7.869 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 4.6, + 14.0, + 40.0, + 17.0, + 33.0, + 10.638, + 5.66, + 5.235 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.97, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.964, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.111 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.508 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.015, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.019, + 0.078 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.8, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 12.805 + ] + } + }, + "wt_peptide": "VDRERERPV" + } + }, + "transcripts": [ + "ENST00000409907.8-IQCA1-E/K-460" + ], + "transcript_expr": [ + 7.726 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 822 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.726 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.726 + ], + "DNA VAF": 0.233, + "RNA VAF": 0.087, + "gene_expr": 14.414, + "best_peptide_mt": "VDRERKRPV", + "best_peptide_wt": "VDRERERPV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-2312957-2312958-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FRCDAATDV": { + "ic50s_MT": [ + "X", + "X", + "X", + 64.681 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.281 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.603 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.726 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 51.93 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.17 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.145 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.414 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.607 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 669.19, + 35.14, + 208.42, + 442.1, + 6.149, + 9.607, + 94.222, + 4.66 + ] + }, + "WT": { + "HLA-C*06:02": [ + 193.75, + 28.89, + 74.97, + 337.323, + 3.458, + 5.452, + 77.219, + 5.89 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.183 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.093 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.15, + 0.02, + 0.28, + 0.5, + 0.2, + 0.3, + 0.283, + 0.01, + 0.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.02, + 0.08, + 0.3, + 0.2, + 0.2, + 0.194, + 0.03, + 0.145 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.121, + 0.881, + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.391, + 0.939, + 0.06 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.726 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.607 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.143, + 0.003, + 0.502, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.337, + 0.126, + 0.559, + 0.038 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.39, + 0.817 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.13, + 0.697 + ] + } + }, + "wt_peptide": "FRRDAATDV" + }, + "FRCDAATDVA": { + "ic50s_MT": [ + "X", + "X", + "X", + 2837.125 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.669 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.508 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.836 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2274.537 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.364 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.446 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.628 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13456.1, + 3283.36, + 2377.99, + 2390.889, + "NA", + "NA", + 4534.818, + 3.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7926.45, + 2724.82, + 1000.67, + 1824.253, + "NA", + "NA", + 2755.566, + 4.14 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.235 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.632 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 1.2, + 2.2, + 1.3, + "NA", + "NA", + 8.063, + 0.0, + 2.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 0.85, + 1.2, + 0.9, + "NA", + "NA", + 5.742, + 0.01, + 5.099 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.763, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.752, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.628 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.022, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.036, + 0.025 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.9, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 6.793 + ] + } + }, + "wt_peptide": "FRRDAATDVA" + } + }, + "transcripts": [ + "ENST00000651531.1-ENSG00000286022-R/C-220" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 712 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "FRCDAATDVA": { + "ic50s_MT": [ + "X", + "X", + "X", + 2837.125 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.669 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.508 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.836 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2274.537 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.364 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.446 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.628 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13456.1, + 3283.36, + 2377.99, + 2390.889, + "NA", + "NA", + 4534.818, + 3.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7926.45, + 2724.82, + 1000.67, + 1824.253, + "NA", + "NA", + 2755.566, + 4.14 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.235 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.632 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.2, + 1.2, + 2.2, + 1.3, + "NA", + "NA", + 8.063, + 0.0, + 2.501 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 0.85, + 1.2, + 0.9, + "NA", + "NA", + 5.742, + 0.01, + 5.099 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.763, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.752, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.836 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.628 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.022, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.036, + 0.025 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.9, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.1, + 6.793 + ] + } + }, + "wt_peptide": "FRRDAATDVA" + } + }, + "transcripts": [ + "ENST00000381458.6-TGM3-R/C-201" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 693 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 0.0, + 0.0 + ], + "DNA VAF": 0.65, + "RNA VAF": 0.0, + "gene_expr": "NA", + "best_peptide_mt": "FRCDAATDV", + "best_peptide_wt": "FRRDAATDV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-4182496-4182497-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KRKYTSFF": { + "ic50s_MT": [ + "X", + "X", + "X", + 6555.995 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.681 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.909 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.963 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6823.72 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.537 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.866 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.074 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4877.09, + 11775.41, + 2077.17, + 1967.786, + "NA", + "NA", + 8234.899, + 16124.66 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6165.83, + 7481.61, + 2416.9, + 5324.554, + "NA", + "NA", + 9174.184, + 8157.27 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.896 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.758 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 4.4, + 1.9, + 0.9, + "NA", + "NA", + 12.649, + 30.0, + 7.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 2.7, + 2.1, + 5.0, + "NA", + "NA", + 13.877, + 16.76, + 6.308 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.074 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.041, + 0.007, + 0.012, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.029, + 0.004, + 0.011, + 0.017 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 20.232 + ] + } + }, + "wt_peptide": "KRQYTSFF" + } + }, + "transcripts": [ + "ENST00000305958.9-SMOX-Q/K-340" + ], + "transcript_expr": [ + 25.284 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 555 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 25.284 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 25.284 + ], + "DNA VAF": 0.6, + "RNA VAF": 0.539, + "gene_expr": 34.52, + "best_peptide_mt": "KRKYTSFF", + "best_peptide_wt": "KRQYTSFF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-10054508-10054509-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TTSEGNKV": { + "ic50s_MT": [ + "X", + "X", + "X", + 13822.942 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.139 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.139 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 75.508 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11853.398 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.86 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.22 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.65 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 79.282 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 32124.301, + 36222.09, + 7989.04, + 14882.824, + "NA", + "NA", + 5674.639, + 12763.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32044.47, + 37056.15, + 9759.45, + 13947.345, + "NA", + "NA", + 5399.607, + 6546.6 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.082 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.187 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 26.0, + 31.0, + 6.4, + 20.0, + "NA", + "NA", + 9.496, + 24.25, + 10.522 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.0, + 33.0, + 8.2, + 18.0, + "NA", + "NA", + 9.134, + 14.22, + 12.545 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.029, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.088, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 75.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 79.282 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.017, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.013, + 0.018, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.8, + 13.501 + ] + } + }, + "wt_peptide": "TTSEGKKV" + } + }, + "transcripts": [ + "ENST00000378392.6-ANKEF1-K/N-694" + ], + "transcript_expr": [ + 1.152 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 776 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.152 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.152 + ], + "DNA VAF": 0.521, + "RNA VAF": 0.382, + "gene_expr": 3.908, + "best_peptide_mt": "TTSEGNKV", + "best_peptide_wt": "TTSEGKKV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-17659330-17659331-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NQGKKVKGA": { + "ic50s_MT": [ + "X", + "X", + "X", + 26271.494 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 29.533 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 42.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 22.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 27.423 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 30104.31 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 34.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 37.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.29 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 42.515 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 31273.779, + 40646.859, + 38565.121, + 21269.211, + 18022.291, + 5402.192, + 12659.319, + 36996.922 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34366.22, + 41206.13, + 37739.56, + 25842.399, + 13360.109, + 8701.017, + 10760.968, + 38083.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.237 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.905 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 24.0, + 46.0, + 62.0, + 60.0, + 42.0, + 25.0, + 19.161, + 80.22, + 13.504 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31.0, + 48.0, + 59.0, + 66.0, + 37.0, + 31.0, + 16.156, + 83.79, + 28.987 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.968, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.96, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 27.423 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.515 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.008, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.009, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 24.579 + ] + } + }, + "wt_peptide": "NQGKKVEGA" + } + }, + "transcripts": [ + "ENST00000377813.6-RRBP1-E/K-393" + ], + "transcript_expr": [ + 33.598 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1410 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 33.598 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 33.598 + ], + "DNA VAF": 0.574, + "RNA VAF": 0.493, + "gene_expr": 153.904, + "best_peptide_mt": "NQGKKVKGA", + "best_peptide_wt": "NQGKKVEGA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-23354058-23354059-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SVDLKTYV": { + "ic50s_MT": [ + "X", + "X", + "X", + 10507.709 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.884 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.758 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 41.097 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10973.266 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.044 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.494 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 46.863 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24531.869, + 33499.09, + 9047.59, + 3725.78, + "NA", + "NA", + 11967.827, + 3280.58 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19827.55, + 27162.62, + 7945.94, + 3066.449, + "NA", + "NA", + 14000.591, + 203.04 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.256 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.473 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 25.0, + 7.5, + 2.9, + "NA", + "NA", + 17.841, + 8.83, + 13.884 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.9, + 16.0, + 6.3, + 2.1, + "NA", + "NA", + 21.487, + 1.5, + 18.048 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.061, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.11, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 41.097 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46.863 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.004, + 0.022, + 0.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.004, + 0.02, + 0.298 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.4, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 12.187 + ] + } + }, + "wt_peptide": "SVDFKTYV" + } + }, + "transcripts": [ + "ENST00000254998.3-NXT1-F/L-6" + ], + "transcript_expr": [ + 38.946 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 140 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 38.946 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 38.946 + ], + "DNA VAF": 0.375, + "RNA VAF": 0.422, + "gene_expr": 38.946, + "best_peptide_mt": "SVDLKTYV", + "best_peptide_wt": "SVDFKTYV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-35384131-35384132-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SRTSQSPQM": { + "ic50s_MT": [ + "X", + "X", + "X", + 365.305 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.849 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.364 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 13.411 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 752.965 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.8 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.499 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.658 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 429.21, + 376.46, + 354.15, + 953.119, + 78.489, + 56.829, + 80.423, + 2001.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 588.23, + 1660.35, + 917.7, + 1485.268, + 195.799, + 166.944, + 121.452, + 1794.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.119 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.451 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 0.14, + 0.49, + 1.6, + 1.3, + 1.0, + 0.212, + 6.38, + 1.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.13, + 0.51, + 1.2, + 3.1, + 2.7, + 2.4, + 0.418, + 5.96, + 3.73 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.969, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.974, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 13.411 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.658 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.57, + 0.001, + 0.559, + 0.05 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.448, + 0.001, + 0.453, + 0.042 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.697 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.07, + 0.927 + ] + } + }, + "wt_peptide": "SRTSQWPQM" + } + }, + "transcripts": [ + "ENST00000374385.10-UQCC1-W/S-44", + "ENST00000397554.5-UQCC1-W/S-44" + ], + "transcript_expr": [ + 20.661, + 4.98 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 299, + 221 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 25.641000000000002 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 25.641000000000002 + ], + "DNA VAF": 0.434, + "RNA VAF": 0.327, + "gene_expr": 47.722, + "best_peptide_mt": "SRTSQSPQM", + "best_peptide_wt": "SRTSQWPQM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-41165771-41165772-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TGAPDGCFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 14114.554 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.134 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.322 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11199.621 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 19.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.29 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.923 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "7", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15233.1, + 25835.4, + 21734.48, + 12790.861, + 12996.009, + 8271.229, + 990.489, + 35021.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11261.17, + 22510.65, + 17410.87, + 9654.428, + 11138.071, + 5182.866, + 487.693, + 22191.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.086 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.897 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 15.0, + 24.0, + 43.0, + 37.0, + 30.0, + 2.772, + 73.99, + 1.862 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 12.0, + 19.0, + 33.0, + 35.0, + 25.0, + 1.605, + 41.5, + 1.277 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.93, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.927, + 0.044 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.322 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.923 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.137, + 0.151 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.002, + 0.248, + 0.164 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.9, + 2.367 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.0, + 1.58 + ] + } + }, + "wt_peptide": "TGAPDGSFL" + } + }, + "transcripts": [ + "ENST00000373271.5-PLCG1-S/C-582" + ], + "transcript_expr": [ + 0.701 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1290 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.701 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.701 + ], + "DNA VAF": 0.429, + "RNA VAF": 0.444, + "gene_expr": 67.838, + "best_peptide_mt": "TGAPDGCFL", + "best_peptide_wt": "TGAPDGSFL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-59301546-59301547-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VAGPGEWTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4246.898 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.25 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.309 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.626 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11166.819 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.35 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.385 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.128 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13066.57, + 19762.66, + 15625.39, + 3975.676, + 1145.012, + 2283.337, + 206.645, + 4518.12 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18182.12, + 26008.75, + 22942.68, + 4151.518, + 2321.721, + 2968.725, + 169.889, + 27673.82 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.782 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.442 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 8.5, + 17.0, + 14.0, + 9.8, + 16.0, + 0.765, + 10.97, + 0.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.7, + 15.0, + 26.0, + 14.0, + 16.0, + 19.0, + 0.627, + 53.77, + 3.672 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.153, + 0.953, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.947, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.626 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.128 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.015, + 0.457, + 0.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.359, + 0.023 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 0.917 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.6, + 1.171 + ] + } + }, + "wt_peptide": "VAGPGEGTV" + } + }, + "transcripts": [ + "ENST00000395654.3-EDN3-G/W-64", + "ENST00000644821.1-EDN3-G/W-64" + ], + "transcript_expr": [ + 0.0, + 0.006 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 224, + 198 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.006 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.006 + ], + "DNA VAF": 0.22, + "RNA VAF": 0.0, + "gene_expr": 0.019, + "best_peptide_mt": "VAGPGEWTV", + "best_peptide_wt": "VAGPGEGTV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr20-59944225-59944226-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SAGDLSDSE": { + "ic50s_MT": [ + "X", + "X", + "X", + 16040.613 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 27.859 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 29.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 24.08 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.362 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13459.374 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 19.318 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.639 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.444 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 42867.398, + 37292.25, + 41375.0, + 6330.918, + 7759.076, + 3610.522, + 6240.242, + 24322.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38310.18, + 36251.51, + 38357.05, + 6682.848, + 2316.381, + 1669.437, + 5659.197, + 20235.9 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.821 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.452 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 70.0, + 34.0, + 75.0, + 22.0, + 29.0, + 21.0, + 10.133, + 46.07, + 26.717 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45.0, + 31.0, + 61.0, + 24.0, + 16.0, + 14.0, + 9.422, + 37.61, + 17.637 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.963, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.974, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.362 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.444 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.015, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.017, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 33.0, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 14.277 + ] + } + }, + "wt_peptide": "SASDLSDSE" + } + }, + "transcripts": [ + "ENST00000360816.8-FAM217B-S/G-95" + ], + "transcript_expr": [ + 4.293 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 383 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.293 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 4.293 + ], + "DNA VAF": 0.578, + "RNA VAF": 0.446, + "gene_expr": 16.58, + "best_peptide_mt": "SAGDLSDSE", + "best_peptide_wt": "SASDLSDSE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr21-30755335-30755336-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YGSSCGCGY": { + "ic50s_MT": [ + "X", + "X", + "X", + 9841.575 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.111 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.831 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 34.378 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10273.664 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.606 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 15.212 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.066 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 30.453 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "5,7", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13072.22, + 30546.08, + 19191.6, + 6610.931, + 3808.991, + 2126.033, + 2625.13, + 35860.18 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14007.54, + 32161.53, + 19717.81, + 6539.788, + 1523.386, + 1724.13, + 1658.675, + 39304.36 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.326 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 20.0, + 21.0, + 23.0, + 21.0, + 16.0, + 5.541, + 76.61, + 18.222 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.5, + 23.0, + 22.0, + 23.0, + 13.0, + 14.0, + 4.034, + 87.88, + 15.212 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.952, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.884, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 34.378 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.453 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.035, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.054, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.7, + 6.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 4.732 + ] + } + }, + "wt_peptide": "YGSGCGCGY" + } + }, + "transcripts": [ + "ENST00000335093.5-KRTAP21-1-G/S-15" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 79 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.47, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "YGSSCGCGY", + "best_peptide_wt": "YGSGCGCGY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr21-43172070-43172071-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ERQHDHGYI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3878.268 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.082 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.164 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 6.175 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.181 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1746.765 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.856 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.911 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.279 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.562 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7627.92, + 3934.42, + 5620.54, + 2842.778, + 669.592, + 1058.205, + 3822.116, + 38874.609 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4413.47, + 1546.92, + 2664.09, + 1946.61, + 170.141, + 310.149, + 1051.826, + 40613.42 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.547 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 1.3, + 5.2, + 7.9, + 7.0, + 9.4, + 7.164, + 86.42, + 10.153 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 0.49, + 2.8, + 4.8, + 2.5, + 3.8, + 2.911, + 92.09, + 4.423 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.956, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.866, + 0.03 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.181 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.562 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.025, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.041, + 0.001, + 0.082, + 0.007 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 9.849 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 3.359 + ] + } + }, + "wt_peptide": "ERQDDHGYI" + } + }, + "transcripts": [ + "ENST00000291554.6-CRYAA-D/H-105", + "ENST00000398132.1-CRYAA-D/H-68", + "ENST00000398133.5-CRYAA-D/H-85" + ], + "transcript_expr": [ + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 1.0, + 2.0, + 3.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 173, + 136, + 153 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.54, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "ERQHDHGYI", + "best_peptide_wt": "ERQDDHGYI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr21-44330789-44330813-AGGCAGCCGCGGCCCCTAGCGGCCC-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HRGRVSGSA": { + "ic50s_MT": [ + "X", + "X", + "X", + 10429.296 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.639 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.289 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 18.623 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 24458.046 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 35.872 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 35.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 34.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 36.744 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8, 9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15167.64, + 25849.67, + 23192.26, + 2469.769, + 17571.547, + 4598.011, + 5690.952, + 2470.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35597.36, + 37230.97, + 38565.12, + 3807.283, + 23378.142, + 9830.373, + 14547.48, + 25537.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.99 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.858 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 15.0, + 27.0, + 6.5, + 42.0, + 23.0, + 9.496, + 7.32, + 31.536 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35.0, + 34.0, + 62.0, + 13.0, + 46.0, + 33.0, + 22.677, + 48.79, + 61.294 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.982, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.986, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 18.623 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.744 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.017, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.3, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 37.359 + ] + } + }, + "wt_peptide": "HRGRVSGGP" + } + }, + "transcripts": [ + "ENST00000397956.7-CFAP410-GPLGAAAA/--217-224" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 375 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.376, + "RNA VAF": 0.0, + "gene_expr": 6.57, + "best_peptide_mt": "HRGRVSGSA", + "best_peptide_wt": "HRGRVSGGP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-26540809-26540810-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GKHGGVSLSKI": { + "ic50s_MT": [ + "X", + "X", + "X", + 23323.926 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.336 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 11.34 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27697.875 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.121 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.558 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.577 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29793.051, + 40820.941, + 16854.801, + 10874.648, + "NA", + "NA", + 16247.421, + 32585.551 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29272.22, + 45329.74, + 26123.53, + 13212.856, + "NA", + "NA", + 11553.88, + 39558.57 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.903 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.413 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 47.0, + 18.0, + 14.0, + "NA", + "NA", + 26.243, + 66.76, + 7.946 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 75.0, + 32.0, + 17.0, + "NA", + "NA", + 17.242, + 88.71, + 3.482 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + "NA", + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 11.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.577 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.005, + 0.044, + 0.571 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.012, + 0.021, + 0.266 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 5.672 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 11.116 + ] + } + }, + "wt_peptide": "GKPGGVSLSKI" + } + }, + "transcripts": [ + "ENST00000338754.9-TPST2-P/H-274" + ], + "transcript_expr": [ + 3.495 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 377 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.495 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.495 + ], + "DNA VAF": 0.203, + "RNA VAF": 0.21, + "gene_expr": 28.333, + "best_peptide_mt": "GKHGGVSLSKI", + "best_peptide_wt": "GKPGGVSLSKI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-37374977-37374978-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ELAGNLFN": { + "ic50s_MT": [ + "X", + "X", + "X", + 43408.871 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 64.857 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 66.97 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 74.372 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 52.057 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 43850.435 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 72.777 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 72.553 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 86.143 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 53.815 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 46108.82, + 46886.09, + 40708.922, + 50000.0, + "NA", + "NA", + 24760.719, + 22506.891 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46325.87, + 47184.82, + 41375.0, + 50000.0, + "NA", + "NA", + 26276.736, + 28174.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -4.024 + ] + }, + "WT": { + "HLA-C*06:02": [ + -4.197 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 93.0, + 89.0, + 73.0, + 58.0, + "NA", + "NA", + 59.2, + 42.15, + 66.97 + ] + }, + "WT": { + "HLA-C*06:02": [ + 95.0, + 91.0, + 77.0, + 58.0, + "NA", + "NA", + 67.645, + 55.01, + 72.553 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.057, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 52.057 + ] + }, + "WT": { + "HLA-C*06:02": [ + 53.815 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.004, + 0.004 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 86.0, + 62.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + 73.0, + 99.287 + ] + } + }, + "wt_peptide": "ELAGNPFN" + } + }, + "transcripts": [ + "ENST00000402918.7-ELFN2-P/L-186" + ], + "transcript_expr": [ + 0.853 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 4.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 820 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.853 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.853 + ], + "DNA VAF": 0.168, + "RNA VAF": 0.368, + "gene_expr": 0.89, + "best_peptide_mt": "ELAGNLFN", + "best_peptide_wt": "ELAGNPFN", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-37570267-37570268-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FNMSSFKLKQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 24541.225 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 47.05 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 43.51 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 55.872 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 45.101 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 26455.159 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 48.812 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 37.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 57.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 45.625 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 35087.988, + 43598.988, + 25017.039, + 22695.785, + "NA", + "NA", + 24065.408, + 23142.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35645.92, + 44246.71, + 29266.51, + 19717.806, + "NA", + "NA", + 23643.807, + 13337.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.575 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.609 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 33.0, + 62.0, + 29.0, + 30.0, + "NA", + "NA", + 54.762, + 43.51, + 51.237 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35.0, + 66.0, + 37.0, + 26.0, + "NA", + "NA", + 52.026, + 25.19, + 52.461 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.982, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.982, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 45.101 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45.625 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 49.0, + 62.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + 52.0, + 62.745 + ] + } + }, + "wt_peptide": "FNMSSFKLKE" + } + }, + "transcripts": [ + "ENST00000215886.6-LGALS2-E/Q-132" + ], + "transcript_expr": [ + 0.057 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 132 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.057 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.057 + ], + "DNA VAF": 0.484, + "RNA VAF": 0.222, + "gene_expr": 0.067, + "best_peptide_mt": "FNMSSFKLKQ", + "best_peptide_wt": "FNMSSFKLKE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-37631020-37631021-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ARPPQQPVP": { + "ic50s_MT": [ + "X", + "X", + "X", + 10012.355 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.7 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.773 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.313 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 15776.426 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.928 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.221 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.309 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 47.457 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24414.57, + 18363.02, + 22209.93, + 1422.358, + 506.769, + 483.693, + 1661.689, + 21177.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37752.2, + 18589.52, + 30396.07, + 3380.076, + 431.33, + 1414.393, + 12963.332, + 35595.52 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.427 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.482 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 7.6, + 25.0, + 2.9, + 5.8, + 5.6, + 4.034, + 39.47, + 3.571 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43.0, + 7.7, + 39.0, + 10.0, + 5.1, + 13.0, + 19.636, + 75.77, + 18.221 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.04, + 0.999, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.046, + 0.999, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.313 + ] + }, + "WT": { + "HLA-C*06:02": [ + 47.457 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.002, + 0.139, + 0.298 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.008, + 0.03 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 2.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 27.617 + ] + } + }, + "wt_peptide": "PRPPQQPVP" + } + }, + "transcripts": [ + "ENST00000343632.9-GGA1-P/A-484" + ], + "transcript_expr": [ + 23.223 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 639 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 23.223 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 23.223 + ], + "DNA VAF": 0.436, + "RNA VAF": 0.435, + "gene_expr": 51.482, + "best_peptide_mt": "ARPPQQPVP", + "best_peptide_wt": "PRPPQQPVP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-37723212-37723213-GA-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GRSAGSTGQGS": { + "ic50s_MT": [ + "X", + "X", + "X", + 31325.73 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 34.533 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 38.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 34.139 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 25.405 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 42248.09, + 45967.859, + 29584.891, + 5154.497, + "NA", + "NA", + 5906.258, + 33066.57 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.975 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 66.0, + 80.0, + 38.0, + 4.8, + "NA", + "NA", + 9.734, + 68.13, + 31.065 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 25.405 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.016, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 54.0, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000644935.1-TRIOBP-G/X-219" + ], + "transcript_expr": [ + 2.793 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2365 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.793 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.793 + ], + "DNA VAF": 0.289, + "RNA VAF": 0.0, + "gene_expr": 35.473, + "best_peptide_mt": "GRSAGSTGQGS", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-41524890-41524891-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KFNPQTDYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2737.512 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.6 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.579 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.88 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3069.029 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.27 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.96 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.639 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6277.78, + 4582.76, + 5154.5, + 2936.567, + 1882.825, + 2538.458, + 226.331, + 1663.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10046.7, + 7018.18, + 7860.43, + 3236.91, + 1980.66, + 2901.149, + 281.502, + 2445.19 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.818 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.933 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.6, + 4.9, + 8.2, + 15.0, + 17.0, + 0.825, + 5.68, + 1.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 2.5, + 7.4, + 9.4, + 15.0, + 18.0, + 1.005, + 7.27, + 1.39 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.052, + 0.974, + 0.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.958, + 0.058 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.639 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.085, + 0.001, + 0.648, + 0.439 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.001, + 0.438, + 0.256 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 0.528 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.96, + 0.96 + ] + } + }, + "wt_peptide": "KFNPETDYL" + }, + "LKFNPQTDY": { + "ic50s_MT": [ + "X", + "X", + "X", + 3339.56 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.254 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.928 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.877 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.855 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4644.461 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.821 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.55 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.907 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.241 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11137.33, + 2973.53, + 21384.59, + 1485.268, + 4464.882, + 943.127, + 3705.591, + 784.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17650.62, + 4911.08, + 24349.41, + 2077.174, + 5417.638, + 2049.132, + 4377.842, + 2594.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.612 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.528 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 0.92, + 24.0, + 3.1, + 23.0, + 8.8, + 7.01, + 3.58, + 4.928 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.4, + 1.7, + 29.0, + 5.2, + 25.0, + 15.0, + 7.884, + 7.55, + 4.275 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.978, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.962, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.855 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.241 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.001, + 0.158, + 0.561 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.002, + 0.096, + 0.446 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 2.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 3.014 + ] + } + }, + "wt_peptide": "LKFNPETDY" + }, + "LKFNPQTDYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4792.799 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.098 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.52 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5717.195 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.9 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.985 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.054 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8070.79, + 10977.26, + 4701.59, + 2722.37, + "NA", + "NA", + 4884.008, + 1240.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12258.11, + 12798.75, + 6434.51, + 3343.702, + "NA", + "NA", + 4999.879, + 2440.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.739 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.1, + 4.0, + 4.0, + 1.6, + "NA", + "NA", + 8.503, + 4.74, + 11.731 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 4.8, + 5.6, + 2.4, + "NA", + "NA", + 8.645, + 7.25, + 6.114 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.962, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.957, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.054 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.011, + 0.106, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.015, + 0.097, + 0.487 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 2.795 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 2.971 + ] + } + }, + "wt_peptide": "LKFNPETDYL" + } + }, + "transcripts": [ + "ENST00000396512.3-ACO2-E/Q-535" + ], + "transcript_expr": [ + 0.112 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 805 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.112 + }, + "Transcript Set 2": { + "peptides": { + "KFNPQTDYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2737.512 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.6 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.579 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.88 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3069.029 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.27 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.96 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.639 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6277.78, + 4582.76, + 5154.5, + 2936.567, + 1882.825, + 2538.458, + 226.331, + 1663.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10046.7, + 7018.18, + 7860.43, + 3236.91, + 1980.66, + 2901.149, + 281.502, + 2445.19 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.818 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.933 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.6, + 4.9, + 8.2, + 15.0, + 17.0, + 0.825, + 5.68, + 1.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 2.5, + 7.4, + 9.4, + 15.0, + 18.0, + 1.005, + 7.27, + 1.39 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.052, + 0.974, + 0.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.958, + 0.058 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.639 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.085, + 0.001, + 0.648, + 0.439 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.001, + 0.438, + 0.256 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 0.528 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.96, + 0.96 + ] + } + }, + "wt_peptide": "KFNPETDYL" + }, + "LKFNPQTDYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4792.799 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.098 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.52 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5717.195 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.9 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.985 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.054 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8070.79, + 10977.26, + 4701.59, + 2722.37, + "NA", + "NA", + 4884.008, + 1240.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12258.11, + 12798.75, + 6434.51, + 3343.702, + "NA", + "NA", + 4999.879, + 2440.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.739 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.1, + 4.0, + 4.0, + 1.6, + "NA", + "NA", + 8.503, + 4.74, + 11.731 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 4.8, + 5.6, + 2.4, + "NA", + "NA", + 8.645, + 7.25, + 6.114 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.962, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.957, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.054 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.011, + 0.106, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.015, + 0.097, + 0.487 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 2.795 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 2.971 + ] + } + }, + "wt_peptide": "LKFNPETDYL" + } + }, + "transcripts": [ + "ENST00000216254.9-ACO2-E/Q-510" + ], + "transcript_expr": [ + 101.95 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 780 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 101.95 + }, + "Transcript Set 3": { + "peptides": { + "LKFNPQTDY": { + "ic50s_MT": [ + "X", + "X", + "X", + 3339.56 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.254 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.928 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.877 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.855 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4644.461 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.821 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.55 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.907 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.241 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11137.33, + 2973.53, + 21384.59, + 1485.268, + 4464.882, + 943.127, + 3705.591, + 784.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17650.62, + 4911.08, + 24349.41, + 2077.174, + 5417.638, + 2049.132, + 4377.842, + 2594.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.612 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.528 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 0.92, + 24.0, + 3.1, + 23.0, + 8.8, + 7.01, + 3.58, + 4.928 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.4, + 1.7, + 29.0, + 5.2, + 25.0, + 15.0, + 7.884, + 7.55, + 4.275 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.978, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.962, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.855 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.241 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.001, + 0.158, + 0.561 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.002, + 0.096, + 0.446 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 2.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 3.014 + ] + } + }, + "wt_peptide": "LKFNPETDY" + }, + "LKFNPQTDYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4792.798 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.098 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.52 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5717.194 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.9 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.985 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.054 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8070.79, + 10977.26, + 4701.59, + 2722.37, + "NA", + "NA", + 4884.007, + 1240.78 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12258.11, + 12798.75, + 6434.51, + 3343.702, + "NA", + "NA", + 4999.879, + 2440.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.739 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.1, + 4.0, + 4.0, + 1.6, + "NA", + "NA", + 8.503, + 4.74, + 11.731 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 4.8, + 5.6, + 2.4, + "NA", + "NA", + 8.645, + 7.25, + 6.114 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.962, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.957, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.054 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.011, + 0.106, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.015, + 0.097, + 0.487 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 2.795 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 2.971 + ] + } + }, + "wt_peptide": "LKFNPETDYL" + } + }, + "transcripts": [ + "ENST00000678269.1-ACO2-E/Q-535", + "ENST00000678788.1-ACO2-E/Q-505", + "ENST00000677554.1-ACO2-E/Q-510" + ], + "transcript_expr": [ + 0.112, + 0.0, + 0.0 + ], + "mane_select": [ + false, + false, + false + ], + "canonical": [ + false, + false, + false + ], + "tsl": [ + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 805, + 775, + 716 + ], + "transcript_count": 3, + "peptide_count": 2, + "total_expr": 0.112 + }, + "Transcript Set 4": { + "peptides": { + "KFNPQTDYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2737.512 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.6 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.579 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.88 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3069.029 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.27 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.96 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.639 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6277.78, + 4582.76, + 5154.5, + 2936.567, + 1882.825, + 2538.458, + 226.331, + 1663.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10046.7, + 7018.18, + 7860.43, + 3236.91, + 1980.66, + 2901.149, + 281.502, + 2445.19 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.818 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.933 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.6, + 4.9, + 8.2, + 15.0, + 17.0, + 0.825, + 5.68, + 1.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 2.5, + 7.4, + 9.4, + 15.0, + 18.0, + 1.005, + 7.27, + 1.39 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.052, + 0.974, + 0.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.958, + 0.058 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.639 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.085, + 0.001, + 0.648, + 0.439 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.001, + 0.438, + 0.256 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 0.528 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.96, + 0.96 + ] + } + }, + "wt_peptide": "KFNPETDYL" + } + }, + "transcripts": [ + "ENST00000676748.1-ACO2-E/Q-477", + "ENST00000676792.1-ACO2-E/Q-455" + ], + "transcript_expr": [ + 0.591, + 0.729 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 747, + 725 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 1.3199999999999998 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3", + "Transcript Set 4" + ], + "transcript_counts": [ + 1, + 1, + 3, + 2 + ], + "peptide_counts": [ + 3, + 2, + 2, + 1 + ], + "set_expr": [ + 0.112, + 101.95, + 0.112, + 1.3199999999999998 + ], + "DNA VAF": 0.216, + "RNA VAF": 0.238, + "gene_expr": 119.616, + "best_peptide_mt": "KFNPQTDYL", + "best_peptide_wt": "KFNPETDYL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-46257698-46257699-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YSYGLLHIYG": { + "ic50s_MT": [ + "X", + "X", + "X", + 21091.654 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.255 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 22.53 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.902 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19275.011 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.418 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 33.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.456 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16621.0, + 28327.811, + 17316.93, + 6469.41, + "NA", + "NA", + 24866.381, + 34965.621 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12693.25, + 28700.18, + 15208.39, + 6128.721, + "NA", + "NA", + 23341.632, + 32642.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.202 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.7, + 17.0, + 18.0, + 6.7, + "NA", + "NA", + 59.2, + 73.81, + 9.51 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 18.0, + 16.0, + 5.9, + "NA", + "NA", + 50.718, + 66.92, + 12.836 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.246, + 0.986, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.055, + 0.977, + 0.02 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.902 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.456 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.017, + 0.007, + 0.138 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.005, + 0.005, + 0.034 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 62.745 + ] + } + }, + "wt_peptide": "YSYGLLHTYG" + } + }, + "transcripts": [ + "ENST00000253255.7-PKDREJ-T/I-1875" + ], + "transcript_expr": [ + 0.02 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2253 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.02 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.02 + ], + "DNA VAF": 0.27, + "RNA VAF": 0.0, + "gene_expr": 0.02, + "best_peptide_mt": "YSYGLLHIYG", + "best_peptide_wt": "YSYGLLHTYG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-50177151-50177152-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LAFTRLTSEL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4236.82 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.862 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.925 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.766 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 12.198 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11854.784 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 15.079 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.329 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.134 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5751.27, + 19383.17, + 1477.25, + 2722.37, + "NA", + "NA", + 2194.819, + 18097.619 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12716.62, + 35543.86, + 4576.12, + 10992.949, + "NA", + "NA", + 7546.462, + 27718.6 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.114 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.503 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 8.2, + 1.5, + 1.6, + "NA", + "NA", + 4.925, + 33.57, + 11.143 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 29.0, + 3.9, + 14.0, + "NA", + "NA", + 11.787, + 53.88, + 18.623 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.99, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.93, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 12.198 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.134 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.006, + 0.054, + 0.083 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.006, + 0.015, + 0.046 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.8, + 4.732 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 16.158 + ] + } + }, + "wt_peptide": "LASTRLTSEL" + } + }, + "transcripts": [ + "ENST00000395842.3-PANX2-S/F-147", + "ENST00000159647.9-PANX2-S/F-147" + ], + "transcript_expr": [ + 8.461, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 2.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 677, + 643 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 8.461 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 8.461 + ], + "DNA VAF": 0.996, + "RNA VAF": 1.0, + "gene_expr": 10.842, + "best_peptide_mt": "LAFTRLTSEL", + "best_peptide_wt": "LASTRLTSEL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr22-50243800-50243801-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GALVRSRTY": { + "ic50s_MT": [ + "X", + "X", + "X", + 3659.563 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.939 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.179 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.385 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.227 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3736.638 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.732 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.128 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.512 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11321.89, + 4336.22, + 14407.49, + 4062.646, + 291.615, + 511.175, + 489.73, + 3256.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9754.28, + 3454.35, + 11857.88, + 4018.926, + 128.177, + 347.192, + 267.674, + 4411.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.516 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.282 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 1.5, + 15.0, + 14.0, + 3.7, + 5.8, + 1.605, + 8.79, + 4.179 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 1.2, + 13.0, + 14.0, + 1.9, + 4.3, + 0.967, + 10.8, + 2.732 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.969, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.949, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.227 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.512 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.04, + 0.001, + 0.25, + 0.167 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.051, + 0.006, + 0.323, + 0.103 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 1.571 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.97, + 1.286 + ] + } + }, + "wt_peptide": "GALVHSRTY" + }, + "VRSRTYDM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3902.868 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.7 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 15.109 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 48.721 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21250.917 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 35.322 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 67.111 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9251.91, + 4198.95, + 1103.02, + 3606.785, + "NA", + "NA", + 11464.623, + 5.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24726.14, + 20688.84, + 4909.54, + 28485.481, + "NA", + "NA", + 21812.995, + 19.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.691 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.647 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 1.4, + 1.2, + 2.8, + "NA", + "NA", + 17.242, + 0.02, + 23.167 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 9.1, + 3.7, + 38.0, + "NA", + "NA", + 43.878, + 0.21, + 53.818 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 48.721 + ] + }, + "WT": { + "HLA-C*06:02": [ + 67.111 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.009, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.005, + 0.024 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 27.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.9, + 62.745 + ] + } + }, + "wt_peptide": "VHSRTYDM" + }, + "RSRTYDMDV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4782.029 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.181 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.565 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.418 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5216.21 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.022 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.889 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.844 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11633.08, + 6497.61, + 10246.39, + 3066.449, + 184.846, + 378.068, + 7181.837, + 150.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10034.21, + 8356.84, + 11294.36, + 3416.846, + 322.708, + 459.801, + 7015.575, + 174.46 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.896 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.799 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 2.3, + 9.7, + 8.7, + 2.6, + 4.5, + 11.282, + 1.21, + 7.862 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.8, + 3.0, + 12.0, + 11.0, + 4.0, + 5.3, + 11.094, + 1.35, + 6.745 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.966, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.073, + 0.986, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.418 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.844 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.02, + 0.122 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.017, + 0.057 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.5, + 11.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.5, + 14.277 + ] + } + }, + "wt_peptide": "HSRTYDMDV" + } + }, + "transcripts": [ + "ENST00000248846.10-TUBGCP6-H/R-220", + "ENST00000439308.6-TUBGCP6-H/R-220" + ], + "transcript_expr": [ + 13.021, + 1.175 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1819, + 1493 + ], + "transcript_count": 2, + "peptide_count": 3, + "total_expr": 14.196000000000002 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 3 + ], + "set_expr": [ + 14.196000000000002 + ], + "DNA VAF": 0.75, + "RNA VAF": 0.775, + "gene_expr": 24.241, + "best_peptide_mt": "GALVRSRTY", + "best_peptide_wt": "GALVHSRTY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-33053544-33053545-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GRNITDAFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1932.555 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.158 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.941 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.666 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12647.509 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 19.079 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.52 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.579 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.645 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2523.55, + 7208.11, + 7131.08, + 1534.27, + 1215.654, + 958.451, + 229.448, + 2330.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22292.28, + 34317.92, + 28640.0, + 6128.721, + 11770.909, + 11656.549, + 7697.89, + 13524.11 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.902 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.56, + 2.6, + 6.5, + 3.3, + 11.0, + 8.8, + 0.833, + 7.04, + 1.717 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.9, + 27.0, + 36.0, + 22.0, + 35.0, + 35.0, + 11.988, + 25.52, + 7.931 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.132, + 0.975, + 0.056 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.976, + 0.018 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.645 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.067, + 0.007, + 0.383, + 0.135 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.015, + 0.052 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 1.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 16.158 + ] + } + }, + "wt_peptide": "GSNITDAFL" + } + }, + "transcripts": [ + "ENST00000307363.10-GLB1-S/R-246", + "ENST00000307377.12-GLB1-S/R-115", + "ENST00000399402.7-GLB1-S/R-216" + ], + "transcript_expr": [ + 35.859, + 1.226, + 12.708 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 1.0, + 1.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 677, + 546, + 647 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 49.793 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 49.793 + ], + "DNA VAF": 0.314, + "RNA VAF": 0.253, + "gene_expr": 77.589, + "best_peptide_mt": "GRNITDAFL", + "best_peptide_wt": "GSNITDAFL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-38698510-38698511-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QSYFSPMLF": { + "ic50s_MT": [ + "X", + "X", + "X", + 2637.368 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.748 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.325 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3616.841 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.044 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.228 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.495 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2107.12, + 11679.23, + 6161.97, + 3167.617, + 1468.284, + 1843.19, + 1202.058, + 27952.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3426.4, + 14779.48, + 8297.38, + 3807.283, + 2337.814, + 2815.594, + 859.241, + 20755.81 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.996 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.075 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 4.3, + 5.6, + 9.2, + 13.0, + 15.0, + 3.196, + 54.46, + 1.583 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.79, + 5.6, + 7.8, + 13.0, + 17.0, + 18.0, + 2.487, + 38.63, + 1.826 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.979, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.988, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.325 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.495 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.078, + 0.015, + 0.336, + 0.532 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.066, + 0.008, + 0.228, + 0.287 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.69, + 1.243 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 1.676 + ] + } + }, + "wt_peptide": "QSYFSPTLF" + }, + "SYFSPMLF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4145.82 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.461 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.651 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.386 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.361 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4463.668 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.928 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.672 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.892 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.407 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4958.12, + 19188.07, + 874.09, + 2496.636, + "NA", + "NA", + 3333.52, + 7840.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6430.54, + 19315.34, + 819.15, + 2812.186, + "NA", + "NA", + 1560.89, + 6115.15 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.266 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.27 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 8.1, + 0.88, + 1.4, + "NA", + "NA", + 6.502, + 16.28, + 2.651 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 8.2, + 0.83, + 1.8, + "NA", + "NA", + 3.852, + 13.52, + 2.672 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + "NA", + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.046, + "NA", + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.361 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.407 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.11, + 0.01, + 0.062, + 0.235 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.09, + 0.008, + 0.089, + 0.138 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 4.271 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.6, + 3.185 + ] + } + }, + "wt_peptide": "SYFSPTLF" + }, + "SYFSPMLFRV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4613.915 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.242 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.194 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.692 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3165.372 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.793 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.925 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.755 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.414 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3019.73, + 27056.15, + 1262.76, + 2842.778, + "NA", + "NA", + 8417.616, + 6208.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1893.8, + 25486.69, + 855.38, + 2781.922, + "NA", + "NA", + 3548.822, + 4230.19 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.322 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.68, + 16.0, + 1.4, + 1.8, + "NA", + "NA", + 12.886, + 13.67, + 4.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.42, + 14.0, + 0.94, + 1.7, + "NA", + "NA", + 6.798, + 10.48, + 2.925 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.101, + 0.987, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.094, + 0.985, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.692 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.414 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.002, + 0.053, + 0.444 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.06, + 0.003, + 0.115, + 0.445 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 4.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.85, + 2.661 + ] + } + }, + "wt_peptide": "SYFSPTLFRV" + } + }, + "transcripts": [ + "ENST00000449082.3-SCN10A-T/M-1570" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1956 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "QSYFSPMLF": { + "ic50s_MT": [ + "X", + "X", + "X", + 2637.368 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.748 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.325 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3616.841 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.044 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.228 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.495 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2107.12, + 11679.23, + 6161.97, + 3167.617, + 1468.284, + 1843.19, + 1202.058, + 27952.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3426.4, + 14779.48, + 8297.38, + 3807.283, + 2337.814, + 2815.594, + 859.241, + 20755.81 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.996 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.075 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 4.3, + 5.6, + 9.2, + 13.0, + 15.0, + 3.196, + 54.46, + 1.583 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.79, + 5.6, + 7.8, + 13.0, + 17.0, + 18.0, + 2.487, + 38.63, + 1.826 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.979, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.988, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.325 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.495 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.078, + 0.015, + 0.336, + 0.532 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.066, + 0.008, + 0.228, + 0.287 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.69, + 1.243 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 1.676 + ] + } + }, + "wt_peptide": "QSYFSPTLF" + }, + "FSPMLFRVI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1975.888 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.315 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.551 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.066 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1628.018 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.222 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.032 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 716.68, + 5707.01, + 4335.14, + 2443.191, + 485.076, + 1508.586, + 128.251, + 3892.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 512.18, + 4851.82, + 3435.38, + 2469.769, + 402.541, + 786.267, + 70.461, + 10780.98 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.296 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.072 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.17, + 2.0, + 4.2, + 6.4, + 5.6, + 13.0, + 0.448, + 9.92, + 0.266 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.11, + 1.7, + 3.4, + 6.5, + 4.8, + 7.8, + 0.155, + 20.98, + 0.135 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.141, + 0.949, + 0.173 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.254, + 0.98, + 0.207 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.066 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.085, + 0.624, + 0.68, + 0.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.186, + 0.663, + 0.886, + 0.524 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 0.472 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.3, + 0.145 + ] + } + }, + "wt_peptide": "FSPTLFRVI" + }, + "SYFSPMLF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4145.82 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.461 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.651 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.386 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.361 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4463.668 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.928 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.672 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.892 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.407 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4958.12, + 19188.07, + 874.09, + 2496.636, + "NA", + "NA", + 3333.52, + 7840.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6430.54, + 19315.34, + 819.15, + 2812.186, + "NA", + "NA", + 1560.89, + 6115.15 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.266 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.27 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 8.1, + 0.88, + 1.4, + "NA", + "NA", + 6.502, + 16.28, + 2.651 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 8.2, + 0.83, + 1.8, + "NA", + "NA", + 3.852, + 13.52, + 2.672 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + "NA", + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.046, + "NA", + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.361 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.407 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.11, + 0.01, + 0.062, + 0.235 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.09, + 0.008, + 0.089, + 0.138 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.5, + 4.271 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.6, + 3.185 + ] + } + }, + "wt_peptide": "SYFSPTLF" + }, + "SYFSPMLFRV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4613.915 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.242 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.194 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.692 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3165.372 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.793 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.925 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.755 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.414 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3019.73, + 27056.15, + 1262.76, + 2842.778, + "NA", + "NA", + 8417.616, + 6208.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1893.8, + 25486.69, + 855.38, + 2781.922, + "NA", + "NA", + 3548.822, + 4230.19 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.322 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.68, + 16.0, + 1.4, + 1.8, + "NA", + "NA", + 12.886, + 13.67, + 4.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.42, + 14.0, + 0.94, + 1.7, + "NA", + "NA", + 6.798, + 10.48, + 2.925 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.101, + 0.987, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.094, + 0.985, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.692 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.414 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.002, + 0.053, + 0.444 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.06, + 0.003, + 0.115, + 0.445 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 4.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.85, + 2.661 + ] + } + }, + "wt_peptide": "SYFSPTLFRV" + } + }, + "transcripts": [ + "ENST00000643924.1-SCN10A-T/M-1569" + ], + "transcript_expr": [ + 0.004 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1955 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 0.004 + }, + "Transcript Set 3": { + "peptides": { + "QSYFSPMLF": { + "ic50s_MT": [ + "X", + "X", + "X", + 2637.368 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.748 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.967 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.325 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3616.841 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.044 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.228 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.495 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2107.12, + 11679.23, + 6161.97, + 3167.617, + 1468.284, + 1843.19, + 1202.058, + 27952.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3426.4, + 14779.48, + 8297.38, + 3807.283, + 2337.814, + 2815.594, + 859.241, + 20755.81 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.996 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.075 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 4.3, + 5.6, + 9.2, + 13.0, + 15.0, + 3.196, + 54.46, + 1.583 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.79, + 5.6, + 7.8, + 13.0, + 17.0, + 18.0, + 2.487, + 38.63, + 1.826 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.979, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.988, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.325 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.495 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.078, + 0.015, + 0.336, + 0.532 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.066, + 0.008, + 0.228, + 0.287 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.69, + 1.243 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 1.676 + ] + } + }, + "wt_peptide": "QSYFSPTLF" + }, + "FSPMLFRVI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1975.888 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.315 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.551 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.066 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1628.018 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.222 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.032 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 716.68, + 5707.01, + 4335.14, + 2443.191, + 485.076, + 1508.586, + 128.251, + 3892.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + 512.18, + 4851.82, + 3435.38, + 2469.769, + 402.541, + 786.267, + 70.461, + 10780.98 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.296 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.072 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.17, + 2.0, + 4.2, + 6.4, + 5.6, + 13.0, + 0.448, + 9.92, + 0.266 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.11, + 1.7, + 3.4, + 6.5, + 4.8, + 7.8, + 0.155, + 20.98, + 0.135 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.141, + 0.949, + 0.173 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.254, + 0.98, + 0.207 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.066 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.085, + 0.624, + 0.68, + 0.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.186, + 0.663, + 0.886, + 0.524 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 0.472 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.3, + 0.145 + ] + } + }, + "wt_peptide": "FSPTLFRVI" + }, + "MLFRVIRLA": { + "ic50s_MT": [ + "X", + "X", + "X", + 2368.709 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.7 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 15.459 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.666 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5059.903 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.75 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.409 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.653 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4952.38, + 3416.7, + 7860.43, + 1170.651, + 1320.718, + 564.378, + 13803.222, + 17.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7410.8, + 8054.31, + 10933.64, + 1824.253, + 2709.006, + 1350.735, + 15361.254, + 24.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.089 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 1.2, + 7.4, + 2.1, + 12.0, + 6.2, + 21.207, + 0.18, + 1.91 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 2.9, + 12.0, + 4.3, + 18.0, + 12.0, + 24.33, + 0.27, + 1.869 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.087, + 0.996, + 0.056 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.09, + 0.995, + 0.057 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.653 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.006, + 0.008, + 0.05 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.004, + 0.008, + 0.071 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 27.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 27.617 + ] + } + }, + "wt_peptide": "TLFRVIRLA" + }, + "SYFSPMLFRV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4613.915 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.967 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.242 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.194 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.692 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3165.372 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.793 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.925 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.755 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.414 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3019.73, + 27056.15, + 1262.76, + 2842.778, + "NA", + "NA", + 8417.616, + 6208.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1893.8, + 25486.69, + 855.38, + 2781.922, + "NA", + "NA", + 3548.822, + 4230.19 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.524 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.322 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.68, + 16.0, + 1.4, + 1.8, + "NA", + "NA", + 12.886, + 13.67, + 4.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.42, + 14.0, + 0.94, + 1.7, + "NA", + "NA", + 6.798, + 10.48, + 2.925 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.101, + 0.987, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.094, + 0.985, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.692 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.414 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + 0.002, + 0.053, + 0.444 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.06, + 0.003, + 0.115, + 0.445 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 4.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.85, + 2.661 + ] + } + }, + "wt_peptide": "SYFSPTLFRV" + } + }, + "transcripts": [ + "ENST00000655275.1-SCN10A-T/M-1578" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1964 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 3, + 4, + 4 + ], + "set_expr": [ + 0.0, + 0.004, + 0.0 + ], + "DNA VAF": 0.273, + "RNA VAF": 0.0, + "gene_expr": 0.004, + "best_peptide_mt": "QSYFSPMLF", + "best_peptide_wt": "QSYFSPTLF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-39188114-39188115-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TFKNHFETL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2106.447 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.9 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.95 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.213 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.689 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8032.062 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.78 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.496 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.855 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2614.09, + 4068.94, + 2264.98, + 5382.477, + 765.262, + 1947.915, + 63.222, + 575.57 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5398.57, + 22030.92, + 8252.61, + 8032.377, + 8031.747, + 16810.089, + 100.157, + 1684.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.356 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.467 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.58, + 1.4, + 2.4, + 19.0, + 7.7, + 15.0, + 0.118, + 2.95, + 3.114 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 11.0, + 7.8, + 29.0, + 30.0, + 41.0, + 0.317, + 5.73, + 3.831 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.99, + 0.055 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.992, + 0.047 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.689 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.855 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.178, + 0.004, + 0.911, + 0.572 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.084, + 0.004, + 0.753, + 0.358 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.32, + 0.105 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.64, + 0.353 + ] + } + }, + "wt_peptide": "TFKNLFETL" + }, + "FKNHFETL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4690.33 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.986 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.604 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.055 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.872 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7735.977 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.763 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.405 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.057 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6843.17, + 8131.45, + 2537.49, + 7775.837, + "NA", + "NA", + 982.761, + 11.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10597.96, + 25145.13, + 5712.5, + 9759.454, + "NA", + "NA", + 901.24, + 48.21 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.256 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.325 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 2.9, + 2.1, + 8.1, + "NA", + "NA", + 2.772, + 0.1, + 2.604 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 14.0, + 4.5, + 12.0, + "NA", + "NA", + 2.591, + 0.5, + 2.936 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.062, + "NA", + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + "NA", + 0.023 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.872 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.057 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.064, + 0.04, + 0.315, + 0.451 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032, + 0.017, + 0.288, + 0.39 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.8, + 1.311 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 1.411 + ] + } + }, + "wt_peptide": "FKNLFETL" + } + }, + "transcripts": [ + "ENST00000396251.1-XIRP1-L/H-444" + ], + "transcript_expr": [ + 0.042 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1121 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.042 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.042 + ], + "DNA VAF": 0.661, + "RNA VAF": 0.0, + "gene_expr": 0.042, + "best_peptide_mt": "TFKNHFETL", + "best_peptide_wt": "TFKNLFETL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-44242057-44242058-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QRPPPLGPTTA": { + "ic50s_MT": [ + "X", + "X", + "X", + 14924.325 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.365 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.421 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.23 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9977.635 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.009 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.227 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.401 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20801.061, + 41443.988, + 9047.59, + 4989.872, + "NA", + "NA", + 991.191, + 30555.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13990.11, + 39090.24, + 5965.16, + 3236.91, + "NA", + "NA", + 386.196, + 28082.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.396 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.434 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.7, + 49.0, + 8.2, + 4.5, + "NA", + "NA", + 2.772, + 61.12, + 3.374 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.4, + 40.0, + 5.2, + 2.2, + "NA", + "NA", + 1.313, + 54.78, + 3.618 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + "NA", + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.23 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.401 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.149, + 0.179 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.028, + 0.003, + 0.441, + 0.346 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 2.242 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 0.955 + ] + } + }, + "wt_peptide": "RRPPPLGPTTA" + } + }, + "transcripts": [ + "ENST00000309765.4-TOPAZ1-R/Q-2" + ], + "transcript_expr": [ + 0.005 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1692 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.005 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.005 + ], + "DNA VAF": 0.307, + "RNA VAF": 0.0, + "gene_expr": 0.005, + "best_peptide_mt": "QRPPPLGPTTA", + "best_peptide_wt": "RRPPPLGPTTA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-52395054-52395055-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "PRFIELQTA": { + "ic50s_MT": [ + "X", + "X", + "X", + 2770.125 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.839 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.903 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.443 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6851.897 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.656 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.745 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.74 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.568 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21522.23, + 4334.53, + 16854.801, + 1028.11, + 373.087, + 462.988, + 10668.337, + 1205.72 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21861.14, + 5552.84, + 13429.05, + 1183.386, + 308.894, + 422.25, + 8150.953, + 18424.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.765 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.701 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.2, + 1.5, + 18.0, + 1.8, + 4.4, + 5.3, + 15.984, + 4.66, + 6.379 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.5, + 2.0, + 14.0, + 2.1, + 3.8, + 5.0, + 12.537, + 34.17, + 5.745 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.075, + 0.982, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.955, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.443 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.568 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.014, + 0.118 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.004, + 0.039, + 0.344 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.5, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 6.479 + ] + } + }, + "wt_peptide": "PRFIEPQTA" + } + }, + "transcripts": [ + "ENST00000420323.7-DNAH1-P/L-3655" + ], + "transcript_expr": [ + 0.873 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 4265 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.873 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.873 + ], + "DNA VAF": 0.263, + "RNA VAF": 0.55, + "gene_expr": 3.0, + "best_peptide_mt": "PRFIELQTA", + "best_peptide_wt": "PRFIEPQTA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-52517959-52517960-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TAPTVGDG": { + "ic50s_MT": [ + "X", + "X", + "X", + 38791.734 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 68.789 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 76.28 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 56.112 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 71.578 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 37488.99 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 71.542 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 70.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 74.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 73.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 43829.801, + 45923.621, + 41825.102, + 24481.498, + "NA", + "NA", + 19862.24, + 35758.371 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44571.06, + 45193.6, + 40053.56, + 20149.14, + "NA", + "NA", + 24692.17, + 34924.42 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.936 + ] + }, + "WT": { + "HLA-C*06:02": [ + -4.065 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 77.0, + 80.0, + 79.0, + 33.0, + "NA", + "NA", + 36.113, + 76.28, + 63.981 + ] + }, + "WT": { + "HLA-C*06:02": [ + 82.0, + 74.0, + 70.0, + 27.0, + "NA", + "NA", + 57.658, + 73.7, + 68.403 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 71.578 + ] + }, + "WT": { + "HLA-C*06:02": [ + 73.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 66.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 86.0, + 62.745 + ] + } + }, + "wt_peptide": "TAHTVGDG" + } + }, + "transcripts": [ + "ENST00000321725.10-STAB1-H/P-1573" + ], + "transcript_expr": [ + 0.012 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2570 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.012 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.012 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.09, + "best_peptide_mt": "TAPTVGDG", + "best_peptide_wt": "TAHTVGDG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-56617278-56617279-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TQDKGASLQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 19218.256 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 22.926 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 21.153 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.181 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18459.341 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 24.536 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 26.072 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 23.309 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.543 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 40332.309, + 33486.762, + 39196.129, + 4382.296, + 4353.214, + 3369.535, + 7891.37, + 30545.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41007.75, + 34772.06, + 40708.92, + 3807.283, + 4353.214, + 2278.085, + 8194.502, + 28724.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.679 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.798 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 54.0, + 25.0, + 65.0, + 15.0, + 23.0, + 20.0, + 12.205, + 61.1, + 22.851 + ] + }, + "WT": { + "HLA-C*06:02": [ + 58.0, + 28.0, + 72.0, + 13.0, + 23.0, + 16.0, + 12.649, + 56.39, + 26.072 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.986, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.991, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.181 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.543 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.014, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.013, + 0.027 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 25.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.0, + 18.618 + ] + } + }, + "wt_peptide": "TQDKGASLE" + } + }, + "transcripts": [ + "ENST00000394672.8-CCDC66-E/Q-671" + ], + "transcript_expr": [ + 5.571 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 948 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 5.571 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 5.571 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 24.974, + "best_peptide_mt": "TQDKGASLQ", + "best_peptide_wt": "TQDKGASLE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-58210851-58210852-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSIHSAVAM": { + "ic50s_MT": [ + "X", + "X", + "X", + 10596.275 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.499 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.61 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.039 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.699 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7443.254 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.004 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.756 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.607 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9957.63, + 17819.68, + 14722.66, + 5500.221, + 11743.837, + 11234.92, + 1005.907, + 2630.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7308.24, + 14355.21, + 11355.63, + 4625.904, + 9700.855, + 7578.269, + 801.111, + 5764.16 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.444 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.545 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 7.3, + 16.0, + 19.0, + 35.0, + 35.0, + 2.819, + 7.61, + 3.683 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 5.4, + 12.0, + 16.0, + 33.0, + 29.0, + 2.368, + 12.96, + 4.404 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.997, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.995, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.699 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.607 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.135, + 0.152 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.001, + 0.152, + 0.128 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.7, + 2.379 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 2.212 + ] + } + }, + "wt_peptide": "LSIHSALAM" + } + }, + "transcripts": [ + "ENST00000394549.7-DNASE1L3-L/V-19" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 305 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.181, + "best_peptide_mt": "LSIHSAVAM", + "best_peptide_wt": "LSIHSALAM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-121697676-121697677-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SRAEEGKKEQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2237.928 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.486 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.059 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.486 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.203 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2158.783 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.271 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.102 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.1 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.342 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13235.46, + 23179.471, + 681.52, + 2936.567, + "NA", + "NA", + 669.728, + 1539.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12753.0, + 22454.22, + 649.13, + 3167.617, + "NA", + "NA", + 1149.948, + 736.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.688 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.403 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 12.0, + 0.73, + 1.9, + "NA", + "NA", + 2.059, + 5.43, + 0.759 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 12.0, + 0.7, + 2.1, + "NA", + "NA", + 3.102, + 3.44, + 0.358 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + "NA", + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.203 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.342 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.004, + 0.121, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.002, + 0.076, + 0.007 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 2.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 3.599 + ] + } + }, + "wt_peptide": "SRAEEAKKEQV" + }, + "SRAEEGKKE": { + "ic50s_MT": [ + "X", + "X", + "X", + 2782.261 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.526 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.074 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.68 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2769.903 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.209 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 7.685 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.476 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28351.73, + 12573.38, + 22330.41, + 2054.82, + 304.656, + 127.812, + 2741.673, + 2822.85 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26735.74, + 10417.87, + 22451.54, + 2365.16, + 407.202, + 159.43, + 3174.647, + 875.16 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.41 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.984 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 4.7, + 25.0, + 5.1, + 3.8, + 1.9, + 5.703, + 7.98, + 3.463 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 3.8, + 25.0, + 6.1, + 4.8, + 2.3, + 6.317, + 3.82, + 1.546 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.905, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.901, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.68 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.476 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.033, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.029, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.8, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.1, + 8.269 + ] + } + }, + "wt_peptide": "SRAEEAKKE" + } + }, + "transcripts": [ + "ENST00000340645.9-GOLGB1-A/G-944" + ], + "transcript_expr": [ + 6.784 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3259 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 6.784 + }, + "Transcript Set 2": { + "peptides": { + "SRAEEGKKE": { + "ic50s_MT": [ + "X", + "X", + "X", + 2782.261 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.526 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.074 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.68 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2769.903 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.209 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 7.685 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.476 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28351.73, + 12573.38, + 22330.41, + 2054.82, + 304.656, + 127.812, + 2741.673, + 2822.85 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26735.74, + 10417.87, + 22451.54, + 2365.16, + 407.202, + 159.43, + 3174.647, + 875.16 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.41 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.984 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 4.7, + 25.0, + 5.1, + 3.8, + 1.9, + 5.703, + 7.98, + 3.463 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 3.8, + 25.0, + 6.1, + 4.8, + 2.3, + 6.317, + 3.82, + 1.546 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.905, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.901, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.68 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.476 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.033, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.029, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.8, + 7.348 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.1, + 8.269 + ] + } + }, + "wt_peptide": "SRAEEAKKE" + } + }, + "transcripts": [ + "ENST00000393667.7-GOLGB1-A/G-949" + ], + "transcript_expr": [ + 7.783 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3269 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.783 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 6.784, + 7.783 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.967, + "gene_expr": 45.429, + "best_peptide_mt": "SRAEEGKKEQV", + "best_peptide_wt": "SRAEEAKKEQV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-122927970-122927971-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RTIEKMNGV": { + "ic50s_MT": [ + "X", + "X", + "X", + 3717.845 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.963 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.655 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.527 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2279.199 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.582 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.219 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.864 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2712.37, + 11660.8, + 3361.84, + 4478.161, + 3637.559, + 3798.132, + 411.738, + 12276.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1587.15, + 8775.32, + 2216.49, + 3380.076, + 1823.098, + 2341.909, + 128.262, + 8059.9 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.852 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.328 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.61, + 4.3, + 3.4, + 16.0, + 21.0, + 21.0, + 1.386, + 23.44, + 1.139 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.35, + 3.2, + 2.3, + 10.0, + 14.0, + 17.0, + 0.448, + 16.61, + 0.288 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.048, + 0.834, + 0.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.119, + 0.969, + 0.046 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.527 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.864 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.079, + 0.002, + 0.599, + 0.544 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.165, + 0.015, + 0.916, + 0.785 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.69, + 0.619 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.34, + 0.098 + ] + } + }, + "wt_peptide": "RTIEKINGV" + } + }, + "transcripts": [ + "ENST00000357599.8-SEMA5B-I/M-223", + "ENST00000451055.6-SEMA5B-I/M-277", + "ENST00000616742.4-SEMA5B-I/M-223", + "ENST00000650207.1-SEMA5B-I/M-189", + "ENST00000648990.1-SEMA5B-I/M-165" + ], + "transcript_expr": [ + 0.0, + 0.06, + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + true, + false, + false, + false, + false + ], + "canonical": [ + true, + false, + false, + false, + false + ], + "tsl": [ + 1.0, + 2.0, + 5.0, + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 1151, + 1205, + 1151, + 1117, + 1092 + ], + "transcript_count": 5, + "peptide_count": 1, + "total_expr": 0.06 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 5 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.06 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.169, + "best_peptide_mt": "RTIEKMNGV", + "best_peptide_wt": "RTIEKINGV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-171138369-171138370-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RRAEHEQEYKS": { + "ic50s_MT": [ + "X", + "X", + "X", + 8498.657 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.293 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.579 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 27.922 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10134.145 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.955 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.11 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.289 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.317 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 32474.471, + 8238.69, + 10699.58, + 8758.623, + "NA", + "NA", + 7355.346, + 900.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30094.03, + 8281.42, + 11986.87, + 41151.772, + "NA", + "NA", + 1504.359, + 2892.16 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.139 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.727 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 27.0, + 2.9, + 9.7, + 9.5, + "NA", + "NA", + 11.585, + 3.89, + 11.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 3.0, + 12.0, + 50.0, + "NA", + "NA", + 3.765, + 8.11, + 5.983 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 27.922 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.317 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.008, + 0.014, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.006, + 0.107, + 0.188 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 16.158 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.8, + 2.778 + ] + } + }, + "wt_peptide": "RRAEHEQEYKR" + } + }, + "transcripts": [ + "ENST00000357327.9-TNIK-R/S-448" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1331 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.27, + "RNA VAF": 0.167, + "gene_expr": 3.976, + "best_peptide_mt": "RRAEHEQEYKS", + "best_peptide_wt": "RRAEHEQEYKR", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-172353066-172353067-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLSETTYRI": { + "ic50s_MT": [ + "X", + "X", + "X", + 8231.15 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.855 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.202 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.449 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10805.217 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.676 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.161 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.672 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8209.69, + 14971.65, + 8252.61, + 15710.146, + 5091.081, + 10412.859, + 5158.044, + 1818.41 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6073.73, + 17476.74, + 9812.39, + 12249.092, + 11798.044, + 25443.099, + 1053.005, + 2032.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.139 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.903 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 5.7, + 7.8, + 50.0, + 24.0, + 34.0, + 8.846, + 6.01, + 2.038 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 7.1, + 9.3, + 41.0, + 35.0, + 47.0, + 2.911, + 6.44, + 1.296 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.963, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.983, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.449 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.672 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.001, + 0.164, + 0.664 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.013, + 0.597, + 0.799 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 2.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 0.621 + ] + } + }, + "wt_peptide": "LLPETTYRI" + } + }, + "transcripts": [ + "ENST00000415807.7-FNDC3B-P/S-927" + ], + "transcript_expr": [ + 16.885 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1204 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 16.885 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 16.885 + ], + "DNA VAF": 0.356, + "RNA VAF": 0.317, + "gene_expr": 92.076, + "best_peptide_mt": "LLSETTYRI", + "best_peptide_wt": "LLPETTYRI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-183179682-183179683-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SALSLAGFF": { + "ic50s_MT": [ + "X", + "X", + "X", + 16935.111 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 12.686 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 16.48 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.396 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.846 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11566.881 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.925 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.996 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.034 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9551.67, + 27088.65, + 20368.33, + 13501.893, + 56339.113, + 22520.084, + 2579.182, + 7971.92 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9731.2, + 24424.08, + 17038.15, + 9865.623, + 13268.139, + 8252.205, + 1571.241, + 15750.99 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.973 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 16.0, + 22.0, + 44.0, + 60.0, + 45.0, + 5.5, + 16.48, + 9.371 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 13.0, + 18.0, + 34.0, + 37.0, + 30.0, + 3.883, + 29.34, + 8.849 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.986, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.98, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.846 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.034 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.001, + 0.037, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.06, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 6.793 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 4.392 + ] + } + }, + "wt_peptide": "SALSLAGLF" + } + }, + "transcripts": [ + "ENST00000328913.8-MCF2L2-L/F-1039" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1114 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.377, + "RNA VAF": 0.0, + "gene_expr": 0.407, + "best_peptide_mt": "SALSLAGFF", + "best_peptide_wt": "SALSLAGLF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-184239802-184239803-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ELAPPAVPPQV": { + "ic50s_MT": [ + "X", + "X", + "X", + 24316.744 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.08 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 11.83 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.98 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 37182.985 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 37.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 52.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 26.596 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.348 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27129.42, + 42771.488, + 20813.9, + 50000.0, + "NA", + "NA", + 8445.929, + 21504.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38169.51, + 46879.5, + 35367.39, + 50000.0, + "NA", + "NA", + 13735.656, + 36196.46 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.337 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.065 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 57.0, + 24.0, + 57.0, + "NA", + "NA", + 12.886, + 40.12, + 2.994 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44.0, + 88.0, + 52.0, + 57.0, + "NA", + "NA", + 20.92, + 77.67, + 10.199 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.98 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.348 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.016, + 0.096 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.01, + 0.105 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.5, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31.0, + 22.192 + ] + } + }, + "wt_peptide": "ELAPPAVPPQA" + } + }, + "transcripts": [ + "ENST00000691901.1-VWA5B2-A/V-836" + ], + "transcript_expr": [ + 0.007 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1242 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.007 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.007 + ], + "DNA VAF": 0.429, + "RNA VAF": 1.0, + "gene_expr": 0.083, + "best_peptide_mt": "ELAPPAVPPQV", + "best_peptide_wt": "ELAPPAVPPQA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr3-186164997-186164998-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSDQLLKVV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4161.532 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.289 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.68 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2990.116 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.677 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.471 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.055 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17708.961, + 18354.08, + 16228.45, + 1158.053, + 452.699, + 523.082, + 558.027, + 7165.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22462.48, + 21520.13, + 17791.74, + 1407.051, + 335.591, + 842.5, + 876.519, + 4573.18 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.981 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.648 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.4, + 7.6, + 17.0, + 2.1, + 5.3, + 5.8, + 1.785, + 15.24, + 1.536 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 9.7, + 19.0, + 2.8, + 4.1, + 8.1, + 2.53, + 11.06, + 5.255 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.984, + 0.055 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.981, + 0.023 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.68 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.055 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.194, + 0.112 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.109, + 0.046 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.7, + 1.877 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.2, + 2.741 + ] + } + }, + "wt_peptide": "LSDQLLEVV" + } + }, + "transcripts": [ + "ENST00000344484.8-DGKG-E/K-681", + "ENST00000382164.8-DGKG-E/K-667" + ], + "transcript_expr": [ + 0.022, + 0.0 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 766, + 752 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.022 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.022 + ], + "DNA VAF": 0.518, + "RNA VAF": 1.0, + "gene_expr": 0.612, + "best_peptide_mt": "LSDQLLKVV", + "best_peptide_wt": "LSDQLLEVV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-373601-373602-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VLNEHKKIY": { + "ic50s_MT": [ + "X", + "X", + "X", + 2945.431 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.707 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.996 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.835 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8597.267 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.394 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.887 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 10.479 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.026 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11002.47, + 2618.74, + 3997.24, + 3272.123, + 140.867, + 147.764, + 385.074, + 7305.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27592.43, + 13560.16, + 15208.39, + 9346.083, + 305.358, + 969.55, + 7644.91, + 7848.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.618 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 0.84, + 3.9, + 9.6, + 2.1, + 2.2, + 1.313, + 15.48, + 0.657 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 5.1, + 16.0, + 32.0, + 3.8, + 8.9, + 11.887, + 16.3, + 4.977 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + 0.968, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.973, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.835 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.026 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.051, + 0.007, + 0.414, + 0.315 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.0, + 0.014, + 0.035 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.97, + 1.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 16.158 + ] + } + }, + "wt_peptide": "VLNEHKKIH" + } + }, + "transcripts": [ + "ENST00000240499.8-ZNF141-H/Y-389" + ], + "transcript_expr": [ + 0.907 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 474 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.907 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.907 + ], + "DNA VAF": 0.917, + "RNA VAF": 0.821, + "gene_expr": 2.222, + "best_peptide_mt": "VLNEHKKIY", + "best_peptide_wt": "VLNEHKKIH", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-5988666-5988667-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QGKAKLHAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 16857.934 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.991 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.701 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 19415.822 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 9.45 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.713 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.184 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15188.66, + 23693.461, + 23699.6, + 7054.341, + 18527.209, + 13352.728, + 624.799, + 30985.711 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15018.87, + 25477.04, + 24481.5, + 7131.082, + 23812.775, + 14078.941, + 1231.962, + 32198.3 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.814 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.036 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.0, + 13.0, + 27.0, + 25.0, + 42.0, + 37.0, + 1.959, + 62.31, + 1.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.9, + 14.0, + 29.0, + 25.0, + 46.0, + 38.0, + 3.272, + 65.66, + 1.708 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.956, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.835, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.701 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.184 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.001, + 0.145, + 0.043 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.0, + 0.078, + 0.032 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 2.282 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 3.527 + ] + } + }, + "wt_peptide": "QGKAKMHAL" + } + }, + "transcripts": [ + "ENST00000531445.3-C4orf50-M/L-1127" + ], + "transcript_expr": [ + 0.006 + ], + "mane_select": [ + false + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1508 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.006 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.006 + ], + "DNA VAF": 0.946, + "RNA VAF": 0.0, + "gene_expr": 0.025, + "best_peptide_mt": "QGKAKLHAL", + "best_peptide_wt": "QGKAKMHAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-40808808-40808809-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TQHLCCRWV": { + "ic50s_MT": [ + "X", + "X", + "X", + 5833.522 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.8 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.859 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.987 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3314.57 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.3 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.878 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.206 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "5,6", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7146.76, + 7252.23, + 6399.79, + 5267.254, + 502.123, + 411.69, + 7760.037, + 3252.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3597.86, + 3031.28, + 4288.48, + 4625.904, + 240.885, + 250.94, + 4309.021, + 2059.12 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.585 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 2.6, + 5.9, + 18.0, + 5.7, + 4.8, + 11.988, + 8.78, + 1.653 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.83, + 0.94, + 4.1, + 16.0, + 3.2, + 3.4, + 7.768, + 6.49, + 0.583 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.959, + 0.023 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.09, + 0.984, + 0.112 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.987 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.206 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.012, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.016, + 0.023, + 0.011 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.1, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 10.656 + ] + } + }, + "wt_peptide": "TQHLYCRWV" + } + }, + "transcripts": [ + "ENST00000381782.7-NSUN7-Y/C-676" + ], + "transcript_expr": [ + 0.063 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 718 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.063 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.063 + ], + "DNA VAF": 0.471, + "RNA VAF": 0.333, + "gene_expr": 0.405, + "best_peptide_mt": "TQHLCCRWV", + "best_peptide_wt": "TQHLYCRWV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-48420360-48420361-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GTTAMGSGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 20704.131 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 22.473 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 38.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.079 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.367 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17617.499 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 20.703 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.309 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.407 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 24695.65, + 38612.711, + 24087.381, + 15541.082, + 15163.868, + 17320.883, + 7170.545, + 36456.91 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21611.61, + 35077.0, + 20149.14, + 14564.226, + 13608.492, + 15085.857, + 9071.998, + 34598.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.416 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.389 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 14.0, + 38.0, + 28.0, + 49.0, + 39.0, + 41.0, + 11.282, + 78.47, + 16.947 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.3, + 28.0, + 22.0, + 47.0, + 38.0, + 39.0, + 13.743, + 72.69, + 16.425 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.985, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.976, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.367 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.407 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.014, + 0.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.013, + 0.052 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 16.158 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.0, + 18.618 + ] + } + }, + "wt_peptide": "GTTAMRSGL" + } + }, + "transcripts": [ + "ENST00000264313.11-SLAIN2-R/G-533" + ], + "transcript_expr": [ + 4.169 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 581 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 4.169 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 4.169 + ], + "DNA VAF": 0.29, + "RNA VAF": 0.312, + "gene_expr": 58.28, + "best_peptide_mt": "GTTAMGSGL", + "best_peptide_wt": "GTTAMRSGL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-103145955-103145956-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TLQESHDEM": { + "ic50s_MT": [ + "X", + "X", + "X", + 9564.146 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.177 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.927 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 13.553 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11675.73 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.037 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.996 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.374 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20960.57, + 15292.21, + 13070.67, + 11355.627, + 4762.226, + 7772.666, + 2094.562, + 1530.43 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22039.73, + 14386.46, + 14023.0, + 9146.011, + 9328.461, + 16239.401, + 2226.254, + 975.53 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.364 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.423 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.8, + 5.9, + 14.0, + 38.0, + 24.0, + 29.0, + 4.78, + 5.41, + 15.942 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.7, + 5.5, + 15.0, + 32.0, + 32.0, + 40.0, + 4.962, + 4.09, + 17.082 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.903, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.852, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 13.553 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.374 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.046, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.06, + 0.115 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.3, + 5.555 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.6, + 4.392 + ] + } + }, + "wt_peptide": "RLQESHDEM" + } + }, + "transcripts": [ + "ENST00000265148.9-CENPE-R/T-1429" + ], + "transcript_expr": [ + 8.107 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2701 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 8.107 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 8.107 + ], + "DNA VAF": 0.239, + "RNA VAF": 0.242, + "gene_expr": 29.958, + "best_peptide_mt": "TLQESHDEM", + "best_peptide_wt": "RLQESHDEM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-108650681-108650682-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LYRVPLLVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2500.65 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.527 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.94 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.964 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.62 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5566.561 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.626 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.03 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.465 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5427.86, + 6412.06, + 5238.84, + 3454.017, + 763.502, + 1547.284, + 361.841, + 918.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6354.6, + 11479.41, + 7247.76, + 4778.521, + 1193.466, + 3080.137, + 467.545, + 9638.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.287 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.627 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 2.3, + 5.0, + 12.0, + 7.6, + 13.0, + 1.247, + 3.94, + 2.753 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 4.2, + 6.6, + 16.0, + 10.0, + 19.0, + 1.549, + 19.11, + 5.052 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.994, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065, + 0.993, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.465 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.057, + 0.022, + 0.404, + 0.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.008, + 0.439, + 0.397 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 1.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 0.96 + ] + } + }, + "wt_peptide": "LYRVPFLVL" + }, + "YRVPLLVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 282.169 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.232 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.23 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.142 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.643 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 272.915 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.267 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.283 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.086 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.304 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 468.29, + 2148.35, + 69.13, + 2873.703, + "NA", + "NA", + 96.048, + 21.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 386.37, + 2805.44, + 65.13, + 2904.965, + "NA", + "NA", + 94.375, + 159.46 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.142 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 0.67, + 0.07, + 1.8, + "NA", + "NA", + 0.294, + 0.23, + 0.169 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.09, + 0.87, + 0.06, + 1.9, + "NA", + "NA", + 0.283, + 1.26, + 0.251 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.169, + "NA", + 0.057 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.223, + "NA", + 0.092 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.304 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.484, + 0.44, + 0.829, + 0.477 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.518, + 0.445, + 0.9, + 0.648 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + 0.233 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.121 + ] + } + }, + "wt_peptide": "YRVPFLVL" + }, + "TLYRVPLLV": { + "ic50s_MT": [ + "X", + "X", + "X", + 3237.328 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.39 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.533 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.425 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6274.434 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.601 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.851 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.625 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1976.62, + 8131.89, + 2797.01, + 4883.053, + 4373.307, + 3677.647, + 591.766, + 1450.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3124.56, + 13156.94, + 4856.71, + 7692.158, + 9589.81, + 8444.423, + 2224.445, + 473.24 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.578 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.777 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.44, + 2.9, + 2.9, + 17.0, + 23.0, + 21.0, + 1.88, + 5.23, + 0.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.71, + 4.9, + 4.6, + 27.0, + 32.0, + 31.0, + 4.962, + 2.6, + 0.936 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.971, + 0.076 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.041, + 0.972, + 0.059 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.625 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.091, + 0.119, + 0.678, + 0.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.082, + 0.119, + 0.328 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.59, + 0.475 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 2.602 + ] + } + }, + "wt_peptide": "TLYRVPFLV" + }, + "YRVPLLVLEC": { + "ic50s_MT": [ + "X", + "X", + "X", + 3010.375 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.672 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.722 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.277 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2762.555 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.917 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.829 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.103 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.595 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "10", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10067.7, + 31927.141, + 1542.59, + 4478.161, + "NA", + "NA", + 815.94, + 1260.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6879.54, + 24867.79, + 1158.05, + 3766.311, + "NA", + "NA", + 576.018, + 1758.8 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.816 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 22.0, + 1.6, + 3.7, + "NA", + "NA", + 2.408, + 4.79, + 1.481 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 14.0, + 1.3, + 2.9, + "NA", + "NA", + 1.829, + 5.89, + 1.029 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.304, + 0.996, + 0.035 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.352, + 0.994, + 0.061 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.595 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.172, + 0.123, + 0.063 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.543, + 0.175, + 0.085 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.9, + 2.544 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.2, + 2.005 + ] + } + }, + "wt_peptide": "YRVPFLVLEC" + } + }, + "transcripts": [ + "ENST00000613215.4-OSTC-F/L-9" + ], + "transcript_expr": [ + 2.161 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 83 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 2.161 + }, + "Transcript Set 2": { + "peptides": { + "LYRVPLLVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2500.65 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.527 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.94 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.964 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.62 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5566.561 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.626 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.03 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.465 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5427.86, + 6412.06, + 5238.84, + 3454.017, + 763.502, + 1547.284, + 361.841, + 918.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6354.6, + 11479.41, + 7247.76, + 4778.521, + 1193.466, + 3080.137, + 467.545, + 9638.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.287 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.627 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 2.3, + 5.0, + 12.0, + 7.6, + 13.0, + 1.247, + 3.94, + 2.753 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 4.2, + 6.6, + 16.0, + 10.0, + 19.0, + 1.549, + 19.11, + 5.052 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.994, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065, + 0.993, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.465 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.057, + 0.022, + 0.404, + 0.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.008, + 0.439, + 0.397 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 1.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 0.96 + ] + } + }, + "wt_peptide": "LYRVPFLVL" + }, + "TLYRVPLLV": { + "ic50s_MT": [ + "X", + "X", + "X", + 3237.328 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.39 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.533 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.425 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6274.434 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.601 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.851 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.625 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1976.62, + 8131.89, + 2797.01, + 4883.053, + 4373.307, + 3677.647, + 591.766, + 1450.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3124.56, + 13156.94, + 4856.71, + 7692.158, + 9589.81, + 8444.423, + 2224.445, + 473.24 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.578 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.777 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.44, + 2.9, + 2.9, + 17.0, + 23.0, + 21.0, + 1.88, + 5.23, + 0.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.71, + 4.9, + 4.6, + 27.0, + 32.0, + 31.0, + 4.962, + 2.6, + 0.936 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.971, + 0.076 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.041, + 0.972, + 0.059 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.425 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.625 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.091, + 0.119, + 0.678, + 0.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.082, + 0.119, + 0.328 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.59, + 0.475 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 2.602 + ] + } + }, + "wt_peptide": "TLYRVPFLV" + } + }, + "transcripts": [ + "ENST00000512478.2-OSTC-F/L-9" + ], + "transcript_expr": [ + 1.679 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 171 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 1.679 + }, + "Transcript Set 3": { + "peptides": { + "LYRVPLLVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2500.65 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.527 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.94 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.964 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.62 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5566.561 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.626 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.03 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.465 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5427.86, + 6412.06, + 5238.84, + 3454.017, + 763.502, + 1547.284, + 361.841, + 918.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6354.6, + 11479.41, + 7247.76, + 4778.521, + 1193.466, + 3080.137, + 467.545, + 9638.4 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.287 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.627 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 2.3, + 5.0, + 12.0, + 7.6, + 13.0, + 1.247, + 3.94, + 2.753 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 4.2, + 6.6, + 16.0, + 10.0, + 19.0, + 1.549, + 19.11, + 5.052 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.994, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065, + 0.993, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.465 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.057, + 0.022, + 0.404, + 0.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.008, + 0.439, + 0.397 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.88, + 1.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.1, + 0.96 + ] + } + }, + "wt_peptide": "LYRVPFLVL" + } + }, + "transcripts": [ + "ENST00000361564.9-OSTC-F/L-9" + ], + "transcript_expr": [ + 167.705 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 149 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 167.705 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 1 + ], + "peptide_counts": [ + 4, + 2, + 1 + ], + "set_expr": [ + 2.161, + 1.679, + 167.705 + ], + "DNA VAF": 0.462, + "RNA VAF": 0.486, + "gene_expr": 173.877, + "best_peptide_mt": "LYRVPLLVL", + "best_peptide_wt": "LYRVPFLVL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-110559663-110559664-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NRYTLNNTN": { + "ic50s_MT": [ + "X", + "X", + "X", + 2098.331 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.92 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.84 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.53 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.323 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3040.549 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.935 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.309 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.25 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20590.359, + 2743.19, + 14802.53, + 1453.473, + 53.803, + 60.196, + 6887.18, + 541.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25197.41, + 4176.16, + 20813.9, + 1904.939, + 77.057, + 126.932, + 12164.099, + 1468.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.971 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.918 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.5, + 0.86, + 16.0, + 3.0, + 0.9, + 1.1, + 10.91, + 2.84, + 1.507 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 1.4, + 23.0, + 4.6, + 1.3, + 1.9, + 18.262, + 5.27, + 1.343 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.066, + 0.984, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.989, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.25 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.015, + 0.025 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.009, + 0.02 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.9, + 15.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 27.617 + ] + } + }, + "wt_peptide": "NRYTLNNRN" + } + }, + "transcripts": [ + "ENST00000265162.10-ENPEP-R/T-887" + ], + "transcript_expr": [ + 0.005 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 957 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.005 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.005 + ], + "DNA VAF": 0.239, + "RNA VAF": 0.0, + "gene_expr": 0.032, + "best_peptide_mt": "NRYTLNNTN", + "best_peptide_wt": "NRYTLNNRN", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-114833618-114833619-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "PRYNYPEAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 215.33 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.455 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.51 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.318 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.723 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 219.441 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.802 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.765 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.802 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.568 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2275.08, + 208.26, + 222.4, + 1654.986, + 19.4, + 134.763, + 114.313, + 40310.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3238.35, + 97.65, + 232.24, + 1183.386, + 12.326, + 81.016, + 206.643, + 36883.79 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.878 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.341 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.51, + 0.09, + 0.3, + 3.6, + 0.4, + 2.0, + 0.384, + 91.14, + 1.218 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.74, + 0.05, + 0.31, + 2.1, + 0.3, + 1.3, + 0.765, + 79.84, + 3.022 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.039, + 0.978, + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.982, + 0.03 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.723 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.568 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.17, + 0.038, + 0.782, + 0.44 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.061, + 0.009, + 0.522, + 0.267 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.33, + 0.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.83, + 0.775 + ] + } + }, + "wt_peptide": "PRYNYSEAL" + }, + "YNYPEALTF": { + "ic50s_MT": [ + "X", + "X", + "X", + 1882.281 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.791 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.118 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.823 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2814.9 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.27 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.34 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.555 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.734 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1562.6, + 2422.29, + 907.82, + 7527.491, + 2201.963, + 4212.792, + 70.68, + 260.23 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2291.16, + 3338.64, + 1509.57, + 8387.643, + 4147.725, + 5656.789, + 149.203, + 172.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.512 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.858 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.35, + 0.76, + 1.2, + 27.0, + 16.0, + 22.0, + 0.158, + 1.76, + 0.483 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.51, + 1.2, + 1.8, + 30.0, + 22.0, + 26.0, + 0.54, + 1.34, + 1.159 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.982, + 0.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.952, + 0.027 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.823 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.734 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.299, + 0.026, + 0.923, + 0.649 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.128, + 0.003, + 0.568, + 0.23 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.15, + 0.086 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.43, + 0.68 + ] + } + }, + "wt_peptide": "YNYSEALTF" + } + }, + "transcripts": [ + "ENST00000264363.7-NDST4-S/P-795" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 872 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.187, + "RNA VAF": 0.0, + "gene_expr": 0.003, + "best_peptide_mt": "PRYNYPEAL", + "best_peptide_wt": "PRYNYSEAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-121932625-121932626-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TLSPFEQEL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3541.898 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.37 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.06 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3408.95 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.75 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.564 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.673 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6104.83, + 11286.91, + 4883.05, + 9447.755, + 1281.77, + 2200.746, + 64.768, + 1775.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13484.52, + 11213.14, + 3398.41, + 8758.623, + 926.424, + 1505.116, + 157.966, + 3419.49 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.435 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 4.1, + 4.6, + 33.0, + 12.0, + 16.0, + 0.128, + 5.92, + 0.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 4.1, + 3.4, + 31.0, + 8.7, + 13.0, + 0.575, + 9.08, + 0.389 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.986, + 0.177 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.027, + 0.986, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.673 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.124, + 0.019, + 0.786, + 0.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.002, + 0.497, + 0.165 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.44, + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 0.827 + ] + } + }, + "wt_peptide": "TLSPCEQEL" + } + }, + "transcripts": [ + "ENST00000379645.8-TRPC3-C/F-211", + "ENST00000264811.9-TRPC3-C/F-138", + "ENST00000513531.1-TRPC3-C/F-138" + ], + "transcript_expr": [ + 0.068, + 0.0, + 0.0 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 1.0, + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 921, + 848, + 793 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.068 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.068 + ], + "DNA VAF": 0.3, + "RNA VAF": 0.0, + "gene_expr": 0.068, + "best_peptide_mt": "TLSPFEQEL", + "best_peptide_wt": "TLSPCEQEL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-154491218-154491219-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ARTQRCLLW": { + "ic50s_MT": [ + "X", + "X", + "X", + 1237.637 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.218 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.368 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.349 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.485 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 748.136 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.387 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.498 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.763 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.046 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "6", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4316.18, + 730.48, + 2889.29, + 1672.99, + 51.028, + 58.421, + 802.283, + 27168.529 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2581.04, + 253.67, + 1550.96, + 1050.601, + 19.49, + 20.071, + 445.672, + 33036.3 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.457 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.403 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 0.28, + 2.9, + 3.7, + 0.9, + 1.0, + 2.368, + 52.57, + 3.77 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.57, + 0.11, + 1.8, + 1.8, + 0.4, + 0.4, + 1.498, + 68.04, + 3.418 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.845, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.864, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.485 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.046 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.086, + 0.002, + 0.168, + 0.162 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.211, + 0.004, + 0.326, + 0.247 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.63, + 2.068 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.25, + 1.276 + ] + } + }, + "wt_peptide": "ARTQRSLLW" + }, + "ARTQRCLLWL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3524.516 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.808 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 15.004 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2236.559 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.66 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.826 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.055 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "6", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4507.81, + 9246.51, + 270.22, + 3766.311, + "NA", + "NA", + 3282.72, + 240.81 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3429.92, + 5296.51, + 223.61, + 2968.512, + "NA", + "NA", + 1504.607, + 730.77 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.573 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.263 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 3.3, + 0.27, + 2.9, + "NA", + "NA", + 6.452, + 1.67, + 19.961 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.79, + 1.9, + 0.24, + 1.9, + "NA", + "NA", + 3.765, + 3.42, + 14.005 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.041, + 0.727, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032, + 0.815, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 15.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.055 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.002, + 0.03, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.022, + 0.005, + 0.07, + 0.054 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.6, + 8.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.8, + 3.853 + ] + } + }, + "wt_peptide": "ARTQRSLLWL" + }, + "QRCLLWLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3633.04 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.845 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.59 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.881 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.502 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3039.742 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.687 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.595 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.494 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.844 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9179.32, + 17872.59, + 2032.71, + 4676.227, + "NA", + "NA", + 2589.852, + 787.59 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4662.79, + 18282.72, + 893.21, + 4778.521, + "NA", + "NA", + 1416.694, + 854.79 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.23 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.275 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 7.3, + 1.9, + 4.1, + "NA", + "NA", + 5.5, + 3.59, + 2.476 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 7.6, + 0.89, + 4.3, + "NA", + "NA", + 3.595, + 3.78, + 2.697 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + "NA", + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + "NA", + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.502 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.844 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.019, + 0.036, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.061, + 0.136, + 0.063, + 0.008 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 6.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.83, + 4.157 + ] + } + }, + "wt_peptide": "QRSLLWLL" + } + }, + "transcripts": [ + "ENST00000357232.10-DCHS2-S/C-46", + "ENST00000339452.2-DCHS2-S/C-46" + ], + "transcript_expr": [ + 0.144, + 0.499 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 3371, + 1369 + ], + "transcript_count": 2, + "peptide_count": 3, + "total_expr": 0.643 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 3 + ], + "set_expr": [ + 0.643 + ], + "DNA VAF": 0.963, + "RNA VAF": 1.0, + "gene_expr": 2.425, + "best_peptide_mt": "ARTQRCLLW", + "best_peptide_wt": "ARTQRSLLW", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-176120050-176120052-AG-GA": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FRWHTHQKGKI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2657.811 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.174 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.25 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3244.824 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.478 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.009 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4876.14, + 9356.71, + 304.37, + 3033.449, + "NA", + "NA", + 2282.172, + 55.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4955.01, + 8473.66, + 260.18, + 2192.642, + "NA", + "NA", + 4297.007, + 10.08 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.672 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 3.4, + 0.34, + 2.0, + "NA", + "NA", + 5.034, + 0.56, + 6.803 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 3.0, + 0.32, + 1.1, + "NA", + "NA", + 7.768, + 0.08, + 5.474 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.105, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.009 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.01, + 0.041, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.01, + 0.023, + 0.009 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 6.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 10.656 + ] + } + }, + "wt_peptide": "FRWHTHQKGKV" + } + }, + "transcripts": [ + "ENST00000508596.6-WDR17-KV/KI-164-165", + "ENST00000507824.6-WDR17-KV/KI-188-189" + ], + "transcript_expr": [ + 0.062, + 0.088 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1283, + 1297 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.15 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.15 + ], + "DNA VAF": 0.508, + "RNA VAF": "NA", + "gene_expr": 0.514, + "best_peptide_mt": "FRWHTHQKGKI", + "best_peptide_wt": "FRWHTHQKGKV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr4-176120051-176120052-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HTHQKGKIV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2657.255 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.005 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.36 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.189 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2338.375 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.04 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.025 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.669 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4104.62, + 2163.98, + 3150.53, + 3454.017, + 693.122, + 326.265, + 354.738, + 21335.131 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3080.12, + 1924.77, + 2751.98, + 3766.311, + 1037.075, + 537.737, + 221.463, + 23861.57 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.762 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.702 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.95, + 0.68, + 3.2, + 12.0, + 7.1, + 4.1, + 1.237, + 39.78, + 0.903 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.7, + 0.59, + 2.8, + 13.0, + 9.3, + 6.0, + 0.812, + 45.06, + 0.785 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.99, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.986, + 0.018 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.669 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.001, + 0.202, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.084, + 0.001, + 0.287, + 0.004 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.9, + 1.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.64, + 1.411 + ] + } + }, + "wt_peptide": "HTHQKGKVV" + }, + "FRWHTHQKGKI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2657.811 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.174 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.25 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3244.824 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.478 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.009 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4876.14, + 9356.71, + 304.37, + 3033.449, + "NA", + "NA", + 2282.172, + 55.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4955.01, + 8473.66, + 260.18, + 2192.642, + "NA", + "NA", + 4297.007, + 10.08 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.672 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 3.4, + 0.34, + 2.0, + "NA", + "NA", + 5.034, + 0.56, + 6.803 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 3.0, + 0.32, + 1.1, + "NA", + "NA", + 7.768, + 0.08, + 5.474 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.105, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.009 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.01, + 0.041, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.01, + 0.023, + 0.009 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 6.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 10.656 + ] + } + }, + "wt_peptide": "FRWHTHQKGKV" + } + }, + "transcripts": [ + "ENST00000280190.8-WDR17-V/I-189", + "ENST00000507824.6-WDR17-V/I-189" + ], + "transcript_expr": [ + 0.0, + 0.088 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1322, + 1297 + ], + "transcript_count": 2, + "peptide_count": 2, + "total_expr": 0.088 + }, + "Transcript Set 2": { + "peptides": { + "FRWHTHQKGKI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2657.811 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.174 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.25 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3244.824 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.478 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.009 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4876.14, + 9356.71, + 304.37, + 3033.449, + "NA", + "NA", + 2282.172, + 55.62 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4955.01, + 8473.66, + 260.18, + 2192.642, + "NA", + "NA", + 4297.007, + 10.08 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.672 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 3.4, + 0.34, + 2.0, + "NA", + "NA", + 5.034, + 0.56, + 6.803 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 3.0, + 0.32, + 1.1, + "NA", + "NA", + 7.768, + 0.08, + 5.474 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.105, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.009 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.01, + 0.041, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.01, + 0.023, + 0.009 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 6.048 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 10.656 + ] + } + }, + "wt_peptide": "FRWHTHQKGKV" + } + }, + "transcripts": [ + "ENST00000508596.6-WDR17-V/I-165" + ], + "transcript_expr": [ + 0.062 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1283 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.062 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 0.088, + 0.062 + ], + "DNA VAF": 0.489, + "RNA VAF": 0.0, + "gene_expr": 0.514, + "best_peptide_mt": "HTHQKGKIV", + "best_peptide_wt": "HTHQKGKVV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-1331835-1331836-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SFWNKKKSM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3130.994 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.35 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.887 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.008 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5890.775 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.318 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.716 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5087.84, + 2133.32, + 5126.69, + 6682.848, + 4128.668, + 1149.661, + 287.894, + 269.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7848.02, + 3933.53, + 8571.13, + 9047.586, + 13734.41, + 2996.194, + 473.689, + 291.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.739 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.005 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 0.66, + 4.9, + 24.0, + 22.0, + 9.9, + 1.024, + 1.8, + 6.106 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 1.3, + 8.1, + 32.0, + 38.0, + 19.0, + 1.564, + 1.9, + 9.293 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.101, + 0.992, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.977, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.716 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.121, + 0.009, + 0.312, + 0.108 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.082, + 0.004, + 0.179, + 0.039 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.45, + 1.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.66, + 1.975 + ] + } + }, + "wt_peptide": "SFWKKKKSM" + } + }, + "transcripts": [ + "ENST00000320895.10-CLPTM1L-K/N-313", + "ENST00000507807.3-CLPTM1L-K/N-180" + ], + "transcript_expr": [ + 51.961, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 538, + 369 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 51.961 + }, + "Transcript Set 2": { + "peptides": { + "SFWNKKKSM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3130.994 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.35 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.887 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.008 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5890.775 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.318 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.716 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5087.84, + 2133.32, + 5126.69, + 6682.848, + 4128.668, + 1149.661, + 287.894, + 269.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7848.02, + 3933.53, + 8571.13, + 9047.586, + 13734.41, + 2996.194, + 473.689, + 291.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.739 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.005 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 0.66, + 4.9, + 24.0, + 22.0, + 9.9, + 1.024, + 1.8, + 6.106 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 1.3, + 8.1, + 32.0, + 38.0, + 19.0, + 1.564, + 1.9, + 9.293 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.101, + 0.992, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.977, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.716 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.121, + 0.009, + 0.312, + 0.108 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.082, + 0.004, + 0.179, + 0.039 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.45, + 1.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.66, + 1.975 + ] + } + }, + "wt_peptide": "SFWKKKKSM" + }, + "ISFWNKKKSM": { + "ic50s_MT": [ + "X", + "X", + "X", + 4691.438 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.3 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 8.844 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 61.243 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8537.578 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 16.24 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 78.115 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11776.05, + 20697.34, + 3435.38, + 1844.099, + "NA", + "NA", + 5947.496, + 310.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15579.13, + 24763.08, + 5560.06, + 2192.642, + "NA", + "NA", + 11515.096, + 240.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.176 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.522 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.5, + 9.1, + 3.0, + 0.9, + "NA", + "NA", + 9.813, + 1.98, + 37.517 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.2, + 14.0, + 4.8, + 1.1, + "NA", + "NA", + 17.242, + 1.67, + 49.346 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.037, + 0.977, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.987, + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 61.243 + ] + }, + "WT": { + "HLA-C*06:02": [ + 78.115 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.009, + 0.02, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.005, + 0.009, + 0.024 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.5, + 12.187 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.9, + 24.579 + ] + } + }, + "wt_peptide": "ISFWKKKKSM" + } + }, + "transcripts": [ + "ENST00000630539.1-CLPTM1L-K/N-180" + ], + "transcript_expr": [ + 17.195 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 369 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 17.195 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 1, + 2 + ], + "set_expr": [ + 51.961, + 17.195 + ], + "DNA VAF": 0.378, + "RNA VAF": 0.325, + "gene_expr": 169.373, + "best_peptide_mt": "SFWNKKKSM", + "best_peptide_wt": "SFWKKKKSM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-1814504-1814505-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "PAHPHTPLH": { + "ic50s_MT": [ + "X", + "X", + "X", + 9806.038 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.012 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.024 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 14.74 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.106 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13251.355 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.062 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.123 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 19.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.218 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 25522.84, + 9574.95, + 17888.25, + 9245.506, + 92.429, + 1237.571, + 10037.127, + 39316.211 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26788.16, + 13197.71, + 20813.9, + 10757.622, + 213.211, + 2175.555, + 13305.001, + 39044.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.571 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.912 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 3.5, + 19.0, + 32.0, + 1.4, + 12.0, + 15.024, + 87.92, + 19.938 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 4.9, + 23.0, + 37.0, + 3.0, + 16.0, + 20.123, + 87.0, + 29.189 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.997, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.034, + 0.991, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.106 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.218 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.01, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.006, + 0.008, + 0.02 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.9, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.1, + 31.643 + ] + } + }, + "wt_peptide": "PARPHTPLH" + } + }, + "transcripts": [ + "ENST00000469176.1-NDUFS6-R/H-118" + ], + "transcript_expr": [ + 0.592 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 172 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.592 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.592 + ], + "DNA VAF": 0.41, + "RNA VAF": 0.5, + "gene_expr": 181.433, + "best_peptide_mt": "PAHPHTPLH", + "best_peptide_wt": "PARPHTPLH", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-7886679-7886680-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QIRAIPKKAFL": { + "ic50s_MT": [ + "X", + "X", + "X", + 21032.195 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 20.627 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 20.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 27.253 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21191.985 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 22.63 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 31.633 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.75 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 27.259 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 22600.939, + 19463.449, + 14099.07, + 25564.297, + "NA", + "NA", + 23144.371, + 3933.86 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22907.46, + 19476.51, + 16763.86, + 31740.463, + "NA", + "NA", + 23149.994, + 19067.34 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.992 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.993 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 8.3, + 14.0, + 34.0, + "NA", + "NA", + 49.48, + 9.99, + 31.622 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 8.3, + 18.0, + 41.0, + "NA", + "NA", + 49.48, + 35.38, + 31.633 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 27.253 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.259 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.002, + 0.007, + 0.152 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.017, + 0.395 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 10.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.0, + 13.501 + ] + } + }, + "wt_peptide": "EIRAIPKKAFL" + } + }, + "transcripts": [ + "ENST00000440940.7-MTRR-E/Q-375" + ], + "transcript_expr": [ + 9.135 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 698 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 9.135 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 9.135 + ], + "DNA VAF": 0.194, + "RNA VAF": 0.204, + "gene_expr": 64.271, + "best_peptide_mt": "QIRAIPKKAFL", + "best_peptide_wt": "EIRAIPKKAFL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-14507134-14507135-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MADQGCLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5494.7 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.68 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.56 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.611 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 47.503 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1836.907 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.3 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.809 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 27.161 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "6", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 22148.26, + 22561.859, + 8387.64, + 1844.099, + "NA", + "NA", + 1797.133, + 2601.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13629.59, + 6804.41, + 2678.54, + 995.274, + "NA", + "NA", + 376.709, + 128.39 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.644 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.922 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.8, + 12.0, + 6.8, + 0.8, + "NA", + "NA", + 4.264, + 7.56, + 21.888 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.3, + 2.4, + 2.2, + 0.3, + "NA", + "NA", + 1.29, + 1.08, + 8.184 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 47.503 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.161 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.151, + 0.347 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.008, + 0.457, + 0.358 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 2.222 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 0.917 + ] + } + }, + "wt_peptide": "MADQGRLL" + } + }, + "transcripts": [ + "ENST00000344204.9-TRIO-R/C-2876" + ], + "transcript_expr": [ + 11.522 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3097 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 11.522 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 11.522 + ], + "DNA VAF": 0.259, + "RNA VAF": 0.25, + "gene_expr": 74.348, + "best_peptide_mt": "MADQGCLL", + "best_peptide_wt": "MADQGRLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-23521053-23521054-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ASFSNECSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2733.89 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.583 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.135 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.467 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2134.276 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.765 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.217 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.73 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "7", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7655.87, + 7480.32, + 7054.34, + 1602.129, + 365.435, + 723.719, + 397.609, + 3865.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6109.65, + 5097.98, + 4129.12, + 1209.273, + 313.192, + 453.492, + 212.249, + 3059.28 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.797 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.607 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.7, + 6.5, + 3.5, + 4.4, + 7.3, + 1.35, + 9.88, + 0.978 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 1.8, + 4.0, + 2.2, + 3.9, + 5.3, + 0.78, + 8.42, + 0.617 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.987, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.991, + 0.027 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.467 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.73 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.001, + 0.195, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.002, + 0.338, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 1.871 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 1.233 + ] + } + }, + "wt_peptide": "ASFSNESSL" + } + }, + "transcripts": [ + "ENST00000296682.4-PRDM9-S/C-128" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 894 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.417, + "RNA VAF": 0.0, + "gene_expr": 0.024, + "best_peptide_mt": "ASFSNECSL", + "best_peptide_wt": "ASFSNESSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-115130597-115130604-ACTAACTG-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VRMPVLIL": { + "ic50s_MT": [ + "X", + "X", + "X", + 435.525 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.297 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.305 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.194 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 696.48, + 1831.31, + 62.37, + 1097.068, + "NA", + "NA", + 143.948, + 174.57 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.313 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.16, + 0.56, + 0.06, + 0.4, + "NA", + "NA", + 0.516, + 1.35, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.287, + "NA", + 0.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.194 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.391, + 0.301, + 0.659, + 0.329 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 0.509 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "MSKTVGMTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 779.928 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.684 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.661 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.758 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1074.78, + 9293.85, + 3848.7, + 1304.419, + 485.076, + 458.744, + 202.001, + 475.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.414 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.25, + 3.3, + 3.8, + 2.5, + 5.6, + 5.3, + 0.748, + 2.61, + 3.491 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.051, + 0.959, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.758 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.071, + 0.005, + 0.618, + 0.371 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.74, + 0.582 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRMPVLILH": { + "ic50s_MT": [ + "X", + "X", + "X", + 1225.923 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.35 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.25 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3199.79, + 1330.78, + 3325.66, + 1121.067, + 73.589, + 274.517, + 334.024, + 13744.79 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.531 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.73, + 0.43, + 3.4, + 2.0, + 1.2, + 3.5, + 1.171, + 25.89, + 0.507 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.173, + 0.977, + 0.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.165, + 0.702, + 0.748, + 0.681 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.361 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "LRSPRDVQDM": { + "ic50s_MT": [ + "X", + "X", + "X", + 1378.948 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.044 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.02 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.189 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17857.441 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.268 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 22.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 28.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 20.536 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7, 8, 9, 10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2644.11, + 2256.74, + 331.89, + 1824.253, + "NA", + "NA", + 933.642, + 140.2 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30194.81, + 39518.49, + 18882.64, + 8208.088, + "NA", + "NA", + 16832.242, + 13232.98 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.842 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.258 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.59, + 0.71, + 0.33, + 0.9, + "NA", + "NA", + 2.657, + 1.15, + 1.107 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 41.0, + 20.0, + 9.1, + "NA", + "NA", + 27.539, + 25.02, + 13.916 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.059, + 0.978, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.922, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.536 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + 0.016, + 0.094, + 0.014 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.98, + 3.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 37.359 + ] + } + }, + "wt_peptide": "LRSPRDAVSP" + } + }, + "transcripts": [ + "ENST00000513154.6-TRIM36-AVS/X-595-597", + "ENST00000514154.1-TRIM36-AVS/X-452-454" + ], + "transcript_expr": [ + 0.317, + 0.456 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 2.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 716, + 573 + ], + "transcript_count": 2, + "peptide_count": 4, + "total_expr": 0.773 + }, + "Transcript Set 2": { + "peptides": { + "MSKTVGMTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 779.928 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.684 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.661 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.758 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1074.78, + 9293.85, + 3848.7, + 1304.419, + 485.076, + 458.744, + 202.001, + 475.32 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.414 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.25, + 3.3, + 3.8, + 2.5, + 5.6, + 5.3, + 0.748, + 2.61, + 3.491 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.051, + 0.959, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.758 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.071, + 0.005, + 0.618, + 0.371 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.74, + 0.582 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "VRMPVLILH": { + "ic50s_MT": [ + "X", + "X", + "X", + 1225.923 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.35 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.25 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3199.79, + 1330.78, + 3325.66, + 1121.067, + 73.589, + 274.517, + 334.024, + 13744.79 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.531 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.73, + 0.43, + 3.4, + 2.0, + 1.2, + 3.5, + 1.171, + 25.89, + 0.507 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.173, + 0.977, + 0.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.165, + 0.702, + 0.748, + 0.681 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.361 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + }, + "LRSPRDVQDM": { + "ic50s_MT": [ + "X", + "X", + "X", + 1378.948 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.044 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.02 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.189 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 17857.441 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.268 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 22.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 28.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 20.536 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7, 8, 9, 10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2644.11, + 2256.74, + 331.89, + 1824.253, + "NA", + "NA", + 933.642, + 140.2 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30194.81, + 39518.49, + 18882.64, + 8208.088, + "NA", + "NA", + 16832.242, + 13232.98 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.842 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.258 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.59, + 0.71, + 0.33, + 0.9, + "NA", + "NA", + 2.657, + 1.15, + 1.107 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 41.0, + 20.0, + 9.1, + "NA", + "NA", + 27.539, + 25.02, + 13.916 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.059, + 0.978, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.922, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.189 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.536 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + 0.016, + 0.094, + 0.014 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.98, + 3.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 37.359 + ] + } + }, + "wt_peptide": "LRSPRDAVSP" + } + }, + "transcripts": [ + "ENST00000282369.7-TRIM36-AVS/X-607-609" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 728 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 4, + 3 + ], + "set_expr": [ + 0.773, + 0.0 + ], + "DNA VAF": 0.92, + "RNA VAF": 0.0, + "gene_expr": 1.136, + "best_peptide_mt": "VRMPVLIL", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-133103958-133103959-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LNPQNKQSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 8800.51 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.71 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.761 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.82 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7362.423 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.3 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.089 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.242 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16420.98, + 9299.78, + 6095.65, + 8758.623, + 4119.173, + 8842.396, + 158.384, + 18284.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19344.41, + 6652.12, + 5500.22, + 15541.082, + 7635.017, + 11764.406, + 824.715, + 7089.83 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.723 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.366 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.6, + 3.3, + 5.6, + 31.0, + 22.0, + 31.0, + 0.575, + 33.9, + 0.827 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.5, + 2.4, + 5.1, + 49.0, + 29.0, + 35.0, + 2.428, + 15.12, + 3.181 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.963, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.975, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.242 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.004, + 0.455, + 0.117 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.003, + 0.127, + 0.078 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 0.923 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 2.477 + ] + } + }, + "wt_peptide": "LNLQNKQSL" + } + }, + "transcripts": [ + "ENST00000304858.7-HSPA4-L/P-751" + ], + "transcript_expr": [ + 83.59 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 840 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 83.59 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 83.59 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.996, + "gene_expr": 114.662, + "best_peptide_mt": "LNPQNKQSL", + "best_peptide_wt": "LNLQNKQSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-134893641-134893642-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DAPQHSSLS": { + "ic50s_MT": [ + "X", + "X", + "X", + 12894.035 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.631 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 24.29 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.102 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16771.027 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 37.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.735 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 31841.58, + 13673.46, + 30560.949, + 5099.027, + 138.934, + 636.165, + 12114.61, + 36001.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34488.78, + 13935.58, + 29425.27, + 6539.788, + 59.953, + 260.357, + 19606.475, + 22991.36 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.505 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 25.0, + 5.1, + 39.0, + 17.0, + 2.1, + 6.7, + 18.262, + 77.05, + 14.131 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 5.2, + 37.0, + 23.0, + 1.1, + 3.5, + 35.386, + 43.17, + 18.665 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.965, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.959, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.735 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.009, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.005, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 24.0, + 24.579 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29.0, + 46.225 + ] + } + }, + "wt_peptide": "DASQHSSLS" + } + }, + "transcripts": [ + "ENST00000358387.9-TXNDC15-S/P-248" + ], + "transcript_expr": [ + 11.362 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 360 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 11.362 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 11.362 + ], + "DNA VAF": 0.993, + "RNA VAF": 0.996, + "gene_expr": 42.95, + "best_peptide_mt": "DAPQHSSLS", + "best_peptide_wt": "DASQHSSLS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-136274698-136274699-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IGLPFLAITY": { + "ic50s_MT": [ + "X", + "X", + "X", + 26041.936 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.056 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 31.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.658 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.38 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 29560.425 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.294 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 36.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 14.08 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.52 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19364.301, + 45979.801, + 26123.529, + 34986.781, + "NA", + "NA", + 7808.783, + 25960.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21877.46, + 46599.84, + 28951.56, + 45360.651, + "NA", + "NA", + 8328.085, + 30169.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.367 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.545 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.5, + 80.0, + 31.0, + 44.0, + "NA", + "NA", + 12.097, + 49.76, + 16.016 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.5, + 86.0, + 36.0, + 54.0, + "NA", + "NA", + 12.767, + 60.11, + 19.427 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.994, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.058, + 0.996, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.38 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.52 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.005, + 0.021, + 0.159 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.016, + 0.086 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 8.2, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 15.161 + ] + } + }, + "wt_peptide": "IGLPFLAIAY" + } + }, + "transcripts": [ + "ENST00000513104.6-TRPC7-A/T-368" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 862 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.366, + "RNA VAF": 0.0, + "gene_expr": 0.005, + "best_peptide_mt": "IGLPFLAITY", + "best_peptide_wt": "IGLPFLAIAY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-141123692-141123693-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FVLYPLHNG": { + "ic50s_MT": [ + "X", + "X", + "X", + 19405.965 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 30.835 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 31.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 33.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 19.157 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18943.58 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 30.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 48.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 16.901 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 35174.289, + 22308.92, + 37333.422, + 8758.623, + 9995.626, + 6117.444, + 24731.062, + 16503.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35118.01, + 19049.47, + 35559.24, + 7287.077, + 6695.916, + 4672.723, + 25119.942, + 18837.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.742 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.577 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 34.0, + 12.0, + 58.0, + 31.0, + 33.0, + 27.0, + 59.2, + 30.67, + 24.557 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.0, + 8.0, + 51.0, + 26.0, + 28.0, + 23.0, + 60.797, + 34.94, + 20.072 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.034, + 0.994, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + 0.989, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 19.157 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.901 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.007, + 0.135 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.051 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 30.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35.0, + 62.745 + ] + } + }, + "wt_peptide": "FVLYPLQNG" + } + }, + "transcripts": [ + "ENST00000194152.4-PCDHB4-Q/H-565" + ], + "transcript_expr": [ + 1.101 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 795 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.101 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.101 + ], + "DNA VAF": 0.307, + "RNA VAF": 0.0, + "gene_expr": 1.436, + "best_peptide_mt": "FVLYPLHNG", + "best_peptide_wt": "FVLYPLQNG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-141332647-141332648-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FATVTLTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 6011.591 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.3 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.328 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.786 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.031 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11020.15 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 9.339 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 10.133 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.323 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 17.942 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9712.57, + 23237.48, + 1765.99, + 10414.043, + "NA", + "NA", + 2310.612, + 84.58 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15248.11, + 38572.64, + 6792.19, + 16946.226, + "NA", + "NA", + 6202.769, + 1654.57 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.535 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.106 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.7, + 12.0, + 1.7, + 13.0, + "NA", + "NA", + 5.108, + 0.8, + 4.328 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.0, + 38.0, + 5.4, + 23.0, + "NA", + "NA", + 10.133, + 5.66, + 10.997 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.226, + "NA", + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.081, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.942 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.008, + 0.061, + 0.133 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.002, + 0.029, + 0.179 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 4.271 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.1, + 8.545 + ] + } + }, + "wt_peptide": "SATVTLTV" + } + }, + "transcripts": [ + "ENST00000517417.3-PCDHGA1-S/F-655" + ], + "transcript_expr": [ + 0.037 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 931 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.037 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.037 + ], + "DNA VAF": 0.681, + "RNA VAF": 0.571, + "gene_expr": 0.326, + "best_peptide_mt": "FATVTLTV", + "best_peptide_wt": "SATVTLTV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-145817966-145817967-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HRLTWTQYA": { + "ic50s_MT": [ + "X", + "X", + "X", + 751.769 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.279 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.141 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16275.019 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 20.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 33.112 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.131 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 930.0, + 151.37, + 1158.05, + 1062.03, + 169.75, + 99.213, + 589.207, + 914.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29122.17, + 6250.33, + 17505.31, + 15044.728, + 12817.697, + 19569.062, + 17893.82, + 1277.03 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.771 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.469 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.23, + 0.07, + 1.4, + 1.8, + 2.5, + 1.5, + 1.863, + 3.92, + 0.922 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 2.2, + 19.0, + 48.0, + 37.0, + 43.0, + 30.5, + 4.83, + 17.977 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.068, + 0.95, + 0.133 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.953, + 0.022 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.131 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.113, + 0.001, + 0.167, + 0.075 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.49, + 2.068 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 46.225 + ] + } + }, + "wt_peptide": "HCLTWTQYA" + }, + "HRLTWTQY": { + "ic50s_MT": [ + "X", + "X", + "X", + 2413.15 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.002 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.204 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.093 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 29.634 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25073.615 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 40.221 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 38.442 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 33.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 69.063 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8839.26, + 2992.15, + 1834.15, + 4830.504, + "NA", + "NA", + 727.71, + 193.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37533.91, + 25665.73, + 24481.5, + 50000.0, + "NA", + "NA", + 20448.49, + 1580.48 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.851 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.386 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 0.93, + 1.8, + 4.3, + "NA", + "NA", + 2.204, + 1.45, + 7.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 15.0, + 28.0, + 58.0, + "NA", + "NA", + 38.442, + 5.51, + 44.591 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 29.634 + ] + }, + "WT": { + "HLA-C*06:02": [ + 69.063 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.004, + 0.297, + 0.343 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.008 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.81, + 1.377 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 46.225 + ] + } + }, + "wt_peptide": "HCLTWTQY" + }, + "HRLTWTQYASM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2509.864 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.866 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.334 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 12.54 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 20927.348 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 35.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 35.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 49.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 27.019 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3251.93, + 1370.36, + 348.45, + 4242.334, + "NA", + "NA", + 1767.797, + 7026.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31370.7, + 18074.25, + 13284.53, + 50000.0, + "NA", + "NA", + 22990.235, + 18864.46 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.776 + ] + }, + "WT": { + "HLA-C*06:02": [ + -4.45 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.75, + 0.44, + 0.41, + 3.5, + "NA", + "NA", + 4.232, + 15.02, + 25.473 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 7.4, + 14.0, + 57.0, + "NA", + "NA", + 49.48, + 35.0, + 80.157 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.028, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 12.54 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.019 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.001, + 0.052, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 4.969 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 62.745 + ] + } + }, + "wt_peptide": "HCLTWTQYASM" + } + }, + "transcripts": [ + "ENST00000334744.8-PRELID2-C/R-111" + ], + "transcript_expr": [ + 0.664 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 189 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.664 + }, + "Transcript Set 2": { + "peptides": { + "IRSHRLTWT": { + "ic50s_MT": [ + "X", + "X", + "X", + 1902.386 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 17.772 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.405 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5194.026 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.515 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.83 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 27.862 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.915 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7576.93, + 2514.39, + 4989.87, + 1290.382, + 445.461, + 205.859, + 14028.93, + 69.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12500.8, + 9151.66, + 8950.22, + 1437.831, + 1006.491, + 443.17, + 17758.278, + 87.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.467 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 0.8, + 4.7, + 2.4, + 5.3, + 2.9, + 21.487, + 0.68, + 1.903 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.8, + 3.3, + 8.4, + 2.9, + 9.2, + 5.2, + 29.959, + 0.82, + 3.83 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.91, + 0.032 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.951, + 0.024 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.405 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.915 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.007, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.006, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.5, + 46.225 + ] + } + }, + "wt_peptide": "IRSHCLTWT" + }, + "HRLTWTQY": { + "ic50s_MT": [ + "X", + "X", + "X", + 2413.15 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.002 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.204 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.093 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 29.634 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 25073.615 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 40.221 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 38.442 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 33.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 69.063 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8839.26, + 2992.15, + 1834.15, + 4830.504, + "NA", + "NA", + 727.71, + 193.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37533.91, + 25665.73, + 24481.5, + 50000.0, + "NA", + "NA", + 20448.49, + 1580.48 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.851 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.386 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 0.93, + 1.8, + 4.3, + "NA", + "NA", + 2.204, + 1.45, + 7.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 15.0, + 28.0, + 58.0, + "NA", + "NA", + 38.442, + 5.51, + 44.591 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 29.634 + ] + }, + "WT": { + "HLA-C*06:02": [ + 69.063 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.004, + 0.297, + 0.343 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.008 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.81, + 1.377 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 46.225 + ] + } + }, + "wt_peptide": "HCLTWTQY" + } + }, + "transcripts": [ + "ENST00000394450.6-PRELID2-C/R-70" + ], + "transcript_expr": [ + 3.292 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 148 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 3.292 + }, + "Transcript Set 3": { + "peptides": { + "IRSHRLTWT": { + "ic50s_MT": [ + "X", + "X", + "X", + 1902.386 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.65 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 17.772 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.405 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5194.026 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.515 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.83 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 27.862 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.915 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7576.93, + 2514.39, + 4989.87, + 1290.382, + 445.461, + 205.859, + 14028.93, + 69.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12500.8, + 9151.66, + 8950.22, + 1437.831, + 1006.491, + 443.17, + 17758.278, + 87.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.467 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 0.8, + 4.7, + 2.4, + 5.3, + 2.9, + 21.487, + 0.68, + 1.903 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.8, + 3.3, + 8.4, + 2.9, + 9.2, + 5.2, + 29.959, + 0.82, + 3.83 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.063, + 0.91, + 0.032 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.951, + 0.024 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.405 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.915 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.007, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.006, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.9, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.5, + 46.225 + ] + } + }, + "wt_peptide": "IRSHCLTWT" + } + }, + "transcripts": [ + "ENST00000683046.1-PRELID2-C/R-99", + "ENST00000511435.1-PRELID2-C/R-99", + "ENST00000505416.5-PRELID2-C/R-99" + ], + "transcript_expr": [ + 0.664, + 0.256, + 0.197 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + "NA", + 2.0, + 3.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 177, + 164, + 177 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 1.117 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3" + ], + "transcript_counts": [ + 1, + 1, + 3 + ], + "peptide_counts": [ + 3, + 2, + 1 + ], + "set_expr": [ + 0.664, + 3.292, + 1.117 + ], + "DNA VAF": 0.324, + "RNA VAF": 0.386, + "gene_expr": 7.144, + "best_peptide_mt": "IRSHRLTWT", + "best_peptide_wt": "IRSHCLTWT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-150120064-150120065-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SIFNSLYTI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1871.945 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.613 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.402 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.685 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9818.256 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 24.18 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.475 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2470.06, + 3440.66, + 3254.47, + 2751.985, + 870.583, + 733.787, + 456.371, + 1273.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20710.11, + 16144.92, + 21040.32, + 3491.591, + 2447.992, + 1212.188, + 16866.92, + 1671.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.853 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.83 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.55, + 1.2, + 3.3, + 7.6, + 8.3, + 7.4, + 1.523, + 4.81, + 1.142 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.6, + 6.3, + 23.0, + 12.0, + 17.0, + 11.0, + 27.539, + 5.71, + 7.078 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.084, + 0.983, + 0.055 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.036, + 0.976, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.685 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.475 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.045, + 0.002, + 0.223, + 0.106 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.006, + 0.028 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.704 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 37.359 + ] + } + }, + "wt_peptide": "SIFNSLYTT" + } + }, + "transcripts": [ + "ENST00000261799.9-PDGFRB-T/I-882" + ], + "transcript_expr": [ + 0.129 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1106 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.129 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.129 + ], + "DNA VAF": 0.291, + "RNA VAF": 0.0, + "gene_expr": 0.28, + "best_peptide_mt": "SIFNSLYTI", + "best_peptide_wt": "SIFNSLYTT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr5-177460554-177460555-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EVEKAAAII": { + "ic50s_MT": [ + "X", + "X", + "X", + 30343.26 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 24.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 36.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 19.309 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 10.213 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14681.274 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 20.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.058 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.574 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 32694.471, + 31734.961, + 28951.561, + 16053.812, + 24479.92, + 31737.301, + 12089.115, + 33876.059 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31229.82, + 24630.28, + 21154.46, + 8208.088, + 3637.559, + 7154.347, + 6291.539, + 30770.05 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.249 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.926 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 27.0, + 22.0, + 36.0, + 50.0, + 47.0, + 51.0, + 18.048, + 70.5, + 13.746 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 14.0, + 24.0, + 29.0, + 21.0, + 28.0, + 10.212, + 61.7, + 8.237 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.987, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.975, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 10.213 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.574 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.012, + 0.114 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.022, + 0.102 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 11.116 + ] + } + }, + "wt_peptide": "EVEEAAAII" + } + }, + "transcripts": [ + "ENST00000292385.9-DBN1-E/K-280" + ], + "transcript_expr": [ + 2.226 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 651 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.226 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.226 + ], + "DNA VAF": 0.285, + "RNA VAF": 0.009, + "gene_expr": 109.087, + "best_peptide_mt": "EVEKAAAII", + "best_peptide_wt": "EVEEAAAII", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-3723707-3723708-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NGSEFPSQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 6331.993 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.648 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.248 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5567.435 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.2 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.659 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.125 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4803.56, + 23267.41, + 14252.45, + 7860.427, + 565.992, + 730.416, + 99.531, + 28193.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4735.08, + 18697.03, + 9245.51, + 6399.79, + 243.114, + 421.279, + 91.332, + 31736.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.111 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.106 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 12.0, + 15.0, + 28.0, + 6.3, + 7.4, + 0.311, + 55.05, + 0.154 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 7.8, + 8.7, + 23.0, + 3.2, + 5.0, + 0.266, + 64.36, + 0.152 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.052, + 0.959, + 0.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.054, + 0.98, + 0.14 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.248 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.125 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.123, + 0.002, + 0.488, + 0.027 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.096, + 0.001, + 0.535, + 0.056 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.45, + 0.847 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.57, + 0.747 + ] + } + }, + "wt_peptide": "NGSEFPSEL" + } + }, + "transcripts": [ + "ENST00000380283.5-PXDC1-E/Q-203" + ], + "transcript_expr": [ + 12.155 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 231 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 12.155 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 12.155 + ], + "DNA VAF": 0.418, + "RNA VAF": 0.539, + "gene_expr": 22.483, + "best_peptide_mt": "NGSEFPSQL", + "best_peptide_wt": "NGSEFPSEL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-10801907-10801908-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KPPTASQAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 30467.229 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 20.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 30.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.322 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.084 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 817.645 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.392 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.99 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.13 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.485 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26625.18, + 33358.75, + 25017.039, + 27575.707, + 87258.953, + 280265.719, + 501.357, + 33827.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 820.03, + 816.14, + 819.15, + 837.065, + 166.269, + 546.475, + 51.312, + 5647.93 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.689 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.054 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 25.0, + 30.0, + 68.0, + 66.0, + 81.0, + 1.65, + 70.36, + 5.629 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.19, + 0.3, + 0.99, + 1.3, + 2.4, + 6.0, + 0.06, + 12.78, + 0.126 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.971, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.977, + 0.07 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.084 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.485 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.002, + 0.368, + 0.332 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.467, + 0.021, + 0.85, + 0.349 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.5, + 1.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.06, + 0.199 + ] + } + }, + "wt_peptide": "KRPTASQAL" + } + }, + "transcripts": [ + "ENST00000354489.7-MAK-R/P-272" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 648 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.323, + "RNA VAF": 0.0, + "gene_expr": 0.038, + "best_peptide_mt": "KPPTASQAL", + "best_peptide_wt": "KRPTASQAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-29174125-29174126-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ISALHSSFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3364.601 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.115 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.453 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.423 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18024.981 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 20.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 29.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.994 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1553.7, + 7645.86, + 5016.94, + 5154.497, + 1632.338, + 1712.261, + 1159.193, + 23652.41 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17118.17, + 24340.2, + 26123.53, + 6539.788, + 4589.972, + 2828.59, + 18931.792, + 22442.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.936 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.913 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 2.7, + 4.8, + 18.0, + 14.0, + 14.0, + 3.123, + 44.6, + 1.399 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.0, + 13.0, + 31.0, + 23.0, + 23.0, + 18.0, + 33.385, + 42.02, + 8.07 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.938, + 0.077 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.959, + 0.023 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.423 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.994 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.002, + 0.092, + 0.067 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 3.107 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 46.225 + ] + } + }, + "wt_peptide": "ISALHSSFT" + } + }, + "transcripts": [ + "ENST00000641417.1-OR2J2-T/I-164", + "ENST00000377167.3-OR2J2-T/I-164" + ], + "transcript_expr": [ + 0.037, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 312, + 312 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.037 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.037 + ], + "DNA VAF": 0.277, + "RNA VAF": 0.0, + "gene_expr": 0.037, + "best_peptide_mt": "ISALHSSFI", + "best_peptide_wt": "ISALHSSFT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-29374537-29374538-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LYGPVGFTYI": { + "ic50s_MT": [ + "X", + "X", + "X", + 9119.172 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.604 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.611 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.412 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2751.205 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.79 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.342 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.125 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8280.34, + 38687.988, + 8478.89, + 9759.454, + "NA", + "NA", + 2328.074, + 14676.94 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3232.75, + 27584.95, + 2010.83, + 5681.683, + "NA", + "NA", + 514.833, + 2269.66 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.786 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.13 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 38.0, + 7.4, + 12.0, + "NA", + "NA", + 5.108, + 27.49, + 0.955 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.74, + 17.0, + 1.9, + 5.4, + "NA", + "NA", + 1.68, + 6.91, + 0.163 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.08, + 0.994, + 0.078 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.282, + 0.994, + 0.14 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.412 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.125 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.003, + 0.376, + 0.763 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.008, + 0.734, + 0.779 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 1.123 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 0.384 + ] + } + }, + "wt_peptide": "FYGPVGFTYI" + }, + "SHFMVVCLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1575.374 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.379 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.059 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.339 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.323 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5068.17 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.05 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.996 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.4 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.824 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "7", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2622.34, + 2770.48, + 598.54, + 1534.27, + 4157.287, + 1616.479, + 665.765, + 522.12 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5825.42, + 6869.65, + 1824.25, + 2751.985, + 11345.144, + 4310.92, + 2243.954, + 10607.49 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.593 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.048 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.59, + 0.86, + 0.78, + 3.3, + 22.0, + 14.0, + 2.059, + 2.77, + 0.594 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 2.5, + 2.0, + 7.6, + 35.0, + 23.0, + 4.996, + 20.71, + 1.745 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.96, + 0.089 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.956, + 0.048 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.824 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.067, + 0.003, + 0.19, + 0.154 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.001, + 0.075, + 0.187 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 1.898 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 3.599 + ] + } + }, + "wt_peptide": "SHFMVVCLF" + } + }, + "transcripts": [ + "ENST00000396806.3-OR12D3-F/L-250" + ], + "transcript_expr": [ + 0.001 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 316 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.001 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.001 + ], + "DNA VAF": 0.398, + "RNA VAF": 0.0, + "gene_expr": 0.006, + "best_peptide_mt": "LYGPVGFTYI", + "best_peptide_wt": "FYGPVGFTYI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-29726902-29726904-AA-CT": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YSVVSGLLM": { + "ic50s_MT": [ + "X", + "X", + "X", + 3204.153 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.2 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.146 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.175 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2164.716 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.833 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.203 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.807 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.165 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5810.43, + 4073.69, + 3911.67, + 2496.636, + 148.871, + 414.543, + 685.253, + 5822.8 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4852.82, + 1778.18, + 5238.84, + 2551.251, + 178.982, + 443.17, + 440.324, + 4645.21 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.543 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.369 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 1.4, + 3.8, + 6.6, + 2.2, + 4.9, + 2.092, + 13.06, + 4.394 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 0.54, + 5.0, + 6.8, + 2.5, + 5.2, + 1.482, + 11.17, + 3.203 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.042, + 0.993, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + 0.992, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.175 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.165 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.002, + 0.225, + 0.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.005, + 0.344, + 0.267 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.6, + 1.693 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.4, + 1.215 + ] + } + }, + "wt_peptide": "YSVVSGNLM" + }, + "AAYSVVSGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3225.582 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.625 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.402 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.65 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 22796.195 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 24.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 24.809 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.945 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1537.18, + 13365.13, + 5295.83, + 1904.939, + 4157.287, + 2293.876, + 71.793, + 24879.18 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31342.55, + 33798.71, + 34798.02, + 3167.617, + 14249.84, + 5502.626, + 11301.49, + 34490.59 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.578 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.005 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 5.0, + 5.0, + 4.6, + 22.0, + 16.0, + 0.162, + 47.31, + 0.574 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 26.0, + 49.0, + 9.2, + 38.0, + 25.0, + 16.855, + 72.36, + 9.29 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.044, + 0.995, + 0.057 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.049, + 0.994, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.945 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.238, + 0.011, + 0.616, + 0.085 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.009, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.22, + 0.585 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.0, + 27.617 + ] + } + }, + "wt_peptide": "AAYSVVSGN" + } + }, + "transcripts": [ + "ENST00000259951.12-HLA-F-N/L-353" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 442 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.648, + "RNA VAF": "NA", + "gene_expr": 74.251, + "best_peptide_mt": "YSVVSGLLM", + "best_peptide_wt": "YSVVSGNLM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-30986467-30986468-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FSTASSGIS": { + "ic50s_MT": [ + "X", + "X", + "X", + 15802.723 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 21.11 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.22 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 50.372 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 18.689 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16122.961 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 53.872 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.514 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28429.75, + 28148.16, + 32965.5, + 6262.789, + 1051.502, + 1298.883, + 21288.598, + 10316.85 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30699.49, + 31006.92, + 34798.02, + 8478.888, + 475.127, + 1460.73, + 21511.342, + 10734.58 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.502 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 17.0, + 44.0, + 22.0, + 9.4, + 12.0, + 41.926, + 20.22, + 45.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23.0, + 21.0, + 49.0, + 30.0, + 5.5, + 13.0, + 42.871, + 20.91, + 48.667 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.984, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.046, + 0.978, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 18.689 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.514 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.004 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 38.0, + 62.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45.0, + 62.745 + ] + } + }, + "wt_peptide": "FSTVSSGIS" + } + }, + "transcripts": [ + "ENST00000376296.3-MUC21-V/A-98" + ], + "transcript_expr": [ + 0.025 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 566 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.025 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.025 + ], + "DNA VAF": 0.662, + "RNA VAF": 0.0, + "gene_expr": 0.123, + "best_peptide_mt": "FSTASSGIS", + "best_peptide_wt": "FSTVSSGIS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-32181195-32181196-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ERAEMNQSEE": { + "ic50s_MT": [ + "X", + "X", + "X", + 23205.215 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 24.408 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 19.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 29.309 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 21.199 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 24499.635 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.34 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 26.79 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 28.101 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 37691.801, + 36779.73, + 17985.289, + 7287.077, + "NA", + "NA", + 11361.356, + 28425.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37559.09, + 38235.64, + 20926.8, + 8032.377, + "NA", + "NA", + 9846.685, + 28072.47 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.449 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 42.0, + 33.0, + 19.0, + 7.9, + "NA", + "NA", + 17.043, + 55.62, + 15.235 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 37.0, + 23.0, + 8.8, + "NA", + "NA", + 14.735, + 54.76, + 17.586 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.947, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + 0.975, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 21.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.101 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.009, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.005, + 0.01, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 31.0, + 27.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29.0, + 24.579 + ] + } + }, + "wt_peptide": "ERAELNQSEE" + } + }, + "transcripts": [ + "ENST00000375069.7-AGER-L/M-404" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 420 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.51, + "RNA VAF": 0.462, + "gene_expr": 2.211, + "best_peptide_mt": "ERAEMNQSEE", + "best_peptide_wt": "ERAELNQSEE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-33723018-33723020-CA-TG": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRALLSII": { + "ic50s_MT": [ + "X", + "X", + "X", + 4377.809 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.929 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.431 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3064.893 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.464 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.656 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.936 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.458 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5521.81, + 19308.24, + 2496.64, + 7054.341, + "NA", + "NA", + 3233.808, + 172.48 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4148.64, + 18692.58, + 1834.15, + 7527.491, + "NA", + "NA", + 1981.147, + 162.11 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.74 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.267 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 8.2, + 2.1, + 7.1, + "NA", + "NA", + 6.406, + 1.34, + 0.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.95, + 7.8, + 1.8, + 7.8, + "NA", + "NA", + 4.574, + 1.28, + 2.656 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.083, + "NA", + 0.032 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + "NA", + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.431 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.458 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.068, + 0.033, + 0.041 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.026, + 0.064, + 0.061, + 0.091 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 7.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 4.271 + ] + } + }, + "wt_peptide": "LRALLSVI" + } + }, + "transcripts": [ + "ENST00000293756.5-IP6K3-SV/SI-311-312" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 410 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.718, + "RNA VAF": "NA", + "gene_expr": 0.009, + "best_peptide_mt": "LRALLSII", + "best_peptide_wt": "LRALLSVI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-43283594-43283595-A-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SGGQALRSV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4397.388 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.7 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.972 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16713.902 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.096 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 30.096 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 10.507 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8502.04, + 9900.16, + 18082.85, + 3975.676, + 640.929, + 717.084, + 184.403, + 4819.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40620.91, + 29376.29, + 42280.1, + 7692.158, + 3418.299, + 1988.703, + 9096.574, + 24331.23 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.755 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.266 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 3.6, + 19.0, + 14.0, + 6.7, + 7.3, + 0.674, + 11.46, + 0.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 56.0, + 19.0, + 80.0, + 27.0, + 20.0, + 15.0, + 13.743, + 46.09, + 14.076 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.192, + 0.985, + 0.042 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.036, + 0.983, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.972 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10.507 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.034, + 0.384, + 0.077 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.011, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 1.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38.0, + 22.192 + ] + } + }, + "wt_peptide": "SGGQALRSE" + }, + "MSSGGQALRSV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4623.75 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.968 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.19 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.478 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.383 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 24809.27 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 44.721 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 46.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 44.809 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 43.443 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "11", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15345.09, + 31392.439, + 3567.97, + 4151.518, + "NA", + "NA", + 5095.982, + 1907.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41457.01, + 43900.04, + 33144.32, + 8032.377, + "NA", + "NA", + 12514.974, + 16474.22 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.45 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.875 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.1, + 22.0, + 3.1, + 3.4, + "NA", + "NA", + 8.781, + 6.19, + 17.599 + ] + }, + "WT": { + "HLA-C*06:02": [ + 61.0, + 64.0, + 46.0, + 8.5, + "NA", + "NA", + 18.921, + 30.62, + 61.882 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.127, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.069, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.383 + ] + }, + "WT": { + "HLA-C*06:02": [ + 43.443 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.361, + 0.027, + 0.108 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.044, + 0.008, + 0.012 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 9.8, + 9.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 62.0, + 27.617 + ] + } + }, + "wt_peptide": "MSSGGQALRSE" + } + }, + "transcripts": [ + "ENST00000259750.9-TTBK1-E/V-952" + ], + "transcript_expr": [ + 0.005 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1321 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.005 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.005 + ], + "DNA VAF": 0.267, + "RNA VAF": 0.0, + "gene_expr": 0.015, + "best_peptide_mt": "SGGQALRSV", + "best_peptide_wt": "SGGQALRSE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-43340177-43340178-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SSFRKFSWK": { + "ic50s_MT": [ + "X", + "X", + "X", + 13427.648 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.257 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.058 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.887 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9472.569 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 9.115 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.081 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.297 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 14844.55, + 28787.27, + 21852.381, + 9146.011, + 11345.144, + 12010.746, + 6769.031, + 35276.09 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12116.1, + 24310.45, + 21384.59, + 6829.038, + 2823.644, + 4983.908, + 2118.156, + 37438.21 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.185 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.646 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.8, + 18.0, + 24.0, + 32.0, + 35.0, + 36.0, + 10.821, + 74.79, + 12.515 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 13.0, + 24.0, + 24.0, + 18.0, + 24.0, + 4.813, + 81.65, + 5.231 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.995, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065, + 0.998, + 0.021 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.297 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.022, + 0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.003, + 0.301, + 0.643 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.0, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 1.363 + ] + } + }, + "wt_peptide": "SSFGKFSWK" + } + }, + "transcripts": [ + "ENST00000361428.3-ZNF318-G/R-1274" + ], + "transcript_expr": [ + 10.676 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2279 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 10.676 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 10.676 + ], + "DNA VAF": 0.347, + "RNA VAF": 0.377, + "gene_expr": 12.831, + "best_peptide_mt": "SSFRKFSWK", + "best_peptide_wt": "SSFGKFSWK", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-43587456-43587457-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YIEGLPQDP": { + "ic50s_MT": [ + "X", + "X", + "X", + 18779.564 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 32.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 32.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 43.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.939 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21800.404 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 36.18 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 38.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 34.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.847 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 43471.801, + 36930.852, + 39408.75, + 9346.083, + 2690.357, + 3922.564, + 16307.209, + 21251.92 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42295.2, + 42280.55, + 38774.32, + 11233.424, + 9116.119, + 11106.315, + 15618.148, + 27982.66 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.144 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.484 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 74.0, + 33.0, + 66.0, + 32.0, + 18.0, + 22.0, + 26.243, + 39.62, + 11.717 + ] + }, + "WT": { + "HLA-C*06:02": [ + 66.0, + 54.0, + 63.0, + 38.0, + 32.0, + 35.0, + 24.689, + 54.53, + 18.253 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.991, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.991, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.847 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 50.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32.0, + 37.359 + ] + } + }, + "wt_peptide": "YIEGLPQGP" + } + }, + "transcripts": [ + "ENST00000372236.9-POLH-G/D-153" + ], + "transcript_expr": [ + 3.654 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 713 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 3.654 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 3.654 + ], + "DNA VAF": 0.23, + "RNA VAF": 0.291, + "gene_expr": 12.57, + "best_peptide_mt": "YIEGLPQDP", + "best_peptide_wt": "YIEGLPQGP", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-46662451-46662452-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VEMQMEGKRKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 22929.869 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 15.243 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 16.486 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.573 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 31.208 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11640.723 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.418 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.948 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.61 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28811.26, + 23488.221, + 13575.13, + 32434.799, + "NA", + "NA", + 5869.412, + 22371.52 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27030.11, + 23474.26, + 5997.52, + 13212.856, + "NA", + "NA", + 1357.35, + 10068.59 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.392 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.043 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 13.0, + 14.0, + 42.0, + "NA", + "NA", + 9.734, + 41.88, + 16.486 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17.0, + 13.0, + 5.2, + 17.0, + "NA", + "NA", + 3.509, + 19.81, + 9.835 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 31.208 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.61 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.028, + 0.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.009, + 0.085, + 0.086 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.6, + 8.545 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.6, + 3.297 + ] + } + }, + "wt_peptide": "VQMQMEGKRKL" + } + }, + "transcripts": [ + "ENST00000371347.10-SLC25A27-Q/E-154" + ], + "transcript_expr": [ + 2.644 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 323 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.644 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.644 + ], + "DNA VAF": 0.484, + "RNA VAF": 0.521, + "gene_expr": 14.615, + "best_peptide_mt": "VEMQMEGKRKL", + "best_peptide_wt": "VQMQMEGKRKL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-47000271-47000272-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TRDSSDNIML": { + "ic50s_MT": [ + "X", + "X", + "X", + 1158.5 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.8 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.349 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.281 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 26213.375 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 22.753 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 30.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.725 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 14.129 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10084.49, + 16645.84, + 1158.05, + 893.209, + "NA", + "NA", + 1158.95, + 286.31 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37231.76, + 44106.2, + 25152.75, + 6903.328, + "NA", + "NA", + 4719.685, + 27274.0 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.491 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.549 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 6.6, + 1.3, + 0.3, + "NA", + "NA", + 3.123, + 1.88, + 3.987 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.0, + 65.0, + 30.0, + 7.3, + "NA", + "NA", + 8.303, + 52.82, + 19.506 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.951, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.968, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.281 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.129 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.005, + 0.191, + 0.307 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.046, + 0.246 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 1.898 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.0, + 5.449 + ] + } + }, + "wt_peptide": "TGDSSDNIML" + } + }, + "transcripts": [ + "ENST00000283297.5-ADGRF1-G/R-698" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 713 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.491, + "RNA VAF": 0.0, + "gene_expr": 0.655, + "best_peptide_mt": "TRDSSDNIML", + "best_peptide_wt": "TGDSSDNIML", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-55351464-55351465-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FCDCAQSHI": { + "ic50s_MT": [ + "X", + "X", + "X", + 10258.547 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 18.191 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.383 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 17.403 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 27.634 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10283.01 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 23.947 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 32.096 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 48.899 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "2,4", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28725.66, + 15316.72, + 25017.039, + 2751.985, + 2098.022, + 3986.3, + 5200.374, + 24359.93 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35784.26, + 11602.65, + 30068.96, + 2365.16, + 686.768, + 2231.362, + 8963.37, + 18654.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.438 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.784 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 5.9, + 30.0, + 7.6, + 16.0, + 22.0, + 8.92, + 46.15, + 17.383 + ] + }, + "WT": { + "HLA-C*06:02": [ + 35.0, + 4.3, + 38.0, + 6.1, + 7.1, + 16.0, + 13.61, + 34.58, + 25.701 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.973, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.969, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 27.634 + ] + }, + "WT": { + "HLA-C*06:02": [ + 48.899 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.019, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.011, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 12.805 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 22.192 + ] + } + }, + "wt_peptide": "FCDCAQSDI" + } + }, + "transcripts": [ + "ENST00000340465.2-GFRAL-D/H-195" + ], + "transcript_expr": [ + 0.013 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 394 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.013 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.013 + ], + "DNA VAF": 0.511, + "RNA VAF": 0.0, + "gene_expr": 0.013, + "best_peptide_mt": "FCDCAQSHI", + "best_peptide_wt": "FCDCAQSDI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-70190343-70190344-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VSFEEINKY": { + "ic50s_MT": [ + "X", + "X", + "X", + 1379.179 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.855 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.37 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.301 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1252.336 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.05 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.378 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.377 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5646.51, + 1990.7, + 4830.5, + 767.658, + 74.957, + 165.794, + 165.293, + 6931.77 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4851.82, + 3586.43, + 4651.0, + 666.931, + 79.033, + 113.912, + 145.296, + 1837.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.006 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 0.61, + 4.6, + 1.1, + 1.2, + 2.4, + 0.606, + 14.86, + 0.077 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 1.2, + 4.4, + 0.9, + 1.3, + 1.8, + 0.523, + 6.05, + 0.102 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.996, + 0.093 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + 0.992, + 0.082 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.377 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.162, + 0.175, + 0.723, + 0.452 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.233, + 0.245, + 0.65, + 0.319 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.4 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.23, + 0.526 + ] + } + }, + "wt_peptide": "VSFEEIKKY" + }, + "VSFEEINKYI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2718.375 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.267 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.375 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.129 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.166 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3295.2 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.61 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.762 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.61 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.925 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9106.32, + 15117.51, + 1039.29, + 1209.273, + "NA", + "NA", + 1611.15, + 3825.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10164.35, + 18239.86, + 1283.42, + 1170.651, + "NA", + "NA", + 2513.66, + 4076.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.396 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.591 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 5.8, + 1.2, + 0.5, + "NA", + "NA", + 3.939, + 9.8, + 3.375 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.9, + 7.5, + 1.4, + 0.5, + "NA", + "NA", + 5.378, + 10.24, + 4.762 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.984, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.036, + 0.978, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.166 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.925 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.016, + 0.09, + 0.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.007, + 0.057, + 0.136 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.1, + 3.159 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.7, + 4.519 + ] + } + }, + "wt_peptide": "VSFEEIKKYI" + }, + "SFEEINKYI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4522.356 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.15 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.407 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.67 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5130.917 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.143 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7653.55, + 6424.84, + 6262.79, + 2781.922, + 1103.596, + 1010.578, + 324.896, + 10688.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9257.02, + 7356.87, + 8664.37, + 2904.965, + 1948.992, + 1332.202, + 332.957, + 8714.78 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.081 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.051 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 2.3, + 5.7, + 7.7, + 9.6, + 9.2, + 1.138, + 20.83, + 1.845 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 2.6, + 8.2, + 8.1, + 15.0, + 12.0, + 1.171, + 17.66, + 1.753 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.948, + 0.056 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + 0.964, + 0.038 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.67 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.143 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + 0.001, + 0.287, + 0.109 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.003, + 0.256, + 0.071 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 1.543 + ] + } + }, + "wt_peptide": "SFEEIKKYI" + } + }, + "transcripts": [ + "ENST00000620364.5-COL19A1-K/N-1019" + ], + "transcript_expr": [ + 6.012 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1142 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 6.012 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 3 + ], + "set_expr": [ + 6.012 + ], + "DNA VAF": 0.255, + "RNA VAF": 0.269, + "gene_expr": 10.708, + "best_peptide_mt": "VSFEEINKY", + "best_peptide_wt": "VSFEEIKKY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-73363141-73363172-CTTGATTCACGTGAATCGATTGGACCCTAACG-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRSWYLGGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 847.28 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.193 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.028 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.165 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 751.7, + 2902.14, + 942.86, + 1304.419, + 121.846, + 154.373, + 161.426, + 27627.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.316 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.17, + 0.9, + 1.2, + 2.5, + 1.9, + 2.3, + 0.591, + 53.65, + 2.893 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.987, + 0.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.165 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.058, + 0.016, + 0.354, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.87, + 1.185 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000370367.4-KHDC3L-LIHVNRLDPNG/X-73-83" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 217 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.113, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "LRSWYLGGL", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-73363176-73363177-AG-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NGELRSWYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 9534.129 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.4 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.78 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.887 + ], + "ic50s_WT": [ + "X", + "X", + "X", + "NA" + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + "NA" + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "NA", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19485.779, + 12669.24, + 19932.311, + 5869.133, + 697.927, + 797.205, + 6399.019, + 16176.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.6, + 4.7, + 22.0, + 20.0, + 7.2, + 7.8, + 10.379, + 30.09, + 4.976 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.787, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA" + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.887 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA" + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.109, + 0.589 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA", + "NA", + "NA" + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.8, + 2.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + "NA", + "NA" + ] + } + }, + "wt_peptide": "FS-NA" + } + }, + "transcripts": [ + "ENST00000370367.4-KHDC3L-E/X-84" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 217 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.085, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "NGELRSWYL", + "best_peptide_wt": "NA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-109451607-109451608-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRLGVMRQPF": { + "ic50s_MT": [ + "X", + "X", + "X", + 6448.933 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.136 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.786 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.094 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6714.95 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.071 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.01 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.806 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4865.49, + 16724.539, + 3254.47, + 8032.377, + "NA", + "NA", + 2592.669, + 25737.59 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5132.52, + 18059.0, + 3529.57, + 8297.38, + "NA", + "NA", + 2083.75, + 29348.68 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.224 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.055 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 6.6, + 2.9, + 8.8, + "NA", + "NA", + 5.5, + 49.25, + 13.268 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 7.4, + 3.1, + 9.2, + "NA", + "NA", + 4.742, + 57.96, + 10.012 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.942, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.976, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.094 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.806 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + 0.001, + 0.045, + 0.071 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.028, + 0.002, + 0.058, + 0.086 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 5.672 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 4.519 + ] + } + }, + "wt_peptide": "LRLGVLRQPF" + } + }, + "transcripts": [ + "ENST00000358577.7-MICAL1-L/M-309" + ], + "transcript_expr": [ + 2.946 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 981 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.946 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.946 + ], + "DNA VAF": 0.981, + "RNA VAF": 1.0, + "gene_expr": 12.825, + "best_peptide_mt": "LRLGVMRQPF", + "best_peptide_wt": "LRLGVLRQPF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-118491773-118491774-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LAFTEKEVL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1999.32 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.472 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.463 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.278 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9632.973 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.206 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.426 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12078.79, + 2621.71, + 8571.13, + 1376.93, + 805.026, + 645.015, + 146.004, + 11534.12 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22612.2, + 13705.89, + 15795.37, + 5560.055, + 2381.277, + 2007.105, + 301.53, + 23291.48 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.705 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.6, + 0.84, + 8.1, + 2.7, + 7.9, + 6.7, + 0.529, + 22.22, + 3.344 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 5.1, + 17.0, + 19.0, + 17.0, + 15.0, + 1.077, + 43.81, + 5.782 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.037, + 0.984, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.059, + 0.916, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.278 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.426 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.015, + 0.595, + 0.254 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.007, + 0.263, + 0.054 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 0.625 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.9, + 1.512 + ] + } + }, + "wt_peptide": "LASTEKEVL" + }, + "FTEKEVLQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4267.528 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.613 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.29 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.816 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.426 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10063.904 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.099 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.246 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10109.84, + 4472.4, + 4856.71, + 4526.876, + 4062.656, + 2609.576, + 234.346, + 681.65 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19263.37, + 19370.59, + 11541.43, + 7366.349, + 8586.378, + 5656.789, + 567.01, + 15762.23 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.657 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.926 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.8, + 1.5, + 4.6, + 16.0, + 22.0, + 18.0, + 0.85, + 3.29, + 0.7 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.5, + 8.2, + 12.0, + 26.0, + 31.0, + 26.0, + 1.814, + 29.36, + 1.368 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.991, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.995, + 0.012 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.426 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.246 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.044, + 0.01, + 0.645, + 0.445 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.005, + 0.191, + 0.111 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 0.533 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 1.898 + ] + } + }, + "wt_peptide": "STEKEVLQL" + } + }, + "transcripts": [ + "ENST00000368491.8-CEP85L-S/F-450", + "ENST00000392500.7-CEP85L-S/F-453", + "ENST00000419517.2-CEP85L-S/F-450" + ], + "transcript_expr": [ + 5.216, + 0.698, + 0.644 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 1.0, + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 805, + 499, + 496 + ], + "transcript_count": 3, + "peptide_count": 2, + "total_expr": 6.558 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 6.558 + ], + "DNA VAF": 0.581, + "RNA VAF": 0.421, + "gene_expr": 16.147, + "best_peptide_mt": "LAFTEKEVL", + "best_peptide_wt": "LASTEKEVL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-122781239-122781240-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FFSSAHTSHL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2031.3 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.829 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.98 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.798 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.361 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1389.755 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.888 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.85 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.378 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.541 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2609.21, + 21822.609, + 1121.07, + 14882.824, + "NA", + "NA", + 1453.391, + 932.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1615.18, + 18540.5, + 1164.33, + 13212.856, + "NA", + "NA", + 564.077, + 279.71 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.686 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.615 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.58, + 9.9, + 1.3, + 19.0, + "NA", + "NA", + 3.678, + 3.98, + 23.033 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.35, + 7.7, + 1.3, + 17.0, + "NA", + "NA", + 1.799, + 1.85, + 21.092 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.074, + 0.965, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.065, + 0.951, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.361 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.541 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.004, + 0.085, + 0.105 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.061, + 0.012, + 0.186, + 0.1 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 3.297 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.83, + 1.927 + ] + } + }, + "wt_peptide": "FFSSPHTSHL" + }, + "SAHTSHLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3467.413 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.65 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.431 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.491 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 26102.945 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 22.488 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.976 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 5.726 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 39.281 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11022.13, + 16792.539, + 1904.94, + 4676.227, + "NA", + "NA", + 333.846, + 2258.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29619.48, + 34868.5, + 12183.0, + 38150.106, + "NA", + "NA", + 7381.923, + 22586.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.828 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.721 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.2, + 6.7, + 1.8, + 4.1, + "NA", + "NA", + 1.171, + 6.89, + 7.055 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 28.0, + 12.0, + 48.0, + "NA", + "NA", + 11.585, + 42.32, + 23.976 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.043, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.491 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.281 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.053, + 0.275, + 0.099 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.006, + 0.069, + 0.488 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.461 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.6, + 3.853 + ] + } + }, + "wt_peptide": "SPHTSHLL" + } + }, + "transcripts": [ + "ENST00000356535.4-FABP7-P/A-132" + ], + "transcript_expr": [ + 0.206 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 166 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.206 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.206 + ], + "DNA VAF": 0.362, + "RNA VAF": 0.0, + "gene_expr": 0.317, + "best_peptide_mt": "FFSSAHTSHL", + "best_peptide_wt": "FFSSPHTSHL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-152325133-152325134-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "AQDQKKIL": { + "ic50s_MT": [ + "X", + "X", + "X", + 13252.179 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.8 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 13.75 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.825 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 44.755 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16300.629 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 11.343 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.687 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.639 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.937 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 34795.77, + 31910.92, + 19295.699, + 7208.657, + "NA", + "NA", + 4682.176, + 6254.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38353.73, + 36384.31, + 24481.5, + 8119.757, + "NA", + "NA", + 7488.356, + 2733.89 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.961 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.318 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 32.0, + 22.0, + 20.0, + 7.3, + "NA", + "NA", + 8.239, + 13.75, + 8.686 + ] + }, + "WT": { + "HLA-C*06:02": [ + 45.0, + 32.0, + 28.0, + 8.6, + "NA", + "NA", + 11.687, + 7.81, + 2.903 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + "NA", + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 44.755 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.937 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.005, + 0.025, + 0.059 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.005, + 0.017, + 0.073 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.8, + 9.849 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 14.277 + ] + } + }, + "wt_peptide": "AQDQEKIL" + } + }, + "transcripts": [ + "ENST00000423061.6-SYNE1-E/K-5132" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 8749 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.323, + "RNA VAF": 0.286, + "gene_expr": 5.739, + "best_peptide_mt": "AQDQKKIL", + "best_peptide_wt": "AQDQEKIL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr6-157133135-157133136-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QMHAAISSF": { + "ic50s_MT": [ + "X", + "X", + "X", + 11576.119 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.033 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.294 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.666 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 11546.206 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.919 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.343 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.354 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13305.1, + 16255.87, + 11294.36, + 11857.879, + 3457.881, + 6420.517, + 2699.6, + 12745.83 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12790.44, + 18940.14, + 14023.0, + 10301.972, + 6292.308, + 6554.959, + 1602.693, + 15665.11 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.443 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.303 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 6.4, + 12.0, + 40.0, + 20.0, + 27.0, + 5.666, + 24.22, + 3.678 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 7.9, + 15.0, + 36.0, + 27.0, + 27.0, + 3.939, + 29.19, + 2.829 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.975, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.971, + 0.02 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.666 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.354 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.119, + 0.382 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.269, + 0.521 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 2.588 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.2, + 1.486 + ] + } + }, + "wt_peptide": "QMHAGISSF" + } + }, + "transcripts": [ + "ENST00000346085.10-ARID1B-G/A-910" + ], + "transcript_expr": [ + 0.097 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2332 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.097 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.097 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 39.757, + "best_peptide_mt": "QMHAAISSF", + "best_peptide_wt": "QMHAGISSF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-27130623-27130624-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GGPDGGPGY": { + "ic50s_MT": [ + "X", + "X", + "X", + 27343.545 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 24.319 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 41.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.956 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 26.638 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27697.79 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 29.374 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 47.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.532 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 31.749 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29694.57, + 42874.371, + 38150.109, + 6195.392, + 24992.518, + 17281.045, + 439.465, + 42460.031 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29717.06, + 45051.04, + 40053.56, + 7692.158, + 25107.877, + 25678.521, + 503.476, + 41993.83 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.281 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.518 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 57.0, + 60.0, + 22.0, + 47.0, + 41.0, + 1.469, + 97.15, + 14.365 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 72.0, + 69.0, + 27.0, + 47.0, + 47.0, + 1.65, + 96.01, + 18.904 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.897, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.957, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 26.638 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31.749 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.174, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.157, + 0.011 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.9, + 2.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.9, + 2.164 + ] + } + }, + "wt_peptide": "GGPGGGPGY" + } + }, + "transcripts": [ + "ENST00000610970.1-HOXA4-G/D-37" + ], + "transcript_expr": [ + 0.53 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 320 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.53 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.53 + ], + "DNA VAF": 0.375, + "RNA VAF": 0.375, + "gene_expr": 1.689, + "best_peptide_mt": "GGPDGGPGY", + "best_peptide_wt": "GGPGGGPGY", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-39339738-39339739-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "STNHHPQPA": { + "ic50s_MT": [ + "X", + "X", + "X", + 6946.793 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.078 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.028 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.798 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6989.125 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.905 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.297 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.897 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10199.38, + 29007.381, + 12930.01, + 9047.587, + 3249.451, + 3448.022, + 4208.006, + 4846.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10164.02, + 21092.06, + 11294.36, + 8297.38, + 598.15, + 947.48, + 3681.317, + 5680.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.695 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.513 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.9, + 18.0, + 14.0, + 32.0, + 19.0, + 20.0, + 7.658, + 11.5, + 5.686 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.9, + 9.4, + 12.0, + 29.0, + 6.4, + 8.8, + 7.01, + 12.84, + 4.155 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.997, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.978, + 0.017 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.798 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.897 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.0, + 0.023, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.026, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.4, + 10.656 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 9.494 + ] + } + }, + "wt_peptide": "STNQHPQPA" + } + }, + "transcripts": [ + "ENST00000518318.7-POU6F2-Q/H-232" + ], + "transcript_expr": [ + 0.001 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 720 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.001 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.001 + ], + "DNA VAF": 0.299, + "RNA VAF": 0.0, + "gene_expr": 0.273, + "best_peptide_mt": "STNHHPQPA", + "best_peptide_wt": "STNQHPQPA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-47833094-47833095-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HIQAPSSGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 19918.506 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 25.509 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 28.671 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.315 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 27.019 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 15932.228 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.572 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 21.143 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.225 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 21.447 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20481.26, + 29347.699, + 21852.381, + 8853.904, + 19355.75, + 16926.611, + 2696.465, + 22043.23 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12158.91, + 26546.08, + 15541.08, + 8297.38, + 16323.377, + 17201.646, + 2881.889, + 32460.78 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.893 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.617 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.4, + 19.0, + 24.0, + 31.0, + 43.0, + 41.0, + 5.666, + 41.19, + 28.671 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 15.0, + 16.0, + 29.0, + 40.0, + 41.0, + 5.919, + 66.4, + 21.143 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.985, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.974, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 27.019 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.447 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.06, + 0.171 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.0, + 0.046, + 0.111 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.3, + 4.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.0, + 5.449 + ] + } + }, + "wt_peptide": "HTQAPSSGL" + } + }, + "transcripts": [ + "ENST00000289672.7-PKD1L1-T/I-2111" + ], + "transcript_expr": [ + 0.007 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2849 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.007 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.007 + ], + "DNA VAF": 0.322, + "RNA VAF": 0.0, + "gene_expr": 0.696, + "best_peptide_mt": "HIQAPSSGL", + "best_peptide_wt": "HTQAPSSGL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-77600798-77600799-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IYCSAGCGRT": { + "ic50s_MT": [ + "X", + "X", + "X", + 28165.088 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 48.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 46.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 52.872 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 57.592 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 31538.18 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 54.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 52.026 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 58.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 65.102 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "3,7", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 38684.219, + 46747.301, + 34986.781, + 20813.898, + "NA", + "NA", + 21343.395, + 13703.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38726.95, + 47900.86, + 24349.41, + 45854.107, + "NA", + "NA", + 23433.565, + 23062.78 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.747 + ] + }, + "WT": { + "HLA-C*06:02": [ + -4.424 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 46.0, + 87.0, + 51.0, + 28.0, + "NA", + "NA", + 41.926, + 25.82, + 57.369 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46.0, + 98.0, + 28.0, + 54.0, + "NA", + "NA", + 52.026, + 43.33, + 79.408 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.983, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.987, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 57.592 + ] + }, + "WT": { + "HLA-C*06:02": [ + 65.102 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.004 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 43.0, + 62.745 + ] + }, + "WT": { + "HLA-C*06:02": [ + 54.0, + 62.745 + ] + } + }, + "wt_peptide": "IHCSAGCGRT" + } + }, + "transcripts": [ + "ENST00000248594.11-PTPN12-H/Y-230" + ], + "transcript_expr": [ + 14.21 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 780 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 14.21 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 14.21 + ], + "DNA VAF": 0.203, + "RNA VAF": 0.161, + "gene_expr": 128.676, + "best_peptide_mt": "IYCSAGCGRT", + "best_peptide_wt": "IHCSAGCGRT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-82908982-82908983-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DSFDKPRESRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5570.197 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.804 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.648 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.092 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 24.22 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18279.6 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.79 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 28.466 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21401.48, + 29999.74, + 4478.16, + 4936.173, + "NA", + "NA", + 6204.221, + 1793.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 25264.84, + 34449.61, + 11294.36, + 26407.712, + "NA", + "NA", + 5846.489, + 7137.09 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.878 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.058 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.1, + 20.0, + 3.9, + 4.4, + "NA", + "NA", + 10.133, + 5.96, + 7.648 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14.0, + 27.0, + 12.0, + 35.0, + "NA", + "NA", + 9.659, + 15.19, + 10.07 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 24.22 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28.466 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.002, + 0.089, + 0.516 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.001, + 0.074, + 0.443 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.0, + 3.185 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 3.679 + ] + } + }, + "wt_peptide": "DWFDKPRESRL" + } + }, + "transcripts": [ + "ENST00000333891.14-PCLO-W/S-4444" + ], + "transcript_expr": [ + 0.037 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 5142 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.037 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.037 + ], + "DNA VAF": 0.409, + "RNA VAF": 0.567, + "gene_expr": 4.482, + "best_peptide_mt": "DSFDKPRESRL", + "best_peptide_wt": "DWFDKPRESRL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-82916602-82916603-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EIYAKLRYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 700.483 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.89 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.451 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.173 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2134.793 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.48 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.331 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1063.05, + 253.06, + 1354.76, + 2579.005, + 337.917, + 317.373, + 299.335, + 2631.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14184.3, + 2614.6, + 7860.43, + 1654.986, + 342.618, + 417.417, + 399.217, + 3579.32 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.126 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.001 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.25, + 0.11, + 1.6, + 6.9, + 4.1, + 3.9, + 1.067, + 7.61, + 0.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.5, + 0.83, + 7.4, + 3.6, + 4.2, + 4.9, + 1.363, + 9.36, + 1.597 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.035, + 0.987, + 0.122 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.99, + 0.034 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.173 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.331 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.274, + 0.242, + 0.552, + 0.403 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.002, + 0.302, + 0.185 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.19, + 0.713 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 1.36 + ] + } + }, + "wt_peptide": "EIDAKLRYL" + }, + "IYAKLRYL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3503.48 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.55 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.213 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.053 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21167.33 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 15.428 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.855 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.196 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.024 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5259.97, + 6416.92, + 1746.99, + 10992.949, + "NA", + "NA", + 888.713, + 78.96 + ] + }, + "WT": { + "HLA-C*06:02": [ + 28692.42, + 24829.35, + 17505.31, + 50000.0, + "NA", + "NA", + 11293.956, + 401.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.338 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.882 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 2.3, + 1.7, + 14.0, + "NA", + "NA", + 2.551, + 0.76, + 0.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.0, + 14.0, + 18.0, + 58.0, + "NA", + "NA", + 16.855, + 2.34, + 1.232 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.192, + "NA", + 0.182 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + "NA", + 0.041 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.024 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.093, + 0.174, + 0.199, + 0.248 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.016, + 0.011, + 0.066 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.58, + 1.845 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.2, + 22.192 + ] + } + }, + "wt_peptide": "IDAKLRYL" + } + }, + "transcripts": [ + "ENST00000437081.1-PCLO-D/Y-515", + "ENST00000423517.6-PCLO-D/Y-3795" + ], + "transcript_expr": [ + 0.832, + 2.087 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 1217, + 4935 + ], + "transcript_count": 2, + "peptide_count": 2, + "total_expr": 2.919 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 2.919 + ], + "DNA VAF": 0.222, + "RNA VAF": 0.171, + "gene_expr": 4.482, + "best_peptide_mt": "EIYAKLRYL", + "best_peptide_wt": "EIDAKLRYL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-87424004-87424005-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KKTEWPYFV": { + "ic50s_MT": [ + "X", + "X", + "X", + 5776.777 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.329 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.165 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.088 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3681.226 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.17 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.901 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.076 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1246.83, + 4873.13, + 6229.0, + 5324.554, + 19489.918, + 9132.086, + 1944.483, + 14842.51 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1718.92, + 3728.04, + 4909.54, + 6755.548, + 2237.742, + 1131.28, + 3634.413, + 5709.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.454 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.398 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.29, + 1.7, + 5.7, + 18.0, + 43.0, + 32.0, + 4.539, + 27.77, + 0.411 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.37, + 1.3, + 4.7, + 24.0, + 16.0, + 9.8, + 6.901, + 12.88, + 0.353 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.152, + 0.997, + 0.159 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.288, + 0.996, + 0.167 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.088 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.076 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.259, + 0.281, + 0.162, + 0.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.153, + 0.26, + 0.075, + 0.318 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.21, + 2.12 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.36, + 3.639 + ] + } + }, + "wt_peptide": "NKTEWPYFV" + } + }, + "transcripts": [ + "ENST00000649586.2-ABCB4-N/K-704" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1279 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.181, + "RNA VAF": 0.0, + "gene_expr": 0.044, + "best_peptide_mt": "KKTEWPYFV", + "best_peptide_wt": "NKTEWPYFV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-92077866-92077867-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LKITTHNKV": { + "ic50s_MT": [ + "X", + "X", + "X", + 11726.369 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 11.713 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.44 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 6.108 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.8 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 15646.735 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 14.238 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 23.23 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 7.22 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.557 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5922.97, + 15866.8, + 22818.9, + 7860.427, + 62778.363, + 14241.968, + 8002.714, + 9210.77 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16937.8, + 14355.67, + 28178.94, + 9447.755, + 88472.846, + 19300.564, + 12991.961, + 12147.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.112 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.063 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.5, + 6.1, + 26.0, + 28.0, + 61.0, + 38.0, + 12.311, + 18.44, + 1.943 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.9, + 5.4, + 35.0, + 33.0, + 67.0, + 43.0, + 19.636, + 23.23, + 1.789 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + 0.98, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.989, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.8 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.557 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + 0.001, + 0.021, + 0.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.027, + 0.366 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.6, + 8.839 + ] + } + }, + "wt_peptide": "LKITTDNKV" + } + }, + "transcripts": [ + "ENST00000356239.8-AKAP9-D/H-2313" + ], + "transcript_expr": [ + 7.05 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3907 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.05 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.05 + ], + "DNA VAF": 0.412, + "RNA VAF": 0.408, + "gene_expr": 36.25, + "best_peptide_mt": "LKITTHNKV", + "best_peptide_wt": "LKITTDNKV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-97006043-97006044-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SSKSAFMQF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4357.518 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.241 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 15.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.933 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.482 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3597.798 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.411 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.572 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.982 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4081.37, + 26124.939, + 15541.08, + 4242.334, + 2970.366, + 4472.702, + 604.886, + 31769.779 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3741.58, + 23692.94, + 12117.27, + 3454.017, + 1275.881, + 2579.705, + 328.389, + 21756.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.604 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.598 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.93, + 15.0, + 16.0, + 15.0, + 19.0, + 23.0, + 1.913, + 64.45, + 4.863 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.86, + 13.0, + 13.0, + 12.0, + 12.0, + 18.0, + 1.149, + 40.62, + 4.822 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.972, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.977, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.482 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.982 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.117, + 0.001, + 0.292, + 0.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.1, + 0.001, + 0.616, + 0.502 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.47, + 1.395 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.56, + 0.585 + ] + } + }, + "wt_peptide": "SSKSAFMEF" + } + }, + "transcripts": [ + "ENST00000518156.3-DLX6-E/Q-23" + ], + "transcript_expr": [ + 2.233 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 293 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 2.233 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 2.233 + ], + "DNA VAF": 0.411, + "RNA VAF": 0.424, + "gene_expr": 2.584, + "best_peptide_mt": "SSKSAFMQF", + "best_peptide_wt": "SSKSAFMEF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-102317255-102317256-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FRGTLSRV": { + "ic50s_MT": [ + "X", + "X", + "X", + 943.696 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.685 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.65 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.149 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.346 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7891.132 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.651 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.108 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.777 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2875.63, + 2140.76, + 319.56, + 1567.832, + "NA", + "NA", + 235.155, + 19.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14526.77, + 26428.58, + 1728.19, + 12382.344, + "NA", + "NA", + 3399.921, + 711.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.077 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.65, + 0.67, + 0.39, + 0.7, + "NA", + "NA", + 0.861, + 0.21, + 0.159 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.7, + 15.0, + 1.7, + 16.0, + "NA", + "NA", + 6.602, + 3.37, + 1.834 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.339, + "NA", + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.067, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.346 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.777 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + 0.313, + 0.35, + 0.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.046, + 0.031, + 0.034 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 8.016 + ] + } + }, + "wt_peptide": "FHGTLSRV" + }, + "FRGTLSRVK": { + "ic50s_MT": [ + "X", + "X", + "X", + 1750.018 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.143 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.707 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.606 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18726.335 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.496 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.632 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7545.84, + 928.57, + 4358.65, + 2264.981, + 635.053, + 467.272, + 1235.056, + 8154.47 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19348.39, + 19373.74, + 9096.67, + 17888.25, + 338695.947, + 40979.816, + 2867.03, + 18104.28 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.766 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.603 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.0, + 0.34, + 4.2, + 5.8, + 6.7, + 5.4, + 3.272, + 16.76, + 0.91 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.5, + 8.2, + 8.5, + 54.0, + 83.0, + 55.0, + 5.919, + 33.58, + 4.861 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.073, + 0.993, + 0.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.032, + 0.985, + 0.018 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.606 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.632 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.004, + 0.096, + 0.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.037, + 0.039 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 3.014 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.2, + 6.793 + ] + } + }, + "wt_peptide": "FHGTLSRVK" + } + }, + "transcripts": [ + "ENST00000444095.3-SH2B2-H/R-419" + ], + "transcript_expr": [ + 2.562 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 632 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 2.562 + }, + "Transcript Set 2": { + "peptides": { + "FRGTLSRV": { + "ic50s_MT": [ + "X", + "X", + "X", + 943.696 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.685 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.65 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.149 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.346 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7891.132 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.651 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 6.108 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.777 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2875.63, + 2140.76, + 319.56, + 1567.832, + "NA", + "NA", + 235.155, + 19.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14526.77, + 26428.58, + 1728.19, + 12382.344, + "NA", + "NA", + 3399.921, + 711.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.077 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.65, + 0.67, + 0.39, + 0.7, + "NA", + "NA", + 0.861, + 0.21, + 0.159 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.7, + 15.0, + 1.7, + 16.0, + "NA", + "NA", + 6.602, + 3.37, + 1.834 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.339, + "NA", + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.067, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.346 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.777 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + 0.313, + 0.35, + 0.102 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.046, + 0.031, + 0.034 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 8.016 + ] + } + }, + "wt_peptide": "FHGTLSRV" + } + }, + "transcripts": [ + "ENST00000536178.3-SH2B2-H/R-462" + ], + "transcript_expr": [ + 1.903 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 675 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.903 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 1, + 1 + ], + "peptide_counts": [ + 2, + 1 + ], + "set_expr": [ + 2.562, + 1.903 + ], + "DNA VAF": 0.181, + "RNA VAF": 0.223, + "gene_expr": 6.055, + "best_peptide_mt": "FRGTLSRV", + "best_peptide_wt": "FHGTLSRV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-112342710-112342711-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SSIFNQLLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1525.098 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.4 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.043 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2320.805 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.671 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.276 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.241 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3327.89, + 7275.89, + 3626.35, + 1967.786, + 468.608, + 458.744, + 347.947, + 1082.41 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4739.59, + 8670.84, + 3745.99, + 2365.16, + 279.776, + 330.043, + 334.365, + 2276.45 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.636 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.644 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.77, + 2.6, + 3.6, + 4.8, + 5.4, + 5.3, + 1.214, + 4.36, + 0.664 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 3.1, + 3.7, + 6.1, + 3.6, + 4.1, + 1.171, + 6.93, + 0.678 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.091, + 0.988, + 0.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.048, + 0.987, + 0.021 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.2 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.241 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.004, + 0.517, + 0.403 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.036, + 0.003, + 0.332, + 0.176 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 0.786 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 1.253 + ] + } + }, + "wt_peptide": "SSILNQLLL" + }, + "QSSIFNQLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4030.513 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.965 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.615 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.327 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4359.85 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.75 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 10.59 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.377 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.854 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8319.85, + 13389.14, + 8758.62, + 3606.785, + 1008.811, + 1092.874, + 1029.232, + 4454.24 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12685.97, + 21445.98, + 11172.82, + 4429.969, + 1488.71, + 2035.026, + 1395.601, + 4289.73 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.642 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.801 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 5.0, + 8.3, + 12.0, + 9.2, + 9.6, + 2.866, + 10.87, + 0.675 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.9, + 9.6, + 12.0, + 15.0, + 13.0, + 15.0, + 3.567, + 10.59, + 0.987 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.96, + 0.089 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.05, + 0.951, + 0.047 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.327 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.854 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.006, + 0.1, + 0.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.006, + 0.08, + 0.075 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 2.931 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 3.454 + ] + } + }, + "wt_peptide": "QSSILNQLL" + } + }, + "transcripts": [ + "ENST00000361822.8-ZNF277-L/F-445" + ], + "transcript_expr": [ + 9.179 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 450 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 9.179 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 9.179 + ], + "DNA VAF": 0.434, + "RNA VAF": 0.347, + "gene_expr": 58.592, + "best_peptide_mt": "SSIFNQLLL", + "best_peptide_wt": "SSILNQLLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-112821984-112821985-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FRKISLKTK": { + "ic50s_MT": [ + "X", + "X", + "X", + 4171.512 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.106 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.766 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.703 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1550.388 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.323 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.446 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.377 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.84 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8384.74, + 5012.06, + 9812.39, + 1904.939, + 15624.64, + 3330.964, + 1137.545, + 3243.55 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3761.55, + 1701.8, + 6829.04, + 476.884, + 1398.975, + 185.597, + 2196.893, + 25.52 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.864 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.951 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.2, + 1.7, + 9.3, + 4.6, + 40.0, + 20.0, + 3.079, + 8.76, + 1.178 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.86, + 0.53, + 6.2, + 0.5, + 13.0, + 2.6, + 4.925, + 0.28, + 1.446 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + 0.995, + 0.054 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.083, + 0.989, + 0.047 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.703 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.84 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.002, + 0.09, + 0.057 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.041, + 0.006, + 0.046, + 0.032 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 3.133 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 5.555 + ] + } + }, + "wt_peptide": "FRKISLKTT" + } + }, + "transcripts": [ + "ENST00000297145.9-BMT2-T/K-326" + ], + "transcript_expr": [ + 11.797 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 405 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 11.797 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 11.797 + ], + "DNA VAF": 0.179, + "RNA VAF": 0.188, + "gene_expr": 34.269, + "best_peptide_mt": "FRKISLKTK", + "best_peptide_wt": "FRKISLKTT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-117548739-117548740-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FFSNFSLLC": { + "ic50s_MT": [ + "X", + "X", + "X", + 4356.166 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.372 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.045 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 9.008 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.629 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6952.814 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.016 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 26.18 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.755 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "9", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18129.68, + 5874.41, + 7568.32, + 4382.296, + 392.473, + 432.086, + 4330.035, + 986.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13931.06, + 9178.53, + 17410.87, + 4727.097, + 392.473, + 469.429, + 16267.305, + 1273.8 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.789 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.7, + 2.1, + 7.0, + 15.0, + 4.6, + 5.1, + 7.824, + 4.12, + 6.045 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.4, + 3.3, + 19.0, + 16.0, + 4.6, + 5.4, + 26.243, + 4.81, + 6.632 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.219, + 0.982, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.21, + 0.969, + 0.027 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.629 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.755 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.022, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.006 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.9, + 11.116 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.0, + 37.359 + ] + } + }, + "wt_peptide": "FFSNFSLLG" + } + }, + "transcripts": [ + "ENST00000003084.11-CFTR-G/C-437" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1480 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.116, + "RNA VAF": 0.0, + "gene_expr": 1.844, + "best_peptide_mt": "FFSNFSLLC", + "best_peptide_wt": "FFSNFSLLG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-122013415-122013416-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MSDSDTHENSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4575.965 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.875 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.75 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.404 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 25.067 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8799.347 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.094 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 18.094 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 26.029 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 33790.301, + 36060.59, + 5353.44, + 2635.422, + "NA", + "NA", + 3103.687, + 3798.49 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36050.84, + 36689.5, + 8252.61, + 9346.083, + "NA", + "NA", + 5560.153, + 3703.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.209 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.279 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 30.0, + 31.0, + 4.6, + 1.5, + "NA", + "NA", + 6.22, + 9.75, + 38.56 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.0, + 32.0, + 7.4, + 11.0, + "NA", + "NA", + 9.349, + 9.58, + 40.859 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 25.067 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.029 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.003, + 0.054, + 0.175 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.02, + 0.039 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 4.807 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 12.187 + ] + } + }, + "wt_peptide": "MNDSDTHENSL" + } + }, + "transcripts": [ + "ENST00000651863.1-PTPRZ1-N/S-1457", + "ENST00000651320.1-PTPRZ1-N/S-1457", + "ENST00000650681.1-PTPRZ1-N/S-1201", + "ENST00000651390.1-PTPRZ1-N/S-1011", + "ENST00000651842.1-PTPRZ1-N/S-1011" + ], + "transcript_expr": [ + 0.0, + 0.0, + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + false, + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false, + false + ], + "tsl": [ + "NA", + "NA", + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 2354, + 2347, + 2059, + 1908, + 1908 + ], + "transcript_count": 5, + "peptide_count": 1, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "YRESQEKVMSD": { + "ic50s_MT": [ + "X", + "X", + "X", + 8776.385 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 20.911 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 31.322 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 33.754 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10966.975 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 19.84 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.647 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 35.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 23.68 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 35173.52, + 5885.79, + 11666.98, + 2240.607, + "NA", + "NA", + 13985.635, + 590.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37735.07, + 6392.87, + 15541.08, + 2122.613, + "NA", + "NA", + 15645.036, + 2252.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.587 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.958 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 34.0, + 2.1, + 12.0, + 1.1, + "NA", + "NA", + 21.487, + 3.0, + 20.334 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42.0, + 2.3, + 16.0, + 1.0, + "NA", + "NA", + 24.689, + 6.88, + 8.647 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 33.754 + ] + }, + "WT": { + "HLA-C*06:02": [ + 23.68 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.005, + 0.007, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.004, + 0.006, + 0.007 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 31.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.0, + 37.359 + ] + } + }, + "wt_peptide": "YRESQEKVMND" + } + }, + "transcripts": [ + "ENST00000393386.7-PTPRZ1-N/S-1457" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2315 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 5, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 0.0, + 0.0 + ], + "DNA VAF": 0.241, + "RNA VAF": 0.0, + "gene_expr": 0.909, + "best_peptide_mt": "YRESQEKVMSD", + "best_peptide_wt": "YRESQEKVMND", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-128815875-128815876-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "CSLESPEEN": { + "ic50s_MT": [ + "X", + "X", + "X", + 18620.033 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 31.052 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 28.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 43.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.46 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 15643.091 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 26.116 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 26.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 28.153 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 26.231 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "1", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 42138.98, + 34978.07, + 38357.051, + 6755.547, + 1839.967, + 3780.681, + 13028.316, + 24211.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41958.81, + 34048.68, + 34798.02, + 6062.767, + 740.986, + 1123.492, + 7209.902, + 24076.28 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.051 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.809 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 65.0, + 28.0, + 61.0, + 24.0, + 15.0, + 21.0, + 19.636, + 45.84, + 33.504 + ] + }, + "WT": { + "HLA-C*06:02": [ + 64.0, + 26.0, + 49.0, + 21.0, + 7.5, + 9.7, + 11.389, + 45.52, + 26.39 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.979, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.974, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.46 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.231 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.008, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.013, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 56.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 39.0, + 17.306 + ] + } + }, + "wt_peptide": "SSLESPEEN" + } + }, + "transcripts": [ + "ENST00000297788.9-CCDC136-S/C-1103" + ], + "transcript_expr": [ + 0.018 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1154 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.018 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.018 + ], + "DNA VAF": 0.2, + "RNA VAF": 0.25, + "gene_expr": 4.998, + "best_peptide_mt": "CSLESPEEN", + "best_peptide_wt": "SSLESPEEN", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-132508196-132508197-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HYLSGVNEI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3428.469 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.68 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.212 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.455 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16127.559 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 16.653 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 19.02 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.603 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.646 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2301.12, + 2723.22, + 3529.57, + 3416.846, + 7530.26, + 3440.092, + 68.315, + 14311.77 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26446.6, + 22898.29, + 28026.9, + 6062.767, + 21174.346, + 11080.772, + 8291.273, + 9575.66 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.346 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.51, + 0.85, + 3.5, + 11.0, + 29.0, + 20.0, + 0.148, + 26.86, + 0.169 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 12.0, + 34.0, + 21.0, + 44.0, + 35.0, + 12.767, + 19.02, + 3.05 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.096, + 0.98, + 0.073 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.987, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.455 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.646 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.181, + 0.012, + 0.906, + 0.577 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.013, + 0.037 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.31, + 0.113 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.9, + 17.306 + ] + } + }, + "wt_peptide": "HYLSGVNES" + } + }, + "transcripts": [ + "ENST00000321063.9-PLXNA4-S/I-166" + ], + "transcript_expr": [ + 0.203 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1894 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.203 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.203 + ], + "DNA VAF": 0.281, + "RNA VAF": 0.0, + "gene_expr": 0.575, + "best_peptide_mt": "HYLSGVNEI", + "best_peptide_wt": "HYLSGVNES", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-140024672-140024681-TCAAAGATCA-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SVSDPSIFE": { + "ic50s_MT": [ + "X", + "X", + "X", + 12999.516 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.981 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.373 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1520.176 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.666 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.46 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.851 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.577 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 34552.27, + 26637.869, + 34423.539, + 5044.154, + 1516.387, + 921.658, + 7280.813, + 18718.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2884.17, + 5525.33, + 3665.8, + 2607.061, + 284.322, + 332.33, + 349.519, + 433.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.426 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.914 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 32.0, + 15.0, + 48.0, + 17.0, + 13.0, + 8.7, + 11.485, + 34.71, + 17.147 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.65, + 2.0, + 3.6, + 7.0, + 3.6, + 4.1, + 1.214, + 2.46, + 1.332 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + 0.98, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.088, + 0.961, + 0.062 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.373 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.577 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.035, + 0.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.124, + 0.001, + 0.33, + 0.185 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 6.963 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.44, + 1.263 + ] + } + }, + "wt_peptide": "SVSDPSIFV" + } + }, + "transcripts": [ + "ENST00000263549.8-PARP12-VIFE/E-662-665" + ], + "transcript_expr": [ + 13.516 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 701 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 13.516 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 13.516 + ], + "DNA VAF": 0.108, + "RNA VAF": 0.153, + "gene_expr": 29.767, + "best_peptide_mt": "SVSDPSIFE", + "best_peptide_wt": "SVSDPSIFV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-151181249-151181250-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VRCQSITNA": { + "ic50s_MT": [ + "X", + "X", + "X", + 1743.54 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.027 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.769 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2275.96 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.983 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 12.259 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.29 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "3", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 8866.27, + 5253.93, + 8342.39, + 1209.273, + 113.713, + 68.639, + 2277.807, + 35.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15325.5, + 3406.33, + 11112.54, + 1145.591, + 48.508, + 44.317, + 7760.876, + 8.2 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.367 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.58 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.4, + 1.9, + 7.9, + 2.2, + 1.8, + 1.2, + 5.034, + 0.38, + 3.186 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.1, + 1.2, + 12.0, + 2.0, + 0.9, + 0.8, + 11.988, + 0.06, + 4.676 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.976, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.959, + 0.015 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.769 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.29 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.0, + 0.046, + 0.042 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.013, + 0.004 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 5.555 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.9, + 18.618 + ] + } + }, + "wt_peptide": "VRCQSITDA" + } + }, + "transcripts": [ + "ENST00000420175.3-ASB10-D/N-265", + "ENST00000377867.7-ASB10-D/N-250" + ], + "transcript_expr": [ + 0.0, + 0.0 + ], + "mane_select": [ + true, + false + ], + "canonical": [ + true, + false + ], + "tsl": [ + 1.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 467, + 452 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "ITNAEATTA": { + "ic50s_MT": [ + "X", + "X", + "X", + 11080.185 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.859 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 15.616 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.246 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16671.474 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 19.985 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 24.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 13.639 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 19.579 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 20631.83, + 32745.449, + 22090.1, + 7609.379, + 13237.623, + 8681.005, + 8922.748, + 1034.8 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31394.8, + 37728.13, + 27575.71, + 3932.892, + 20082.14, + 13260.808, + 6583.728, + 3287.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.918 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.589 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 8.5, + 24.0, + 25.0, + 27.0, + 37.0, + 31.0, + 13.487, + 4.24, + 8.128 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.0, + 35.0, + 34.0, + 14.0, + 44.0, + 37.0, + 10.549, + 8.84, + 20.391 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.966, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.973, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.246 + ] + }, + "WT": { + "HLA-C*06:02": [ + 19.579 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.011, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.017, + 0.042 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.0, + 14.277 + ] + } + }, + "wt_peptide": "ITDAEATTA" + } + }, + "transcripts": [ + "ENST00000275838.5-ASB10-D/N-265" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 429 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2" + ], + "transcript_counts": [ + 2, + 1 + ], + "peptide_counts": [ + 1, + 1 + ], + "set_expr": [ + 0.0, + 0.0 + ], + "DNA VAF": 0.153, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "ITNAEATTA", + "best_peptide_wt": "ITDAEATTA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr7-155462475-155462476-A-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FRTNRYLTE": { + "ic50s_MT": [ + "X", + "X", + "X", + 1085.05 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.85 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.7 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.065 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.599 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13282.926 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 19.522 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.657 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6404.29, + 404.11, + 1824.25, + 1765.99, + 44.958, + 50.416, + 5100.918, + 184.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21551.83, + 11456.08, + 18985.07, + 16763.86, + 1904.627, + 1712.261, + 15109.772, + 4242.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.227 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.944 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.7, + 0.15, + 2.0, + 4.1, + 0.8, + 0.9, + 8.781, + 1.4, + 2.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.3, + 4.2, + 20.0, + 52.0, + 15.0, + 14.0, + 23.642, + 10.5, + 8.463 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.125, + 0.941, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.054, + 0.956, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.599 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.657 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.012, + 0.001, + 0.021, + 0.035 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.007, + 0.035 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 11.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 31.643 + ] + } + }, + "wt_peptide": "FQTNRYLTE" + } + }, + "transcripts": [ + "ENST00000297375.4-EN2-Q/R-264" + ], + "transcript_expr": [ + 0.408 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 333 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.408 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.408 + ], + "DNA VAF": 0.263, + "RNA VAF": 0.375, + "gene_expr": 0.408, + "best_peptide_mt": "FRTNRYLTE", + "best_peptide_wt": "FQTNRYLTE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-22566400-22566401-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YLGSAPSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 14182.723 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.4 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.17 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 26.415 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8768.131 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.4 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.137 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 15.408 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23354.68, + 32839.84, + 8433.14, + 19932.307, + "NA", + "NA", + 740.871, + 7342.35 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15322.19, + 18179.95, + 4883.05, + 12653.213, + "NA", + "NA", + 410.567, + 2417.69 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.74 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.268 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 12.0, + 24.0, + 6.8, + 27.0, + "NA", + "NA", + 2.24, + 15.53, + 6.117 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.1, + 7.5, + 3.7, + 17.0, + "NA", + "NA", + 1.386, + 7.21, + 2.664 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.158, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 26.415 + ] + }, + "WT": { + "HLA-C*06:02": [ + 15.408 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.2, + 0.199 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.596, + 0.523, + 0.455 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.5, + 1.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.5, + 0.775 + ] + } + }, + "wt_peptide": "YLGSARSL" + } + }, + "transcripts": [ + "ENST00000240123.12-SORBS3-R/P-336" + ], + "transcript_expr": [ + 0.065 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 671 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.065 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.065 + ], + "DNA VAF": 0.464, + "RNA VAF": 0.374, + "gene_expr": 23.107, + "best_peptide_mt": "YLGSAPSL", + "best_peptide_wt": "YLGSARSL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-23368189-23368210-TGGCCACGTTGGCGGGGGCCTG-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "EYHQPKIQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4938.498 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.05 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.623 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 13.559 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18441.5 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 36.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 38.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.779 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 48.047 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6, 7, 8, 9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9097.16, + 5200.77, + 9759.45, + 4676.227, + 489.565, + 940.957, + 235.386, + 28605.439 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22836.44, + 37155.32, + 32965.5, + 11233.424, + 9611.917, + 14046.561, + 11005.266, + 37829.82 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.121 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.301 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 1.8, + 9.2, + 16.0, + 5.6, + 8.8, + 0.861, + 56.08, + 1.969 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 34.0, + 44.0, + 38.0, + 32.0, + 38.0, + 16.501, + 82.95, + 41.637 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.979, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.99, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 13.559 + ] + }, + "WT": { + "HLA-C*06:02": [ + 48.047 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.23, + 0.001, + 0.416, + 0.181 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.014, + 0.133 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.23, + 1.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.4, + 16.158 + ] + } + }, + "wt_peptide": "EYHQPQAPA" + } + }, + "transcripts": [ + "ENST00000389131.8-LOXL2-QAPANVA/--48-54" + ], + "transcript_expr": [ + 88.174 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 774 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 88.174 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 88.174 + ], + "DNA VAF": 0.706, + "RNA VAF": 0.0, + "gene_expr": 102.877, + "best_peptide_mt": "EYHQPKIQL", + "best_peptide_wt": "EYHQPQAPA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-38428419-38428420-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "NVSDALPSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 5434.319 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.812 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.304 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12987.563 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.735 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.77 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 24.822 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.833 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7386.78, + 13590.56, + 8163.8, + 6829.038, + 337.917, + 779.058, + 103.95, + 4039.6 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33575.29, + 33892.46, + 37132.0, + 13501.892, + 1158.271, + 2770.576, + 12473.235, + 9414.7 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.879 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.221 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 5.1, + 7.7, + 24.0, + 4.1, + 7.8, + 0.335, + 10.17, + 1.222 + ] + }, + "WT": { + "HLA-C*06:02": [ + 29.0, + 26.0, + 57.0, + 44.0, + 9.9, + 18.0, + 18.699, + 18.77, + 13.195 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.042, + 0.982, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.029, + 0.984, + 0.005 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.304 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.833 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.068, + 0.001, + 0.485, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.008, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.77, + 0.854 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 31.643 + ] + } + }, + "wt_peptide": "NVSDALPSS" + } + }, + "transcripts": [ + "ENST00000447712.7-FGFR1-S/L-125" + ], + "transcript_expr": [ + 0.008 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 822 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.008 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.008 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.999, + "gene_expr": 143.964, + "best_peptide_mt": "NVSDALPSL", + "best_peptide_wt": "NVSDALPSS", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-66813873-66813874-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FIKQRRVGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1208.969 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.011 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.022 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.315 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 22.636 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2282.62 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.519 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.469 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 34.53 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4670.11, + 2859.84, + 1765.99, + 2523.796, + 429.349, + 452.449, + 651.949, + 257.68 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5615.43, + 3537.56, + 2216.49, + 2579.005, + 588.586, + 520.679, + 1155.609, + 2348.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.556 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.937 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 0.88, + 2.0, + 6.7, + 5.1, + 5.3, + 2.022, + 1.75, + 4.489 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.2, + 2.3, + 6.9, + 6.4, + 5.8, + 3.123, + 7.08, + 8.371 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.973, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.933, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 22.636 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.53 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + 0.005, + 0.258, + 0.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.002, + 0.086, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 3.239 + ] + } + }, + "wt_peptide": "FIKQRRAGL" + }, + "RRVGLNEFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1472.988 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.798 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.443 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.355 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 920.707 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.625 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.415 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.199 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 898.49, + 2785.38, + 1691.19, + 1765.99, + 737.581, + 1254.787, + 76.464, + 6524.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 551.96, + 2079.0, + 1170.65, + 1864.16, + 398.85, + 670.764, + 79.339, + 3162.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.677 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.445 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.22, + 0.86, + 1.9, + 4.1, + 7.5, + 12.0, + 0.19, + 14.19, + 0.737 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.13, + 0.65, + 1.4, + 4.4, + 4.8, + 7.0, + 0.204, + 8.6, + 0.399 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.885, + 0.085 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.826, + 0.114 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.199 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.16, + 0.007, + 0.638, + 0.129 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.227, + 0.019, + 0.608, + 0.103 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.545 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.23, + 0.6 + ] + } + }, + "wt_peptide": "RRAGLNEFI" + }, + "RRVGLNEF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4753.789 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.218 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.707 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.809 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4521.404 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.249 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.599 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.705 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11284.22, + 17689.619, + 2678.54, + 6829.038, + "NA", + "NA", + 499.797, + 1774.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9342.14, + 13904.4, + 1834.15, + 7208.657, + "NA", + "NA", + 519.166, + 744.36 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.05 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 7.2, + 2.2, + 6.8, + "NA", + "NA", + 1.635, + 5.92, + 3.136 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 5.2, + 1.8, + 7.3, + "NA", + "NA", + 1.697, + 3.46, + 1.749 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.705 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.006, + 0.204, + 0.099 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.008, + 0.176, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.814 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 1.998 + ] + } + }, + "wt_peptide": "RRAGLNEF" + }, + "QRRVGLNEFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4877.866 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.308 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.317 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.466 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.725 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3866.02 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.594 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.509 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.773 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.587 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6264.14, + 23023.5, + 1946.61, + 3491.591, + "NA", + "NA", + 2683.144, + 10142.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5009.67, + 16821.63, + 1332.95, + 2722.37, + "NA", + "NA", + 1359.904, + 7920.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.534 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.746 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 12.0, + 1.9, + 2.5, + "NA", + "NA", + 5.621, + 19.93, + 4.317 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 6.7, + 1.4, + 1.6, + "NA", + "NA", + 3.509, + 16.4, + 6.18 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.942, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.945, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.725 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.587 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.002, + 0.038, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.003, + 0.068, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.3, + 6.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 3.946 + ] + } + }, + "wt_peptide": "QRRAGLNEFI" + } + }, + "transcripts": [ + "ENST00000520976.5-SGK3-A/V-92" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 464 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 0.0 + }, + "Transcript Set 2": { + "peptides": { + "FIKQRRVGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1208.969 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.011 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.022 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.315 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 22.636 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2282.62 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.519 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.469 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 34.53 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4670.11, + 2859.84, + 1765.99, + 2523.796, + 429.349, + 452.449, + 651.949, + 257.68 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5615.43, + 3537.56, + 2216.49, + 2579.005, + 588.586, + 520.679, + 1155.609, + 2348.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.556 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.937 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 0.88, + 2.0, + 6.7, + 5.1, + 5.3, + 2.022, + 1.75, + 4.489 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.2, + 2.3, + 6.9, + 6.4, + 5.8, + 3.123, + 7.08, + 8.371 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.973, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.933, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 22.636 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.53 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + 0.005, + 0.258, + 0.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.002, + 0.086, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 3.239 + ] + } + }, + "wt_peptide": "FIKQRRAGL" + }, + "RRVGLNEF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4753.789 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.218 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.707 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.809 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4521.404 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.249 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.599 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.705 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11284.22, + 17689.619, + 2678.54, + 6829.038, + "NA", + "NA", + 499.797, + 1774.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9342.14, + 13904.4, + 1834.15, + 7208.657, + "NA", + "NA", + 519.166, + 744.36 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.05 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 7.2, + 2.2, + 6.8, + "NA", + "NA", + 1.635, + 5.92, + 3.136 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 5.2, + 1.8, + 7.3, + "NA", + "NA", + 1.697, + 3.46, + 1.749 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.705 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.006, + 0.204, + 0.099 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.008, + 0.176, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.814 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 1.998 + ] + } + }, + "wt_peptide": "RRAGLNEF" + }, + "QRRVGLNEFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4877.866 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.308 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.317 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.466 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.725 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3866.02 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.594 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.509 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.773 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.587 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6264.14, + 23023.5, + 1946.61, + 3491.591, + "NA", + "NA", + 2683.144, + 10142.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5009.67, + 16821.63, + 1332.95, + 2722.37, + "NA", + "NA", + 1359.904, + 7920.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.534 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.746 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 12.0, + 1.9, + 2.5, + "NA", + "NA", + 5.621, + 19.93, + 4.317 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 6.7, + 1.4, + 1.6, + "NA", + "NA", + 3.509, + 16.4, + 6.18 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.942, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.945, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.725 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.587 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.002, + 0.038, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.003, + 0.068, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.3, + 6.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 3.946 + ] + } + }, + "wt_peptide": "QRRAGLNEFI" + } + }, + "transcripts": [ + "ENST00000521198.7-SGK3-A/V-92" + ], + "transcript_expr": [ + 0.177 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 496 + ], + "transcript_count": 1, + "peptide_count": 3, + "total_expr": 0.177 + }, + "Transcript Set 3": { + "peptides": { + "FIKQRRVGL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1208.969 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.011 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.022 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.315 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 22.636 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2282.62 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.519 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.469 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 34.53 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4670.11, + 2859.84, + 1765.99, + 2523.796, + 429.349, + 452.449, + 651.949, + 257.68 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5615.43, + 3537.56, + 2216.49, + 2579.005, + 588.586, + 520.679, + 1155.609, + 2348.75 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.556 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.937 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 0.88, + 2.0, + 6.7, + 5.1, + 5.3, + 2.022, + 1.75, + 4.489 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.2, + 2.3, + 6.9, + 6.4, + 5.8, + 3.123, + 7.08, + 8.371 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.055, + 0.973, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.933, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 22.636 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.53 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + 0.005, + 0.258, + 0.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.024, + 0.002, + 0.086, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.1, + 1.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 3.239 + ] + } + }, + "wt_peptide": "FIKQRRAGL" + }, + "QRRVGLNEF": { + "ic50s_MT": [ + "X", + "X", + "X", + 1633.776 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.806 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.554 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.844 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1052.334 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.768 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.561 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.674 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3251.3, + 1256.72, + 3932.89, + 2010.833, + 94.8, + 229.916, + 131.906, + 2928.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2151.77, + 619.4, + 2737.14, + 1485.268, + 209.802, + 204.442, + 124.061, + 2568.09 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.497 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.395 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.75, + 0.42, + 3.8, + 5.0, + 1.4, + 3.1, + 0.462, + 8.17, + 0.464 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.48, + 0.23, + 2.8, + 3.1, + 2.9, + 2.8, + 0.431, + 7.5, + 0.35 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.987, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.976, + 0.056 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.844 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.674 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.158, + 0.019, + 0.525, + 0.147 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.206, + 0.011, + 0.481, + 0.08 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.768 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.26, + 0.863 + ] + } + }, + "wt_peptide": "QRRAGLNEF" + }, + "RRVGLNEF": { + "ic50s_MT": [ + "X", + "X", + "X", + 4753.789 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.218 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.707 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.809 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4521.404 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.249 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.599 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 8.705 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 11284.22, + 17689.619, + 2678.54, + 6829.038, + "NA", + "NA", + 499.797, + 1774.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9342.14, + 13904.4, + 1834.15, + 7208.657, + "NA", + "NA", + 519.166, + 744.36 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.05 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.3, + 7.2, + 2.2, + 6.8, + "NA", + "NA", + 1.635, + 5.92, + 3.136 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 5.2, + 1.8, + 7.3, + "NA", + "NA", + 1.697, + 3.46, + 1.749 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + "NA", + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.809 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.705 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.006, + 0.204, + 0.099 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.008, + 0.176, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.814 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 1.998 + ] + } + }, + "wt_peptide": "RRAGLNEF" + }, + "QRRVGLNEFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4877.866 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.308 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.317 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 5.466 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.725 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3866.02 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.594 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.509 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.773 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.587 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6264.14, + 23023.5, + 1946.61, + 3491.591, + "NA", + "NA", + 2683.144, + 10142.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5009.67, + 16821.63, + 1332.95, + 2722.37, + "NA", + "NA", + 1359.904, + 7920.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.534 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.746 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 12.0, + 1.9, + 2.5, + "NA", + "NA", + 5.621, + 19.93, + 4.317 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 6.7, + 1.4, + 1.6, + "NA", + "NA", + 3.509, + 16.4, + 6.18 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.014, + 0.942, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.945, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.725 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.587 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.002, + 0.038, + 0.028 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.003, + 0.068, + 0.019 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.3, + 6.631 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 3.946 + ] + } + }, + "wt_peptide": "QRRAGLNEFI" + } + }, + "transcripts": [ + "ENST00000522398.5-SGK3-A/V-92" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 496 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 0.0 + }, + "Transcript Set 4": { + "peptides": { + "RRVGLNEFI": { + "ic50s_MT": [ + "X", + "X", + "X", + 1472.988 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.798 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.443 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.355 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 920.707 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.625 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.415 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.199 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 898.49, + 2785.38, + 1691.19, + 1765.99, + 737.581, + 1254.787, + 76.464, + 6524.63 + ] + }, + "WT": { + "HLA-C*06:02": [ + 551.96, + 2079.0, + 1170.65, + 1864.16, + 398.85, + 670.764, + 79.339, + 3162.64 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.677 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.445 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.22, + 0.86, + 1.9, + 4.1, + 7.5, + 12.0, + 0.19, + 14.19, + 0.737 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.13, + 0.65, + 1.4, + 4.4, + 4.8, + 7.0, + 0.204, + 8.6, + 0.399 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.885, + 0.085 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.826, + 0.114 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.199 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.16, + 0.007, + 0.638, + 0.129 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.227, + 0.019, + 0.608, + 0.103 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.34, + 0.545 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.23, + 0.6 + ] + } + }, + "wt_peptide": "RRAGLNEFI" + } + }, + "transcripts": [ + "ENST00000519289.1-C8orf44-SGK3-A/V-92", + "ENST00000396596.2-SGK3-A/V-92", + "ENST00000345714.8-SGK3-A/V-92" + ], + "transcript_expr": [ + 0.338, + 0.142, + 0.0 + ], + "mane_select": [ + false, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 2.0, + 1.0, + 1.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 496, + 496, + 496 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.48 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3", + "Transcript Set 4" + ], + "transcript_counts": [ + 1, + 1, + 1, + 3 + ], + "peptide_counts": [ + 4, + 3, + 4, + 1 + ], + "set_expr": [ + 0.0, + 0.177, + 0.0, + 0.48 + ], + "DNA VAF": 0.23, + "RNA VAF": 0.571, + "gene_expr": 2.109, + "best_peptide_mt": "FIKQRRVGL", + "best_peptide_wt": "FIKQRRAGL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-123220221-123220221-A-AGGGCTAC": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VGSVARSPD": { + "ic50s_MT": [ + "X", + "X", + "X", + 35481.449 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 61.037 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 64.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 66.112 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 56.655 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 14198.55 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 22.38 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.463 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.96 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6, 7, 8, 9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 42079.75, + 45277.789, + 44872.5, + 26985.391, + 9949.7, + 31737.301, + 18766.744, + 39225.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17102.61, + 34304.55, + 23192.26, + 16763.86, + 1869.864, + 9174.238, + 259.726, + 11633.24 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.766 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.259 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 64.0, + 74.0, + 96.0, + 67.0, + 33.0, + 51.0, + 32.777, + 87.61, + 58.073 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.0, + 27.0, + 27.0, + 52.0, + 15.0, + 32.0, + 0.938, + 22.38, + 2.619 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.976, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.055, + 0.986, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 56.655 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.96 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.284, + 0.043 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 86.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.5, + 1.425 + ] + } + }, + "wt_peptide": "VGSVALTAL" + } + }, + "transcripts": [ + "ENST00000276704.6-C8orf76-L/RSPX-342" + ], + "transcript_expr": [ + 29.411 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 380 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 29.411 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 29.411 + ], + "DNA VAF": 0.724, + "RNA VAF": 0.0, + "gene_expr": 45.915, + "best_peptide_mt": "VGSVARSPD", + "best_peptide_wt": "VGSVALTAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-123220246-123220247-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IKDEVHPDV": { + "ic50s_MT": [ + "X", + "X", + "X", + 9317.899 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.338 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 11.609 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.807 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.977 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7302.102 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.8 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.201 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.99 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.51 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19614.811, + 26266.09, + 25152.75, + 1347.454, + 12847.245, + 5788.553, + 3074.367, + 1555.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9409.39, + 23804.19, + 15625.39, + 1133.262, + 13702.821, + 5194.814, + 573.771, + 1384.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.138 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.748 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 15.0, + 30.0, + 2.6, + 37.0, + 26.0, + 6.175, + 5.46, + 11.609 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 13.0, + 17.0, + 2.0, + 38.0, + 25.0, + 1.829, + 5.09, + 6.201 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.049, + 0.941, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + 0.94, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.977 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.51 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.006, + 0.003, + 0.043, + 0.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.064, + 0.004, + 0.356, + 0.354 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 3.7, + 5.914 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.8, + 1.179 + ] + } + }, + "wt_peptide": "IKDEVHPEV" + } + }, + "transcripts": [ + "ENST00000276704.6-C8orf76-E/D-333" + ], + "transcript_expr": [ + 29.411 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 380 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 29.411 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 29.411 + ], + "DNA VAF": 0.129, + "RNA VAF": 0.173, + "gene_expr": 45.915, + "best_peptide_mt": "IKDEVHPDV", + "best_peptide_wt": "IKDEVHPEV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-125028638-125028639-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FLEDYVRCT": { + "ic50s_MT": [ + "X", + "X", + "X", + 2021.11 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 16.596 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.897 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 852.214 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 7.958 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.091 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21959.039, + 1599.03, + 6161.97, + 2443.191, + 899.104, + 360.222, + 12101.814, + 1124.85 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11212.42, + 282.07, + 1967.79, + 1422.358, + 252.819, + 120.384, + 8096.941, + 29.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.042 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.619 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.6, + 0.5, + 5.6, + 6.4, + 8.5, + 4.4, + 18.262, + 4.47, + 1.726 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 0.11, + 2.2, + 2.9, + 3.4, + 1.8, + 12.42, + 0.32, + 0.636 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.992, + 0.045 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.201, + 0.993, + 0.158 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.897 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.091 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.004, + 0.011, + 0.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.192, + 0.022, + 0.174 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 11.116 + ] + } + }, + "wt_peptide": "FLEDYVRYT" + } + }, + "transcripts": [ + "ENST00000318410.12-WASHC5-Y/C-1135" + ], + "transcript_expr": [ + 44.786 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1159 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 44.786 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 44.786 + ], + "DNA VAF": 0.139, + "RNA VAF": 0.212, + "gene_expr": 65.088, + "best_peptide_mt": "FLEDYVRCT", + "best_peptide_wt": "FLEDYVRYT", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-125102410-125102411-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SALSSFKNF": { + "ic50s_MT": [ + "X", + "X", + "X", + 10695.921 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.329 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 18.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.254 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.175 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8544.479 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.345 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.91 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.291 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.591 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7272.82, + 28520.029, + 24882.07, + 11355.627, + 31536.246, + 10036.216, + 365.588, + 6718.13 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8880.87, + 20762.17, + 21500.59, + 8208.088, + 20174.835, + 5041.619, + 299.436, + 6959.33 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.742 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.402 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 18.0, + 29.0, + 38.0, + 51.0, + 33.0, + 1.258, + 14.52, + 6.138 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.4, + 9.1, + 24.0, + 29.0, + 44.0, + 24.0, + 1.067, + 14.91, + 3.412 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.979, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.989, + 0.014 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.175 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.591 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.071, + 0.001, + 0.212, + 0.026 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.052, + 0.001, + 0.239, + 0.016 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.74, + 1.767 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.96, + 1.623 + ] + } + }, + "wt_peptide": "SALSSLKNF" + } + }, + "transcripts": [ + "ENST00000287437.8-NSMCE2-L/F-27" + ], + "transcript_expr": [ + 34.58 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 247 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 34.58 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 34.58 + ], + "DNA VAF": 0.262, + "RNA VAF": 0.242, + "gene_expr": 78.578, + "best_peptide_mt": "SALSSFKNF", + "best_peptide_wt": "SALSSLKNF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-125436370-125436371-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FVLEPGYI": { + "ic50s_MT": [ + "X", + "X", + "X", + 12062.875 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 9.242 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 12.353 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.484 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18595.58 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 18.541 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 19.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 24.18 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.083 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17261.369, + 11578.2, + 2228.52, + 8478.889, + "NA", + "NA", + 12547.55, + 12843.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27735.49, + 29975.08, + 6229.0, + 13797.251, + "NA", + "NA", + 18985.601, + 18205.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.591 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 4.3, + 1.9, + 9.0, + "NA", + "NA", + 18.921, + 24.38, + 9.5 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.0, + 19.0, + 4.8, + 18.0, + "NA", + "NA", + 33.385, + 33.77, + 20.441 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.106, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.054, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.484 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.083 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.013, + 0.153 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.007, + 0.067 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.4, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11.0, + 37.359 + ] + } + }, + "wt_peptide": "SVLEPGYI" + } + }, + "transcripts": [ + "ENST00000519576.1-TRIB1-S/F-109" + ], + "transcript_expr": [ + 10.102 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 141 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 10.102 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 10.102 + ], + "DNA VAF": 0.133, + "RNA VAF": 0.102, + "gene_expr": 78.491, + "best_peptide_mt": "FVLEPGYI", + "best_peptide_wt": "SVLEPGYI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-125436370-125436372-CC-TT": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLHPWFEFV": { + "ic50s_MT": [ + "X", + "X", + "X", + 2555.185 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.724 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.452 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.365 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.161 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3632.808 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.287 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.902 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.486 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3348.95, + 2555.31, + 3361.84, + 5620.54, + 2284.599, + 2469.278, + 1335.2, + 2555.06 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4142.63, + 5378.46, + 4526.88, + 7527.491, + 2078.787, + 3122.986, + 477.289, + 2984.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.141 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.271 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 0.81, + 3.4, + 19.0, + 16.0, + 17.0, + 3.452, + 7.47, + 2.049 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.95, + 1.9, + 4.3, + 27.0, + 16.0, + 19.0, + 1.577, + 8.28, + 2.674 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.089, + 0.996, + 0.126 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.021, + 0.997, + 0.07 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.161 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.486 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.029, + 0.452, + 0.699 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.031, + 0.004, + 0.721, + 0.739 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 0.93 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 0.403 + ] + } + }, + "wt_peptide": "LLHPWFESV" + } + }, + "transcripts": [ + "ENST00000519576.1-TRIB1-S/F-109", + "ENST00000520847.1-TRIB1-S/F-174" + ], + "transcript_expr": [ + 10.102, + 9.944 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 1.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 141, + 206 + ], + "transcript_count": 2, + "peptide_count": 1, + "total_expr": 20.046 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 2 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 20.046 + ], + "DNA VAF": 0.136, + "RNA VAF": "NA", + "gene_expr": 78.491, + "best_peptide_mt": "LLHPWFEFV", + "best_peptide_wt": "LLHPWFESV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-132141242-132141243-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FTPLNVHAI": { + "ic50s_MT": [ + "X", + "X", + "X", + 3125.171 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.64 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.392 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.26 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6156.961 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.4 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.769 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.286 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1207.95, + 2841.79, + 1340.18, + 4936.173, + 3489.876, + 3408.552, + 86.544, + 21714.939 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5125.63, + 7216.77, + 3472.75, + 6610.931, + 5981.499, + 6332.424, + 267.564, + 24951.25 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.07 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.633 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.28, + 0.88, + 1.6, + 17.0, + 20.0, + 20.0, + 0.242, + 40.54, + 0.078 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 2.6, + 3.4, + 23.0, + 26.0, + 27.0, + 0.967, + 47.47, + 0.659 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.068, + 0.976, + 0.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.066, + 0.98, + 0.035 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.26 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.286 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.138, + 0.146, + 0.735, + 0.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.016, + 0.004, + 0.308, + 0.083 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 0.384 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.2, + 1.338 + ] + } + }, + "wt_peptide": "FTPLNVDAI" + } + }, + "transcripts": [ + "ENST00000388996.10-KCNQ3-D/H-451", + "ENST00000521134.6-KCNQ3-D/H-331", + "ENST00000519445.5-KCNQ3-D/H-451" + ], + "transcript_expr": [ + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 1.0, + 2.0, + 5.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 872, + 752, + 860 + ], + "transcript_count": 3, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.291, + "RNA VAF": 1.0, + "gene_expr": 0.019, + "best_peptide_mt": "FTPLNVHAI", + "best_peptide_wt": "FTPLNVDAI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-132948805-132948806-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLSSRSVLL": { + "ic50s_MT": [ + "X", + "X", + "X", + 2772.01 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.312 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.888 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.648 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6480.871 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.825 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.698 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.016 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 5526.35, + 3019.31, + 2781.92, + 5560.055, + 1027.567, + 789.896, + 525.97, + 2762.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9620.75, + 9156.6, + 7092.61, + 5869.133, + 2414.404, + 2429.797, + 808.478, + 9473.7 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.538 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 0.94, + 2.8, + 19.0, + 9.3, + 7.8, + 1.713, + 7.86, + 1.622 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.7, + 3.3, + 6.5, + 20.0, + 17.0, + 17.0, + 2.39, + 18.85, + 4.349 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.957, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.967, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.648 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.016 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.022, + 0.007, + 0.18, + 0.069 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.002, + 0.106, + 0.015 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 1.975 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 2.795 + ] + } + }, + "wt_peptide": "LLSSPSVLL" + } + }, + "transcripts": [ + "ENST00000220616.9-TG-P/R-1755" + ], + "transcript_expr": [ + 0.08 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2768 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.08 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.08 + ], + "DNA VAF": 0.992, + "RNA VAF": 0.0, + "gene_expr": 0.721, + "best_peptide_mt": "LLSSRSVLL", + "best_peptide_wt": "LLSSPSVLL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-138737576-138737577-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LRWKKGDMG": { + "ic50s_MT": [ + "X", + "X", + "X", + 5695.865 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 19.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 11.99 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 29.18 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 33.842 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 12356.07 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 28.021 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.43 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 48.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 30.739 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 28185.65, + 6238.58, + 19400.381, + 2607.061, + 1124.113, + 265.198, + 16967.496, + 5153.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38517.58, + 14269.42, + 29906.73, + 2390.889, + 1421.707, + 385.097, + 20325.297, + 10442.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.919 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.769 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 2.2, + 21.0, + 7.0, + 9.7, + 3.5, + 28.0, + 11.99, + 29.387 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46.0, + 5.4, + 38.0, + 6.2, + 13.0, + 4.6, + 37.635, + 20.43, + 25.303 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.977, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.984, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 33.842 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.739 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34.0, + 62.745 + ] + } + }, + "wt_peptide": "LRGKKGDMG" + } + }, + "transcripts": [ + "ENST00000303045.11-COL22A1-G/W-696" + ], + "transcript_expr": [ + 0.049 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1626 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.049 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.049 + ], + "DNA VAF": 0.2, + "RNA VAF": 0.0, + "gene_expr": 0.308, + "best_peptide_mt": "LRWKKGDMG", + "best_peptide_wt": "LRGKKGDMG", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-143795429-143795430-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSPEDPGKE": { + "ic50s_MT": [ + "X", + "X", + "X", + 21060.686 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 29.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 25.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 25.653 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 40.845 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 21285.296 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 28.0 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 29.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 21.08 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 40.031 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 40850.121, + 40196.84, + 41151.77, + 6195.392, + 5392.747, + 5053.241, + 7309.58, + 34811.789 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38038.41, + 41169.58, + 40708.92, + 5681.683, + 7461.223, + 6465.022, + 6334.69, + 35109.37 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.535 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 57.0, + 44.0, + 74.0, + 22.0, + 25.0, + 24.0, + 11.485, + 73.35, + 21.856 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44.0, + 48.0, + 72.0, + 20.0, + 29.0, + 27.0, + 10.293, + 74.26, + 19.232 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.967, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.968, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 40.845 + ] + }, + "WT": { + "HLA-C*06:02": [ + 40.031 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.013, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.015, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 34.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 27.0, + 15.161 + ] + } + }, + "wt_peptide": "LSPEGPGKE" + } + }, + "transcripts": [ + "ENST00000356994.7-SCRIB-G/D-1235" + ], + "transcript_expr": [ + 5.601 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1655 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 5.601 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 5.601 + ], + "DNA VAF": 0.162, + "RNA VAF": 0.141, + "gene_expr": 61.627, + "best_peptide_mt": "LSPEDPGKE", + "best_peptide_wt": "LSPEGPGKE", + "best_hla_allele": "HLA-C*06:02" + }, + "chr8-143805313-143805314-A-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VEPENAGTI": { + "ic50s_MT": [ + "X", + "X", + "X", + 19064.426 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.07 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.645 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.14 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 16102.765 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.85 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.856 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.664 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19074.84, + 19054.01, + 15625.39, + 17505.314, + 25165.758, + 35364.703, + 1191.243, + 36200.648 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16032.11, + 16173.42, + 10357.86, + 16583.457, + 15481.392, + 31518.824, + 386.064, + 22283.16 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.789 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.812 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.4, + 8.0, + 17.0, + 53.0, + 47.0, + 52.0, + 3.173, + 77.67, + 6.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.4, + 6.3, + 9.8, + 51.0, + 40.0, + 51.0, + 1.313, + 41.69, + 1.017 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.9, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.984, + 0.028 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.14 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.664 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.0, + 0.082, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.011, + 0.001, + 0.38, + 0.275 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.9, + 3.39 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.6, + 1.112 + ] + } + }, + "wt_peptide": "VEPENAVTI" + } + }, + "transcripts": [ + "ENST00000356994.7-SCRIB-V/G-823" + ], + "transcript_expr": [ + 5.601 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1655 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 5.601 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 5.601 + ], + "DNA VAF": 0.164, + "RNA VAF": 0.055, + "gene_expr": 61.627, + "best_peptide_mt": "VEPENAGTI", + "best_peptide_wt": "VEPENAVTI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-4286160-4286161-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "ALSPRRKML": { + "ic50s_MT": [ + "X", + "X", + "X", + 2440.73 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.409 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.226 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.317 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 815.385 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.61 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.816 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.619 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 9055.32, + 1864.38, + 3017.08, + 4830.504, + 1255.481, + 410.743, + 326.766, + 7211.66 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6640.39, + 818.12, + 1235.73, + 4106.841, + 576.514, + 328.526, + 196.552, + 812.65 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.72 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.535 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 0.58, + 3.1, + 17.0, + 12.0, + 4.8, + 1.149, + 15.32, + 0.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.7, + 0.3, + 1.6, + 14.0, + 6.3, + 4.1, + 0.725, + 3.65, + 0.513 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.939, + 0.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.953, + 0.029 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.317 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.619 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.061, + 0.003, + 0.237, + 0.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.093, + 0.004, + 0.402, + 0.115 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.82, + 1.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.58, + 1.052 + ] + } + }, + "wt_peptide": "ALSPRRQML" + } + }, + "transcripts": [ + "ENST00000381971.8-GLIS3-Q/K-89" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 930 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.153, + "RNA VAF": 0.043, + "gene_expr": 2.761, + "best_peptide_mt": "ALSPRRKML", + "best_peptide_wt": "ALSPRRQML", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-35609475-35609476-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "YSLPRAAAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 918.45 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.393 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.126 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 4.743 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6861.768 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.1 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.376 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.041 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 968.8, + 1529.74, + 1189.81, + 4727.097, + 788.515, + 868.1, + 50.919, + 235.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3494.61, + 10076.53, + 4701.59, + 7775.837, + 7092.674, + 6630.862, + 67.006, + 11946.29 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.153 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.24, + 0.49, + 1.5, + 16.0, + 7.8, + 8.3, + 0.057, + 1.65, + 1.286 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.8, + 3.7, + 4.5, + 28.0, + 28.0, + 27.0, + 0.139, + 22.9, + 2.105 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.99, + 0.011 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.989, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 4.743 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.041 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.23, + 0.069, + 0.969, + 0.829 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.104, + 0.006, + 0.836, + 0.393 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.23, + 0.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.53, + 0.221 + ] + } + }, + "wt_peptide": "HSLPRAAAL" + } + }, + "transcripts": [ + "ENST00000336395.6-TESK1-H/Y-539" + ], + "transcript_expr": [ + 1.476 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 626 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 1.476 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.476 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 9.206, + "best_peptide_mt": "YSLPRAAAL", + "best_peptide_wt": "HSLPRAAAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-35750917-35750918-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SVKYVYKLII": { + "ic50s_MT": [ + "X", + "X", + "X", + 13990.03 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 29.612 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.527 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10686.365 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.367 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 22.98 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.733 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 13649.51, + 22849.529, + 13797.25, + 9047.587, + "NA", + "NA", + 24768.604, + 14182.81 + ] + }, + "WT": { + "HLA-C*06:02": [ + 10730.88, + 22822.11, + 10641.85, + 9759.454, + "NA", + "NA", + 22919.242, + 6670.05 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.704 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.783 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.3, + 12.0, + 14.0, + 12.0, + "NA", + "NA", + 59.2, + 26.64, + 23.522 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 12.0, + 9.2, + 12.0, + "NA", + "NA", + 48.249, + 14.44, + 25.668 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.938, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.98, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.527 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.733 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.005, + 0.061 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.007, + 0.132 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 46.225 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.6, + 37.359 + ] + } + }, + "wt_peptide": "SVKYVYKLTI" + } + }, + "transcripts": [ + "ENST00000378078.5-RGP1-T/I-139" + ], + "transcript_expr": [ + 9.354 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 391 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 9.354 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 9.354 + ], + "DNA VAF": 0.979, + "RNA VAF": 0.995, + "gene_expr": 12.548, + "best_peptide_mt": "SVKYVYKLII", + "best_peptide_wt": "SVKYVYKLTI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-37784015-37784016-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IVTANSGDI": { + "ic50s_MT": [ + "X", + "X", + "X", + 13025.552 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 21.401 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.123 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 28.322 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 21.801 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13701.679 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 21.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 21.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 21.809 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 33.527 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 23939.02, + 12714.83, + 18082.85, + 7775.837, + 3748.09, + 3940.669, + 13336.274, + 30499.92 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22588.96, + 15441.69, + 23192.26, + 9245.506, + 3933.779, + 3703.139, + 11961.668, + 30899.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.323 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.324 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 13.0, + 4.7, + 19.0, + 28.0, + 21.0, + 22.0, + 20.123, + 60.98, + 15.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.0, + 6.0, + 27.0, + 32.0, + 22.0, + 21.0, + 17.842, + 62.07, + 15.177 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + 0.967, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.029, + 0.944, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 21.801 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.527 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.008, + 0.002 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 25.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.0, + 27.617 + ] + } + }, + "wt_peptide": "IVTAKSGDI" + } + }, + "transcripts": [ + "ENST00000327304.10-EXOSC3-K/N-124" + ], + "transcript_expr": [ + 5.523 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 275 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 5.523 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 5.523 + ], + "DNA VAF": 0.48, + "RNA VAF": 0.533, + "gene_expr": 28.784, + "best_peptide_mt": "IVTANSGDI", + "best_peptide_wt": "IVTAKSGDI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-81992222-81992223-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LAQPESPFRAL": { + "ic50s_MT": [ + "X", + "X", + "X", + 14952.049 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.9 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.153 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.359 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 15827.303 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.45 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 8.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.315 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.791 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 21677.881, + 38534.672, + 10933.64, + 11857.879, + "NA", + "NA", + 537.73, + 18046.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20542.07, + 36082.85, + 8163.8, + 11112.536, + "NA", + "NA", + 701.069, + 23262.86 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.621 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.499 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 9.4, + 38.0, + 9.9, + 15.0, + "NA", + "NA", + 1.741, + 33.47, + 4.999 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 31.0, + 7.3, + 14.0, + "NA", + "NA", + 2.149, + 43.76, + 4.047 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.047, + "NA", + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.048, + "NA", + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.791 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.196, + 0.507, + 0.512 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.12, + 0.411, + 0.475 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 7.5, + 0.807 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.6, + 1.029 + ] + } + }, + "wt_peptide": "LAQPQSPFRAL" + } + }, + "transcripts": [ + "ENST00000344803.3-SPATA31D1-Q/E-585" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1576 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.693, + "RNA VAF": 1.0, + "gene_expr": 0.0, + "best_peptide_mt": "LAQPESPFRAL", + "best_peptide_wt": "LAQPQSPFRAL", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-113369791-113369792-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FQNGLHTWM": { + "ic50s_MT": [ + "X", + "X", + "X", + 2174.949 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.26 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.08 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.301 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2553.325 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.211 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.2 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.516 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.405 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 877.41, + 7762.73, + 3890.57, + 4478.161, + 461.116, + 890.369, + 330.605, + 3459.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1135.23, + 11475.43, + 5651.03, + 4989.872, + 587.232, + 1246.149, + 525.638, + 3860.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.858 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.995 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.21, + 2.8, + 3.8, + 16.0, + 5.3, + 8.5, + 1.16, + 9.15, + 1.158 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.26, + 4.2, + 5.2, + 17.0, + 6.4, + 12.0, + 1.713, + 9.87, + 1.579 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.95, + 0.093 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.028, + 0.947, + 0.079 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.405 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.126, + 0.004, + 0.22, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.062, + 0.004, + 0.151, + 0.01 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.44, + 1.72 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.81, + 2.222 + ] + } + }, + "wt_peptide": "FQNGLHAWM" + } + }, + "transcripts": [ + "ENST00000374183.5-BSPRY-A/T-287" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 402 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.537, + "RNA VAF": 0.0, + "gene_expr": 0.09, + "best_peptide_mt": "FQNGLHTWM", + "best_peptide_wt": "FQNGLHAWM", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-120858190-120858191-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSDSSAEGASV": { + "ic50s_MT": [ + "X", + "X", + "X", + 16539.525 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 32.435 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 27.87 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 32.596 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 37.118 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 31723.815 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 53.82 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 70.295 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 51.68 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 41.639 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 36127.371, + 45982.289, + 18180.939, + 3272.123, + "NA", + "NA", + 9126.475, + 14898.11 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42977.46, + 46835.38, + 29425.27, + 7692.158, + "NA", + "NA", + 16030.054, + 34022.36 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -3.713 + ] + }, + "WT": { + "HLA-C*06:02": [ + -4.122 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 37.0, + 80.0, + 20.0, + 2.2, + "NA", + "NA", + 13.743, + 27.87, + 56.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 71.0, + 88.0, + 38.0, + 8.1, + "NA", + "NA", + 25.445, + 70.94, + 70.295 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + "NA", + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 37.118 + ] + }, + "WT": { + "HLA-C*06:02": [ + 41.639 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.011, + 0.009 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 43.0, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 66.0, + 37.359 + ] + } + }, + "wt_peptide": "PSDSSAEGASV" + } + }, + "transcripts": [ + "ENST00000616568.5-PHF19-P/L-518" + ], + "transcript_expr": [ + 0.658 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 599 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.658 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.658 + ], + "DNA VAF": 0.517, + "RNA VAF": 0.447, + "gene_expr": 47.989, + "best_peptide_mt": "LSDSSAEGASV", + "best_peptide_wt": "PSDSSAEGASV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-129102403-129102404-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "VVHNCQFF": { + "ic50s_MT": [ + "X", + "X", + "X", + 15891.114 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 10.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 9.3 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 24.18 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 11.613 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13445.444 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.05 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 11.759 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.027 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "5", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 22406.65, + 21016.66, + 4502.45, + 14407.494, + "NA", + "NA", + 17374.732, + 2591.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 17967.2, + 14444.48, + 3932.89, + 13947.345, + "NA", + "NA", + 12943.544, + 2109.06 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.706 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.467 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 10.0, + 9.3, + 3.4, + 19.0, + "NA", + "NA", + 28.956, + 7.54, + 5.788 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.6, + 5.5, + 3.0, + 18.0, + "NA", + "NA", + 19.636, + 6.6, + 3.829 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.046, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.068, + "NA", + 0.041 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 11.613 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.027 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.001, + 0.002, + 0.007, + 0.046 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.003, + 0.013, + 0.145 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 11.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.9, + 18.618 + ] + } + }, + "wt_peptide": "VVHNYQFF" + } + }, + "transcripts": [ + "ENST00000318080.7-CRAT-Y/C-209" + ], + "transcript_expr": [ + 9.475 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 626 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 9.475 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 9.475 + ], + "DNA VAF": 0.275, + "RNA VAF": 0.018, + "gene_expr": 11.624, + "best_peptide_mt": "VVHNCQFF", + "best_peptide_wt": "VVHNYQFF", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-133354714-133354715-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RRKWKLKLI": { + "ic50s_MT": [ + "X", + "X", + "X", + 212.834 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.37 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.44 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.606 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.094 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 161.921 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.29 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.48 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 0.072 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 639.53, + 145.02, + 333.69, + 280.649, + 75.999, + 59.644, + 130.818, + 1538.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 409.14, + 74.42, + 214.14, + 323.035, + 72.079, + 86.81, + 109.703, + 506.7 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.346 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.15, + 0.07, + 0.44, + 0.3, + 1.2, + 1.1, + 0.462, + 5.43, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.09, + 0.04, + 0.28, + 0.3, + 1.2, + 1.4, + 0.363, + 2.72, + 0.03 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.036, + 0.946, + 0.156 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.044, + 0.96, + 0.169 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.094 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.072 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.211, + 0.106, + 0.438, + 0.045 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.266, + 0.363, + 0.529, + 0.1 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.25, + 0.962 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.2, + 0.759 + ] + } + }, + "wt_peptide": "RRKWKLNLI" + }, + "RRKWKLKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 1060.025 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 2.048 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.721 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 92.022 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1506.594 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.75 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.044 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 90.723 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6837.47, + 6791.83, + 330.1, + 1347.454, + "NA", + "NA", + 772.595, + 223.95 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6327.43, + 5469.13, + 375.87, + 1209.273, + "NA", + "NA", + 1803.915, + 31.12 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.249 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.68 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.8, + 2.4, + 0.4, + 0.5, + "NA", + "NA", + 2.296, + 1.59, + 13.741 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.6, + 1.9, + 0.45, + 0.5, + "NA", + "NA", + 4.298, + 0.34, + 22.877 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + "NA", + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.046, + "NA", + 0.0 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 92.022 + ] + }, + "WT": { + "HLA-C*06:02": [ + 90.723 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.013, + 0.119, + 0.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.012, + 0.052, + 0.018 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.84, + 2.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.2, + 4.887 + ] + } + }, + "wt_peptide": "RRKWKLNL" + }, + "QRRKWKLKLI": { + "ic50s_MT": [ + "X", + "X", + "X", + 4710.051 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.275 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.32 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.506 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 2862.238 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.299 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.5 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.579 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 12.288 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7304.6, + 5937.41, + 367.82, + 2416.898, + "NA", + "NA", + 3482.693, + 7822.53 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5311.84, + 4500.6, + 297.86, + 2579.005, + "NA", + "NA", + 1689.319, + 3145.47 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.929 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.744 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 2.1, + 0.36, + 1.3, + "NA", + "NA", + 6.749, + 16.26, + 29.651 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 1.5, + 0.28, + 1.4, + "NA", + "NA", + 4.099, + 8.57, + 24.622 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.007, + 0.932, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.009, + 0.957, + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.506 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12.288 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.001, + 0.027, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + 0.002, + 0.055, + 0.016 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.8, + 8.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.5, + 4.658 + ] + } + }, + "wt_peptide": "QRRKWKLNLI" + }, + "QRRKWKLKL": { + "ic50s_MT": [ + "X", + "X", + "X", + 313.12 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.63 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.42 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.52 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.24 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 275.25 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.741 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.51 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.621 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.13 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "HLA-C*06:02", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1573.15, + 310.12, + 316.12, + 1602.129, + 193.557, + 195.691, + 104.401, + 651.55 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1521.28, + 353.84, + 371.82, + 1347.454, + 134.837, + 112.608, + 125.402, + 196.66 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.319 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.517 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.35, + 0.12, + 0.42, + 3.5, + 2.7, + 2.7, + 0.339, + 3.2, + 0.282 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.33, + 0.14, + 0.51, + 2.6, + 2.0, + 1.7, + 0.437, + 1.47, + 0.489 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.908, + 0.036 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.944, + 0.038 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.24 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.13 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.272, + 0.006, + 0.491, + 0.043 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.2, + 0.003, + 0.434, + 0.029 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.2, + 0.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.27, + 0.971 + ] + } + }, + "wt_peptide": "QRRKWKLNL" + } + }, + "transcripts": [ + "ENST00000371974.8-SURF1-N/K-89" + ], + "transcript_expr": [ + 10.581 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 300 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 10.581 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 4 + ], + "set_expr": [ + 10.581 + ], + "DNA VAF": 0.7, + "RNA VAF": 0.762, + "gene_expr": 46.709, + "best_peptide_mt": "RRKWKLKLI", + "best_peptide_wt": "RRKWKLNLI", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-137199427-137199428-T-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FLPAASDEA": { + "ic50s_MT": [ + "X", + "X", + "X", + 7122.345 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 17.355 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.405 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 16.153 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 23.126 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4962.199 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 12.578 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 16.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.678 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 22.839 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "7", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 18294.4, + 19488.949, + 22818.9, + 6610.931, + 3302.25, + 3967.985, + 7633.76, + 223.16 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14260.62, + 17295.21, + 20258.44, + 5869.133, + 2083.579, + 3285.262, + 4055.265, + 80.73 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.44 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.426 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.8, + 8.3, + 26.0, + 23.0, + 20.0, + 22.0, + 11.887, + 1.59, + 17.405 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 7.0, + 22.0, + 20.0, + 16.0, + 20.0, + 7.486, + 0.77, + 17.137 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.976, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.977, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 23.126 + ] + }, + "WT": { + "HLA-C*06:02": [ + 22.839 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.013, + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.0, + 0.027, + 0.042 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 15.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.2, + 9.155 + ] + } + }, + "wt_peptide": "FLPAASEEA" + } + }, + "transcripts": [ + "ENST00000409012.6-TPRN-E/D-428" + ], + "transcript_expr": [ + 6.729 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 711 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 6.729 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 6.729 + ], + "DNA VAF": 0.296, + "RNA VAF": 0.333, + "gene_expr": 10.805, + "best_peptide_mt": "FLPAASDEA", + "best_peptide_wt": "FLPAASEEA", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-137255473-137255474-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "DRAPSRAV": { + "ic50s_MT": [ + "X", + "X", + "X", + 7036.604 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 5.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.61 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.285 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 30864.89 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 28.46 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 30.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.608 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 33.739 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12969.38, + 15360.04, + 2021.74, + 5382.477, + "NA", + "NA", + 2345.385, + 8690.73 + ] + }, + "WT": { + "HLA-C*06:02": [ + 34004.49, + 42901.75, + 27725.29, + 41599.443, + "NA", + "NA", + 10362.986, + 14348.57 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.929 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.988 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 4.0, + 5.9, + 1.9, + 5.0, + "NA", + "NA", + 5.15, + 17.62, + 1.378 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.0, + 58.0, + 33.0, + 51.0, + "NA", + "NA", + 15.497, + 26.92, + 9.047 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.132, + "NA", + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + "NA", + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.285 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.739 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + 0.034, + 0.203, + 0.521 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.03, + 0.336 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.82 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.2, + 8.016 + ] + } + }, + "wt_peptide": "DGAPSRAV" + } + }, + "transcripts": [ + "ENST00000343053.6-NELFB-G/R-37" + ], + "transcript_expr": [ + 32.319 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 628 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 32.319 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 32.319 + ], + "DNA VAF": 0.6, + "RNA VAF": 0.812, + "gene_expr": 32.319, + "best_peptide_mt": "DRAPSRAV", + "best_peptide_wt": "DGAPSRAV", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-137436071-137436072-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "FNFSSCQSQ": { + "ic50s_MT": [ + "X", + "X", + "X", + 6466.115 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 16.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 17.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 23.822 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 14.754 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 9033.067 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 22.919 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 20.123 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 30.822 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 31.384 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "6", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27361.43, + 9165.92, + 18180.939, + 3766.311, + 2419.97, + 3512.125, + 13075.39, + 608.64 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32415.51, + 17662.46, + 23699.6, + 4018.926, + 3219.66, + 4825.808, + 13240.327, + 2561.24 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.082 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.642 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 17.0, + 3.3, + 20.0, + 13.0, + 17.0, + 20.0, + 19.874, + 3.06, + 10.523 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.0, + 7.2, + 27.0, + 14.0, + 19.0, + 24.0, + 20.123, + 7.48, + 21.838 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.974, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.974, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 14.754 + ] + }, + "WT": { + "HLA-C*06:02": [ + 31.384 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.008, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.001 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 31.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 30.0, + 31.643 + ] + } + }, + "wt_peptide": "FNFSSCQGQ" + } + }, + "transcripts": [ + "ENST00000371506.7-ENTPD8-G/S-331" + ], + "transcript_expr": [ + 0.147 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 495 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.147 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.147 + ], + "DNA VAF": 0.346, + "RNA VAF": 0.5, + "gene_expr": 0.236, + "best_peptide_mt": "FNFSSCQSQ", + "best_peptide_wt": "FNFSSCQGQ", + "best_hla_allele": "HLA-C*06:02" + }, + "chr9-138120681-138120682-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GLPPGEGPTD": { + "ic50s_MT": [ + "X", + "X", + "X", + 45064.43 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 53.09 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 57.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 52.309 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 11.966 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 43503.11 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 48.665 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 57.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 39.094 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.77 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 46453.859, + 48375.34, + 43675.0, + 50000.0, + "NA", + "NA", + 7531.346, + 25708.971 + ] + }, + "WT": { + "HLA-C*06:02": [ + 44726.12, + 48384.76, + 42280.1, + 50000.0, + "NA", + "NA", + 4818.91, + 21608.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.981 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.407 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 95.0, + 100.0, + 91.0, + 57.0, + "NA", + "NA", + 11.787, + 49.18, + 8.949 + ] + }, + "WT": { + "HLA-C*06:02": [ + 83.0, + 100.0, + 83.0, + 57.0, + "NA", + "NA", + 8.371, + 40.33, + 16.772 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.01, + 0.956, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.974, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 11.966 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.77 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.013, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.02, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 86.0, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 66.0, + 12.187 + ] + } + }, + "wt_peptide": "GLPPGEGPTG" + } + }, + "transcripts": [ + "ENST00000371372.6-CACNA1B-G/D-2097" + ], + "transcript_expr": [ + 0.036 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2339 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.036 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.036 + ], + "DNA VAF": 0.276, + "RNA VAF": 0.0, + "gene_expr": 0.154, + "best_peptide_mt": "GLPPGEGPTD", + "best_peptide_wt": "GLPPGEGPTG", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-1419025-1419026-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "MAFNLSRFSSA": { + "ic50s_MT": [ + "X", + "X", + "X", + 10150.43 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 14.447 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.23 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 19.809 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 11.796 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13960.746 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.816 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 11.56 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.139 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 13.355 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 15364.69, + 30508.08, + 4936.17, + 2842.778, + "NA", + "NA", + 18859.438, + 1928.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20868.02, + 36672.84, + 8853.9, + 4429.969, + "NA", + "NA", + 19067.591, + 4885.56 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.424 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.574 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.1, + 20.0, + 4.3, + 1.8, + "NA", + "NA", + 32.777, + 6.23, + 17.098 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.7, + 32.0, + 8.0, + 3.7, + "NA", + "NA", + 33.385, + 11.56, + 19.985 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.018, + "NA", + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.023, + "NA", + 0.004 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 11.796 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13.355 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.013, + 0.25 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.017, + 0.335 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 21.0, + 18.618 + ] + }, + "WT": { + "HLA-C*06:02": [ + 20.0, + 14.277 + ] + } + }, + "wt_peptide": "TAFNLSRFSSA" + } + }, + "transcripts": [ + "ENST00000381317.9-ASMTL-T/M-445" + ], + "transcript_expr": [ + 65.222 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 621 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 65.222 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 65.222 + ], + "DNA VAF": 0.467, + "RNA VAF": 0.46, + "gene_expr": 74.609, + "best_peptide_mt": "MAFNLSRFSSA", + "best_peptide_wt": "TAFNLSRFSSA", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-1419095-1419096-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SSETRLRFM": { + "ic50s_MT": [ + "X", + "X", + "X", + 847.173 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.623 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.747 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.727 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.08 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8066.235 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 8.752 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 9.16 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 4.627 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.684 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4632.82, + 943.47, + 3000.81, + 1262.758, + 144.481, + 99.671, + 750.875, + 182.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21278.65, + 8301.6, + 15541.08, + 10414.043, + 7830.87, + 4203.103, + 4913.735, + 3462.41 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.049 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.821 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 0.34, + 3.1, + 2.3, + 2.1, + 1.5, + 2.258, + 1.39, + 1.747 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.0, + 3.0, + 16.0, + 36.0, + 30.0, + 22.0, + 8.504, + 9.16, + 6.976 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.011, + 0.968, + 0.039 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.01, + 0.93, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.08 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.684 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.035, + 0.016, + 0.158, + 0.123 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.005, + 0.003, + 0.051, + 0.283 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 2.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 5.054 + ] + } + }, + "wt_peptide": "SPETRLRFM" + }, + "YYQSSETRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 3281.503 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.12 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.275 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.442 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3469.25 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.328 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.457 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.234 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.717 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3666.39, + 4069.95, + 3083.08, + 5044.154, + 2419.97, + 3479.926, + 196.655, + 34.66 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3851.03, + 3540.09, + 3398.41, + 4883.053, + 1810.548, + 3686.125, + 138.52, + 36.94 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.623 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.955 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.84, + 1.4, + 3.2, + 17.0, + 17.0, + 20.0, + 0.725, + 0.37, + 0.643 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.88, + 1.2, + 3.4, + 17.0, + 14.0, + 21.0, + 0.496, + 0.4, + 1.457 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.101, + 0.959, + 0.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.042, + 0.923, + 0.011 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.442 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.717 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.18, + 0.285, + 0.823, + 0.662 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.258, + 0.059, + 0.814, + 0.548 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.31, + 0.241 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.21, + 0.257 + ] + } + }, + "wt_peptide": "YYQSPETRL" + }, + "AYYQSSETRL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4086.926 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.745 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.658 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 8.716 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5179.228 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.05 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.3 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.133 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.518 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12406.35, + 27494.961, + 1978.46, + 6195.392, + "NA", + "NA", + 563.432, + 826.34 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11309.4, + 31947.88, + 1957.17, + 7287.077, + "NA", + "NA", + 447.197, + 3071.38 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.538 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.296 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.8, + 16.0, + 1.9, + 6.0, + "NA", + "NA", + 1.799, + 3.69, + 4.349 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 22.0, + 1.9, + 7.9, + "NA", + "NA", + 1.498, + 8.44, + 2.799 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.023, + 0.953, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.017, + 0.949, + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 8.716 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.518 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.013, + 0.009, + 0.502, + 0.519 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.031, + 0.009, + 0.48, + 0.431 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.5, + 0.817 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.4, + 0.865 + ] + } + }, + "wt_peptide": "AYYQSPETRL" + } + }, + "transcripts": [ + "ENST00000381317.9-ASMTL-P/S-422", + "ENST00000381333.9-ASMTL-P/S-406", + "ENST00000534940.6-ASMTL-P/S-364" + ], + "transcript_expr": [ + 65.222, + 1.669, + 5.108 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + 1.0, + 2.0, + 2.0 + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 621, + 605, + 563 + ], + "transcript_count": 3, + "peptide_count": 3, + "total_expr": 71.999 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 3 + ], + "set_expr": [ + 71.999 + ], + "DNA VAF": 0.226, + "RNA VAF": 0.223, + "gene_expr": 74.609, + "best_peptide_mt": "SSETRLRFM", + "best_peptide_wt": "SPETRLRFM", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-7843975-7843976-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LSQESEMEE": { + "ic50s_MT": [ + "X", + "X", + "X", + 14629.747 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 28.775 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 23.347 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 42.18 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 30.945 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 27836.809 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 47.136 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 42.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 59.612 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 48.047 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 40877.531, + 35754.84, + 37535.941, + 5382.477, + 1488.71, + 1732.088, + 14545.215, + 14714.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 46393.56, + 38891.14, + 41599.44, + 12653.213, + 974.563, + 4881.688, + 19183.128, + 36490.49 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.698 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.635 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 57.0, + 30.0, + 58.0, + 19.0, + 13.0, + 14.0, + 22.36, + 27.55, + 23.347 + ] + }, + "WT": { + "HLA-C*06:02": [ + 95.0, + 39.0, + 77.0, + 42.0, + 9.0, + 24.0, + 34.029, + 78.59, + 53.375 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.016, + 0.949, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.931, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 30.945 + ] + }, + "WT": { + "HLA-C*06:02": [ + 48.047 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.007, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.005, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 47.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 73.0, + 46.225 + ] + } + }, + "wt_peptide": "PSQESEMEE" + } + }, + "transcripts": [ + "ENST00000688183.1-VCX-P/L-194" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 206 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "LSQESEMEE", + "best_peptide_wt": "PSQESEMEE", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-9937278-9937279-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LEKHQIKTL": { + "ic50s_MT": [ + "X", + "X", + "X", + 13470.755 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.95 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 12.49 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.949 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.878 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 8840.095 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 7.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.796 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.101 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 17481.09, + 14625.97, + 12315.54, + 8478.889, + 238127.75, + 74742.906, + 923.019, + 5462.58 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12244.19, + 9337.8, + 8342.39, + 5805.972, + 60507.61, + 21906.349, + 288.047, + 7873.55 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.251 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.736 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 6.3, + 5.6, + 13.0, + 30.0, + 79.0, + 64.0, + 2.636, + 12.49, + 2.581 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.7, + 3.4, + 7.9, + 20.0, + 61.0, + 45.0, + 1.024, + 16.33, + 0.851 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.996, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.994, + 0.039 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.878 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.101 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.003, + 0.177, + 0.218 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.072, + 0.008, + 0.486, + 0.317 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 1.998 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.74, + 0.852 + ] + } + }, + "wt_peptide": "LEKDQIKTL" + } + }, + "transcripts": [ + "ENST00000380913.8-SHROOM2-D/H-1245" + ], + "transcript_expr": [ + 0.297 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1616 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.297 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.297 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 0.608, + "best_peptide_mt": "LEKHQIKTL", + "best_peptide_wt": "LEKDQIKTL", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-9967396-9967397-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "QFSIFALTTI": { + "ic50s_MT": [ + "X", + "X", + "X", + 19315.875 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 23.769 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 27.539 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 28.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 7.063 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 18871.027 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 17.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 29.18 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.868 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 19646.68, + 36707.371, + 18985.07, + 50000.0, + "NA", + "NA", + 16915.076, + 10034.96 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21394.3, + 38677.96, + 14252.45, + 48929.645, + "NA", + "NA", + 16347.755, + 5332.78 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.869 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.256 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 7.7, + 32.0, + 20.0, + 57.0, + "NA", + "NA", + 27.539, + 19.77, + 28.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.1, + 38.0, + 14.0, + 56.0, + "NA", + "NA", + 26.243, + 12.29, + 13.881 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.049, + 0.956, + 0.007 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.035, + 0.965, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 7.063 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.868 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.029 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.007, + 0.029 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 21.0, + 37.359 + ] + } + }, + "wt_peptide": "QFSVFALTTI" + } + }, + "transcripts": [ + "ENST00000445307.4-CLDN34-V/I-14" + ], + "transcript_expr": [ + 0.013 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 214 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.013 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.013 + ], + "DNA VAF": 0.989, + "RNA VAF": 1.0, + "gene_expr": 0.013, + "best_peptide_mt": "QFSIFALTTI", + "best_peptide_wt": "QFSVFALTTI", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-15355261-15355262-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TSVPKLVPV": { + "ic50s_MT": [ + "X", + "X", + "X", + 11326.942 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 7.162 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.16 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.951 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.324 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 13982.521 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 18.98 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.517 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.07 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3183.39, + 30908.119, + 11541.43, + 11604.035, + 11112.455, + 17201.646, + 147.705, + 10283.38 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8812.23, + 36413.07, + 16946.23, + 11604.036, + 16361.006, + 30239.179, + 407.394, + 9553.7 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.84 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.116 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.73, + 21.0, + 12.0, + 39.0, + 35.0, + 41.0, + 0.534, + 20.16, + 1.101 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.4, + 32.0, + 18.0, + 39.0, + 40.0, + 50.0, + 1.374, + 18.98, + 1.955 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.082, + 0.996, + 0.021 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.096, + 0.998, + 0.023 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.324 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.07 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.059, + 0.002, + 0.406, + 0.041 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.001, + 0.185, + 0.009 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.86, + 1.042 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 1.934 + ] + } + }, + "wt_peptide": "TSVPELVPV" + } + }, + "transcripts": [ + "ENST00000297904.4-VEGFD-E/K-177" + ], + "transcript_expr": [ + 0.254 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 354 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.254 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.254 + ], + "DNA VAF": 0.987, + "RNA VAF": 1.0, + "gene_expr": 0.674, + "best_peptide_mt": "TSVPKLVPV", + "best_peptide_wt": "TSVPELVPV", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-32389609-32389610-C-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HLQESKMIL": { + "ic50s_MT": [ + "X", + "X", + "X", + 8205.625 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 4.367 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 8.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.079 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 5.133 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7437.055 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.21 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.62 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.377 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.964 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 12083.1, + 7932.36, + 8478.89, + 7775.837, + 13298.725, + 8965.407, + 659.209, + 4122.28 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14783.96, + 7502.37, + 8252.61, + 6978.426, + 7617.457, + 7371.74, + 883.489, + 1630.63 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.407 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.504 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.6, + 2.9, + 8.0, + 28.0, + 37.0, + 31.0, + 2.04, + 10.31, + 3.443 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.8, + 2.7, + 7.8, + 25.0, + 29.0, + 29.0, + 2.551, + 5.62, + 4.083 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.946, + 0.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.027, + 0.916, + 0.009 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 5.133 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.964 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.015, + 0.002, + 0.197, + 0.163 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.002, + 0.365, + 0.484 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 2.3, + 1.858 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 1.153 + ] + } + }, + "wt_peptide": "RLQESKMIL" + } + }, + "transcripts": [ + "ENST00000357033.9-DMD-R/H-1470" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 3685 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.0, + "gene_expr": 3.178, + "best_peptide_mt": "HLQESKMIL", + "best_peptide_wt": "RLQESKMIL", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-40655057-40655058-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "LLPDQATQL": { + "ic50s_MT": [ + "X", + "X", + "X", + 9441.513 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.965 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.1 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.442 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.929 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6149.382 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.072 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.7 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.224 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 5.044 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6225.9, + 11022.6, + 6539.79, + 7860.427, + 22121.268, + 11365.015, + 60.241, + 18357.27 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4894.0, + 8681.26, + 6195.39, + 5500.221, + 12128.581, + 6103.374, + 52.46, + 17462.0 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.391 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.51 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 4.0, + 6.1, + 28.0, + 45.0, + 35.0, + 0.104, + 34.04, + 0.346 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 3.1, + 5.7, + 19.0, + 36.0, + 27.0, + 0.066, + 32.39, + 0.481 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.973, + 0.013 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.033, + 0.958, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.929 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5.044 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.072, + 0.032, + 0.885, + 0.481 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.129, + 0.021, + 0.972, + 0.863 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.74, + 0.145 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.43, + 0.018 + ] + } + }, + "wt_peptide": "LFPDQATQL" + } + }, + "transcripts": [ + "ENST00000324817.6-MED14-F/L-1325" + ], + "transcript_expr": [ + 7.173 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1454 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 7.173 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 7.173 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 18.572, + "best_peptide_mt": "LLPDQATQL", + "best_peptide_wt": "LFPDQATQL", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-41344254-41344255-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "RKFSYRSTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 513.09 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.794 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.986 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.355 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.839 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 906.664 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.971 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 610.55, + 322.65, + 592.1, + 711.664, + 2222.337, + 434.08, + 276.065, + 50.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 853.84, + 656.99, + 1354.76, + 932.715, + 3182.805, + 915.314, + 898.013, + 127.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.881 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.828 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.14, + 0.13, + 0.75, + 1.0, + 16.0, + 5.1, + 0.986, + 0.52, + 1.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.21, + 0.24, + 1.6, + 1.6, + 19.0, + 8.6, + 2.571, + 1.08, + 1.064 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.993, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.986, + 0.022 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.204, + 0.003, + 0.698, + 0.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.162, + 0.001, + 0.242, + 0.323 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.27, + 0.441 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.34, + 1.602 + ] + } + }, + "wt_peptide": "RKFSYRSRV" + }, + "FSYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4777.793 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.305 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.166 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.733 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5521.143 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.22 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.072 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 26.117 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "10", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6138.74, + 12966.85, + 968.71, + 3416.846, + "NA", + "NA", + 21913.26, + 2066.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7840.21, + 13677.15, + 1127.15, + 3202.076, + "NA", + "NA", + 22779.428, + 1782.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.262 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.404 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 4.8, + 0.9, + 2.4, + "NA", + "NA", + 43.878, + 6.51, + 13.998 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 5.1, + 1.2, + 2.1, + "NA", + "NA", + 48.249, + 5.94, + 16.718 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.117 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.011, + 0.261 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.008, + 0.163 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 31.643 + ] + } + }, + "wt_peptide": "FSYRSRVRPCV" + } + }, + "transcripts": [ + "ENST00000399959.7-DDX3X-R/T-293", + "ENST00000457138.7-DDX3X-R/T-278", + "ENST00000644513.1-DDX3X-R/T-294", + "ENST00000644677.1-DDX3X-R/T-255" + ], + "transcript_expr": [ + 0.735, + 0.112, + 36.22, + 0.0 + ], + "mane_select": [ + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false + ], + "tsl": [ + 1.0, + 2.0, + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 661, + 646, + 662, + 622 + ], + "transcript_count": 4, + "peptide_count": 2, + "total_expr": 37.067 + }, + "Transcript Set 2": { + "peptides": { + "RKFSYRSTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 513.09 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.794 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.986 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.355 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.839 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 906.664 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.971 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 610.55, + 322.65, + 592.1, + 711.664, + 2222.337, + 434.08, + 276.065, + 50.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 853.84, + 656.99, + 1354.76, + 932.715, + 3182.805, + 915.314, + 898.013, + 127.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.881 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.828 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.14, + 0.13, + 0.75, + 1.0, + 16.0, + 5.1, + 0.986, + 0.52, + 1.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.21, + 0.24, + 1.6, + 1.6, + 19.0, + 8.6, + 2.571, + 1.08, + 1.064 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.993, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.986, + 0.022 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.204, + 0.003, + 0.698, + 0.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.162, + 0.001, + 0.242, + 0.323 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.27, + 0.441 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.34, + 1.602 + ] + } + }, + "wt_peptide": "RKFSYRSRV" + }, + "ARKFSYRSTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1121.118 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.65 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.939 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.381 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1908.26 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.059 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1309.52, + 4106.49, + 614.95, + 932.715, + "NA", + "NA", + 7236.634, + 34.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2560.57, + 7350.98, + 1255.95, + 1170.651, + "NA", + "NA", + 12712.537, + 110.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.606 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.861 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.3, + 1.4, + 0.65, + 0.3, + "NA", + "NA", + 11.389, + 0.37, + 4.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.57, + 2.6, + 1.4, + 0.5, + "NA", + "NA", + 19.161, + 0.97, + 7.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + 0.993, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.989, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.381 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.0, + 0.016, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.0, + 0.008, + 0.017 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 27.617 + ] + } + }, + "wt_peptide": "ARKFSYRSRV" + }, + "YRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 79.792 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.169 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.18 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.107 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.859 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 118.52 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.444 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.311 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.358 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.996 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 88.89, + 151.33, + 108.31, + 659.754, + 30.256, + 24.186, + 70.693, + 16.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 149.03, + 285.59, + 138.16, + 727.232, + 79.581, + 59.37, + 98.881, + 12.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.788 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.082 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.07, + 0.13, + 0.8, + 0.6, + 0.5, + 0.158, + 0.18, + 0.959 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.12, + 0.15, + 1.0, + 1.3, + 1.1, + 0.311, + 0.11, + 1.848 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.221, + 0.991, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.989, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.996 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.049, + 0.879, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.317, + 0.004, + 0.622, + 0.179 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.14, + 0.576 + ] + } + }, + "wt_peptide": "YRSRVRPCV" + }, + "YRSTVRPCVV": { + "ic50s_MT": [ + "X", + "X", + "X", + 407.287 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.022 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.301 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.28 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.044 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 723.268 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.116 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.105 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 418.24, + 5690.29, + 65.13, + 1967.786, + "NA", + "NA", + 396.334, + 21.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 641.21, + 5472.09, + 79.14, + 2145.704, + "NA", + "NA", + 805.326, + 12.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.133 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 2.0, + 0.05, + 1.0, + "NA", + "NA", + 1.35, + 0.24, + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.15, + 1.9, + 0.08, + 1.1, + "NA", + "NA", + 2.368, + 0.11, + 2.01 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.164, + 0.971, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.026, + 0.948, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.105 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.023, + 0.331, + 0.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.003, + 0.149, + 0.123 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 1.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 2.232 + ] + } + }, + "wt_peptide": "YRSRVRPCVV" + }, + "YRSTVRPCVVY": { + "ic50s_MT": [ + "X", + "X", + "X", + 2216.009 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.82 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.901 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.734 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3023.253 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.316 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.356 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3564.5, + 7122.67, + 514.41, + 2781.922, + "NA", + "NA", + 1650.096, + 8.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4289.41, + 6899.15, + 611.63, + 3033.45, + "NA", + "NA", + 3013.057, + 3.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.409 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.82, + 2.5, + 0.55, + 1.7, + "NA", + "NA", + 4.034, + 0.06, + 0.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.0, + 2.5, + 0.65, + 2.0, + "NA", + "NA", + 6.089, + 0.01, + 3.46 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.734 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.356 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.041, + 0.004, + 0.119, + 0.246 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.001, + 0.055, + 0.171 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 2.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 4.732 + ] + } + }, + "wt_peptide": "YRSRVRPCVVY" + } + }, + "transcripts": [ + "ENST00000644074.1-DDX3X-R/T-293", + "ENST00000644073.1-DDX3X-R/T-280", + "ENST00000646679.1-DDX3X-R/T-108" + ], + "transcript_expr": [ + 0.058, + 0.14, + 0.0 + ], + "mane_select": [ + false, + false, + false + ], + "canonical": [ + false, + false, + false + ], + "tsl": [ + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 660, + 647, + 475 + ], + "transcript_count": 3, + "peptide_count": 5, + "total_expr": 0.198 + }, + "Transcript Set 3": { + "peptides": { + "RKFSYRSTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 513.09 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.794 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.986 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.355 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 0.839 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 906.664 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.6 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.971 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "8", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 610.55, + 322.65, + 592.1, + 711.664, + 2222.337, + 434.08, + 276.065, + 50.61 + ] + }, + "WT": { + "HLA-C*06:02": [ + 853.84, + 656.99, + 1354.76, + 932.715, + 3182.805, + 915.314, + 898.013, + 127.72 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.881 + ] + }, + "WT": { + "HLA-C*06:02": [ + -0.828 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.14, + 0.13, + 0.75, + 1.0, + 16.0, + 5.1, + 0.986, + 0.52, + 1.228 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.21, + 0.24, + 1.6, + 1.6, + 19.0, + 8.6, + 2.571, + 1.08, + 1.064 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.993, + 0.047 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.025, + 0.986, + 0.022 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.839 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.204, + 0.003, + 0.698, + 0.558 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.162, + 0.001, + 0.242, + 0.323 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.27, + 0.441 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.34, + 1.602 + ] + } + }, + "wt_peptide": "RKFSYRSRV" + }, + "YRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 79.792 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.169 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.18 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.107 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.859 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 118.52 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.444 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.311 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.358 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.996 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 88.89, + 151.33, + 108.31, + 659.754, + 30.256, + 24.186, + 70.693, + 16.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 149.03, + 285.59, + 138.16, + 727.232, + 79.581, + 59.37, + 98.881, + 12.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.788 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.082 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.07, + 0.13, + 0.8, + 0.6, + 0.5, + 0.158, + 0.18, + 0.959 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.12, + 0.15, + 1.0, + 1.3, + 1.1, + 0.311, + 0.11, + 1.848 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.221, + 0.991, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.989, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.996 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.049, + 0.879, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.317, + 0.004, + 0.622, + 0.179 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.14, + 0.576 + ] + } + }, + "wt_peptide": "YRSRVRPCV" + } + }, + "transcripts": [ + "ENST00000644109.1-DDX3X-R/T-293" + ], + "transcript_expr": [ + 1.432 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + "NA" + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 716 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 1.432 + }, + "Transcript Set 4": { + "peptides": { + "ARKFSYRSTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1121.118 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.65 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.939 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.381 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1908.26 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.059 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1309.52, + 4106.49, + 614.95, + 932.715, + "NA", + "NA", + 7236.634, + 34.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2560.57, + 7350.98, + 1255.95, + 1170.651, + "NA", + "NA", + 12712.537, + 110.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.606 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.861 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.3, + 1.4, + 0.65, + 0.3, + "NA", + "NA", + 11.389, + 0.37, + 4.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.57, + 2.6, + 1.4, + 0.5, + "NA", + "NA", + 19.161, + 0.97, + 7.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + 0.993, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.989, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.381 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.0, + 0.016, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.0, + 0.008, + 0.017 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 27.617 + ] + } + }, + "wt_peptide": "ARKFSYRSRV" + }, + "YRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 79.792 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.169 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.18 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.107 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.859 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 118.52 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.444 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.311 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.358 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.996 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 88.89, + 151.33, + 108.31, + 659.754, + 30.256, + 24.186, + 70.693, + 16.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 149.03, + 285.59, + 138.16, + 727.232, + 79.581, + 59.37, + 98.881, + 12.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.788 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.082 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.07, + 0.13, + 0.8, + 0.6, + 0.5, + 0.158, + 0.18, + 0.959 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.12, + 0.15, + 1.0, + 1.3, + 1.1, + 0.311, + 0.11, + 1.848 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.221, + 0.991, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.989, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.996 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.049, + 0.879, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.317, + 0.004, + 0.622, + 0.179 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.14, + 0.576 + ] + } + }, + "wt_peptide": "YRSRVRPCV" + }, + "YRSTVRPCVV": { + "ic50s_MT": [ + "X", + "X", + "X", + 407.287 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.022 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.301 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.28 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.044 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 723.268 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.116 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.105 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 418.24, + 5690.29, + 65.13, + 1967.786, + "NA", + "NA", + 396.334, + 21.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 641.21, + 5472.09, + 79.14, + 2145.704, + "NA", + "NA", + 805.326, + 12.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.133 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 2.0, + 0.05, + 1.0, + "NA", + "NA", + 1.35, + 0.24, + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.15, + 1.9, + 0.08, + 1.1, + "NA", + "NA", + 2.368, + 0.11, + 2.01 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.164, + 0.971, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.026, + 0.948, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.105 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.023, + 0.331, + 0.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.003, + 0.149, + 0.123 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 1.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 2.232 + ] + } + }, + "wt_peptide": "YRSRVRPCVV" + }, + "YRSTVRPCVVY": { + "ic50s_MT": [ + "X", + "X", + "X", + 2216.009 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.82 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.901 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.734 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3023.253 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.316 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.356 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3564.5, + 7122.67, + 514.41, + 2781.922, + "NA", + "NA", + 1650.096, + 8.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4289.41, + 6899.15, + 611.63, + 3033.45, + "NA", + "NA", + 3013.057, + 3.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.409 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.82, + 2.5, + 0.55, + 1.7, + "NA", + "NA", + 4.034, + 0.06, + 0.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.0, + 2.5, + 0.65, + 2.0, + "NA", + "NA", + 6.089, + 0.01, + 3.46 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.734 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.356 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.041, + 0.004, + 0.119, + 0.246 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.001, + 0.055, + 0.171 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 2.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 4.732 + ] + } + }, + "wt_peptide": "YRSRVRPCVVY" + }, + "SYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4070.671 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.48 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.703 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.913 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3882.723 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.17 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.74 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 36.482 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "9", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3362.82, + 12228.7, + 2157.34, + 4778.521, + "NA", + "NA", + 12382.874, + 2041.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3383.15, + 12473.11, + 1073.58, + 4382.296, + "NA", + "NA", + 16714.218, + 841.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.622 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 4.5, + 2.0, + 4.1, + "NA", + "NA", + 18.699, + 6.46, + 15.775 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 4.6, + 1.2, + 3.6, + "NA", + "NA", + 27.088, + 3.74, + 21.288 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.997, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.99, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.913 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.482 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.013, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.007, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 31.643 + ] + } + }, + "wt_peptide": "SYRSRVRPCV" + } + }, + "transcripts": [ + "ENST00000646319.1-DDX3X-R/T-294", + "ENST00000646627.1-DDX3X-R/T-108", + "ENST00000642322.1-DDX3X-R/T-108", + "ENST00000642424.1-DDX3X-R/T-108" + ], + "transcript_expr": [ + 8.887, + 35.653, + 0.0, + 0.0 + ], + "mane_select": [ + false, + false, + false, + false + ], + "canonical": [ + false, + false, + false, + false + ], + "tsl": [ + "NA", + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 661, + 476, + 476, + 476 + ], + "transcript_count": 4, + "peptide_count": 5, + "total_expr": 44.54 + }, + "Transcript Set 5": { + "peptides": { + "YRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 79.792 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 0.169 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.18 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.107 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.859 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 118.52 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 0.444 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 0.311 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.358 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 4.996 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 88.89, + 151.33, + 108.31, + 659.754, + 30.256, + 24.186, + 70.693, + 16.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 149.03, + 285.59, + 138.16, + 727.232, + 79.581, + 59.37, + 98.881, + 12.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.788 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.082 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.03, + 0.07, + 0.13, + 0.8, + 0.6, + 0.5, + 0.158, + 0.18, + 0.959 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.04, + 0.12, + 0.15, + 1.0, + 1.3, + 1.1, + 0.311, + 0.11, + 1.848 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.221, + 0.991, + 0.017 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.047, + 0.989, + 0.01 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.859 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.996 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.475, + 0.049, + 0.879, + 0.508 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.317, + 0.004, + 0.622, + 0.179 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.06, + 0.155 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.14, + 0.576 + ] + } + }, + "wt_peptide": "YRSRVRPCV" + }, + "YRSTVRPCVV": { + "ic50s_MT": [ + "X", + "X", + "X", + 407.287 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.022 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.301 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.28 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.044 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 723.268 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.116 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.105 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 418.24, + 5690.29, + 65.13, + 1967.786, + "NA", + "NA", + 396.334, + 21.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 641.21, + 5472.09, + 79.14, + 2145.704, + "NA", + "NA", + 805.326, + 12.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.133 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 2.0, + 0.05, + 1.0, + "NA", + "NA", + 1.35, + 0.24, + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.15, + 1.9, + 0.08, + 1.1, + "NA", + "NA", + 2.368, + 0.11, + 2.01 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.164, + 0.971, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.026, + 0.948, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.105 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.023, + 0.331, + 0.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.003, + 0.149, + 0.123 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 1.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 2.232 + ] + } + }, + "wt_peptide": "YRSRVRPCVV" + }, + "SYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4070.671 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.48 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.703 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.913 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3882.723 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.17 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.74 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 36.482 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "9", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3362.82, + 12228.7, + 2157.34, + 4778.521, + "NA", + "NA", + 12382.874, + 2041.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3383.15, + 12473.11, + 1073.58, + 4382.296, + "NA", + "NA", + 16714.218, + 841.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.622 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 4.5, + 2.0, + 4.1, + "NA", + "NA", + 18.699, + 6.46, + 15.775 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 4.6, + 1.2, + 3.6, + "NA", + "NA", + 27.088, + 3.74, + 21.288 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.997, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.99, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.913 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.482 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.013, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.007, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 31.643 + ] + } + }, + "wt_peptide": "SYRSRVRPCV" + }, + "FSYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4777.793 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.305 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.166 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.733 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5521.143 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.22 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.072 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 26.117 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "10", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6138.74, + 12966.85, + 968.71, + 3416.846, + "NA", + "NA", + 21913.26, + 2066.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7840.21, + 13677.15, + 1127.15, + 3202.076, + "NA", + "NA", + 22779.428, + 1782.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.262 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.404 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 4.8, + 0.9, + 2.4, + "NA", + "NA", + 43.878, + 6.51, + 13.998 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 5.1, + 1.2, + 2.1, + "NA", + "NA", + 48.249, + 5.94, + 16.718 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.117 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.011, + 0.261 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.008, + 0.163 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 31.643 + ] + } + }, + "wt_peptide": "FSYRSRVRPCV" + } + }, + "transcripts": [ + "ENST00000441189.4-DDX3X-R/T-261" + ], + "transcript_expr": [ + 9.08 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 2.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 629 + ], + "transcript_count": 1, + "peptide_count": 4, + "total_expr": 9.08 + }, + "Transcript Set 6": { + "peptides": { + "ARKFSYRSTV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1121.118 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.65 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 7.939 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 3.381 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1908.26 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.4 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 15.059 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.084 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 1309.52, + 4106.49, + 614.95, + 932.715, + "NA", + "NA", + 7236.634, + 34.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2560.57, + 7350.98, + 1255.95, + 1170.651, + "NA", + "NA", + 12712.537, + 110.5 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.606 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.861 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.3, + 1.4, + 0.65, + 0.3, + "NA", + "NA", + 11.389, + 0.37, + 4.88 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.57, + 2.6, + 1.4, + 0.5, + "NA", + "NA", + 19.161, + 0.97, + 7.442 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.031, + 0.993, + 0.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.989, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 3.381 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.084 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.0, + 0.016, + 0.062 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.0, + 0.008, + 0.017 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 14.277 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 27.617 + ] + } + }, + "wt_peptide": "ARKFSYRSRV" + }, + "YRSTVRPCVV": { + "ic50s_MT": [ + "X", + "X", + "X", + 407.287 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.022 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.301 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.28 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.044 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 723.268 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.95 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.116 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.105 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 418.24, + 5690.29, + 65.13, + 1967.786, + "NA", + "NA", + 396.334, + 21.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 641.21, + 5472.09, + 79.14, + 2145.704, + "NA", + "NA", + 805.326, + 12.02 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.345 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.133 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.1, + 2.0, + 0.05, + 1.0, + "NA", + "NA", + 1.35, + 0.24, + 0.301 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.15, + 1.9, + 0.08, + 1.1, + "NA", + "NA", + 2.368, + 0.11, + 2.01 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.164, + 0.971, + 0.04 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.026, + 0.948, + 0.016 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.044 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.105 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.038, + 0.023, + 0.331, + 0.221 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.018, + 0.003, + 0.149, + 0.123 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.3, + 1.259 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.0, + 2.232 + ] + } + }, + "wt_peptide": "YRSRVRPCVV" + }, + "YRSTVRPCVVY": { + "ic50s_MT": [ + "X", + "X", + "X", + 2216.009 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.45 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 0.82 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.901 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.734 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3023.253 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 2.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 2.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.316 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 6.356 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "8", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3564.5, + 7122.67, + 514.41, + 2781.922, + "NA", + "NA", + 1650.096, + 8.02 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4289.41, + 6899.15, + 611.63, + 3033.45, + "NA", + "NA", + 3013.057, + 3.85 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.617 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.409 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.82, + 2.5, + 0.55, + 1.7, + "NA", + "NA", + 4.034, + 0.06, + 0.633 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.0, + 2.5, + 0.65, + 2.0, + "NA", + "NA", + 6.089, + 0.01, + 3.46 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.017, + "NA", + 0.018 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.004, + "NA", + 0.008 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.734 + ] + }, + "WT": { + "HLA-C*06:02": [ + 6.356 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.041, + 0.004, + 0.119, + 0.246 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.001, + 0.055, + 0.171 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.2, + 2.602 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.9, + 4.732 + ] + } + }, + "wt_peptide": "YRSRVRPCVVY" + }, + "SYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4070.671 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.48 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.703 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.913 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3882.723 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.17 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.74 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 36.482 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "9", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3362.82, + 12228.7, + 2157.34, + 4778.521, + "NA", + "NA", + 12382.874, + 2041.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3383.15, + 12473.11, + 1073.58, + 4382.296, + "NA", + "NA", + 16714.218, + 841.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.622 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 4.5, + 2.0, + 4.1, + "NA", + "NA", + 18.699, + 6.46, + 15.775 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 4.6, + 1.2, + 3.6, + "NA", + "NA", + 27.088, + 3.74, + 21.288 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.997, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.99, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.913 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.482 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.013, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.007, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 31.643 + ] + } + }, + "wt_peptide": "SYRSRVRPCV" + }, + "FSYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4777.793 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.305 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.166 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.733 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5521.143 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.22 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.072 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 26.117 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "10", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6138.74, + 12966.85, + 968.71, + 3416.846, + "NA", + "NA", + 21913.26, + 2066.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7840.21, + 13677.15, + 1127.15, + 3202.076, + "NA", + "NA", + 22779.428, + 1782.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.262 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.404 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 4.8, + 0.9, + 2.4, + "NA", + "NA", + 43.878, + 6.51, + 13.998 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 5.1, + 1.2, + 2.1, + "NA", + "NA", + 48.249, + 5.94, + 16.718 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.117 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.011, + 0.261 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.008, + 0.163 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 31.643 + ] + } + }, + "wt_peptide": "FSYRSRVRPCV" + } + }, + "transcripts": [ + "ENST00000629496.3-DDX3X-R/T-294", + "ENST00000646122.1-DDX3X-R/T-294" + ], + "transcript_expr": [ + 0.0, + 2.805 + ], + "mane_select": [ + false, + false + ], + "canonical": [ + false, + false + ], + "tsl": [ + 5.0, + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None" + ], + "transcript_length": [ + 662, + 641 + ], + "transcript_count": 2, + "peptide_count": 5, + "total_expr": 2.805 + }, + "Transcript Set 7": { + "peptides": { + "SYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4070.671 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.48 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 10.703 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 17.913 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3882.723 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.17 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.74 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 17.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 36.482 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "9", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 3362.82, + 12228.7, + 2157.34, + 4778.521, + "NA", + "NA", + 12382.874, + 2041.9 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3383.15, + 12473.11, + 1073.58, + 4382.296, + "NA", + "NA", + 16714.218, + 841.95 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.355 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.622 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.78, + 4.5, + 2.0, + 4.1, + "NA", + "NA", + 18.699, + 6.46, + 15.775 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.78, + 4.6, + 1.2, + 3.6, + "NA", + "NA", + 27.088, + 3.74, + 21.288 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.033, + 0.997, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.99, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 17.913 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36.482 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.005, + 0.0, + 0.013, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.008, + 0.0, + 0.007, + 0.047 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.1, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.1, + 31.643 + ] + } + }, + "wt_peptide": "SYRSRVRPCV" + }, + "FSYRSTVRPCV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4777.793 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.305 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.8 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 13.166 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 16.733 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5521.143 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 7.22 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 5.1 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 20.072 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 26.117 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "6", + "problematic_positions": "10", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6138.74, + 12966.85, + 968.71, + 3416.846, + "NA", + "NA", + 21913.26, + 2066.29 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7840.21, + 13677.15, + 1127.15, + 3202.076, + "NA", + "NA", + 22779.428, + 1782.88 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.262 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.404 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 4.8, + 0.9, + 2.4, + "NA", + "NA", + 43.878, + 6.51, + 13.998 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.1, + 5.1, + 1.2, + 2.1, + "NA", + "NA", + 48.249, + 5.94, + 16.718 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.05, + "NA", + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.038, + "NA", + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 16.733 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.117 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.002, + 0.002, + 0.011, + 0.261 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.001, + 0.001, + 0.008, + 0.163 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 6.1, + 20.232 + ] + }, + "WT": { + "HLA-C*06:02": [ + 8.5, + 31.643 + ] + } + }, + "wt_peptide": "FSYRSRVRPCV" + } + }, + "transcripts": [ + "ENST00000644876.2-DDX3X-R/T-294", + "ENST00000625837.2-DDX3X-R/T-294", + "ENST00000626301.2-DDX3X-R/T-294", + "ENST00000646107.1-DDX3X-R/T-255" + ], + "transcript_expr": [ + 5.354, + 0.0, + 0.096, + 0.0 + ], + "mane_select": [ + true, + false, + false, + false + ], + "canonical": [ + true, + false, + false, + false + ], + "tsl": [ + "NA", + 5.0, + 5.0, + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 662, + 733, + 640, + 622 + ], + "transcript_count": 4, + "peptide_count": 2, + "total_expr": 5.45 + } + }, + "sets": [ + "Transcript Set 1", + "Transcript Set 2", + "Transcript Set 3", + "Transcript Set 4", + "Transcript Set 5", + "Transcript Set 6", + "Transcript Set 7" + ], + "transcript_counts": [ + 4, + 3, + 1, + 4, + 1, + 2, + 4 + ], + "peptide_counts": [ + 2, + 5, + 2, + 5, + 4, + 5, + 2 + ], + "set_expr": [ + 37.067, + 0.198, + 1.432, + 44.54, + 9.08, + 2.805, + 5.45 + ], + "DNA VAF": 0.966, + "RNA VAF": 0.999, + "gene_expr": 158.794, + "best_peptide_mt": "RKFSYRSTV", + "best_peptide_wt": "RKFSYRSRV", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-43656385-43656386-C-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HMFEVVVI": { + "ic50s_MT": [ + "X", + "X", + "X", + 7047.562 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 6.484 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 7.267 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 2.829 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 20.312 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 4898.526 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 5.65 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.431 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 18.85 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 16648.721, + 19737.439, + 2430.01, + 5267.254, + "NA", + "NA", + 3912.863, + 8827.87 + ] + }, + "WT": { + "HLA-C*06:02": [ + 14350.56, + 20737.92, + 2099.77, + 5620.54, + "NA", + "NA", + 4176.512, + 1811.97 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.142 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.072 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 5.7, + 8.5, + 2.1, + 4.9, + "NA", + "NA", + 7.267, + 17.83, + 11.686 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.6, + 9.1, + 1.9, + 5.3, + "NA", + "NA", + 7.599, + 6.0, + 10.336 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.071, + "NA", + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.088, + "NA", + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 20.312 + ] + }, + "WT": { + "HLA-C*06:02": [ + 18.85 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.004, + 0.036, + 0.4, + 0.934 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.006, + 0.017, + 0.33, + 0.867 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 4.6, + 1.058 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.6, + 1.263 + ] + } + }, + "wt_peptide": "HMFDVVVI" + } + }, + "transcripts": [ + "ENST00000338702.4-MAOA-D/E-15" + ], + "transcript_expr": [ + 0.105 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 527 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.105 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.105 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 0.784, + "best_peptide_mt": "HMFEVVVI", + "best_peptide_wt": "HMFDVVVI", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-68717715-68717716-G-A": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "SASGSGANT": { + "ic50s_MT": [ + "X", + "X", + "X", + 16947.018 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 20.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 18.653 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 25.103 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 20371.274 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 31.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 30.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 24.08 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 33.133 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 29389.32, + 40739.75, + 37333.422, + 5932.98, + 2370.336, + 1487.887, + 7000.314, + 26893.721 + ] + }, + "WT": { + "HLA-C*06:02": [ + 36460.77, + 41538.29, + 40270.83, + 5620.54, + 7939.808, + 3217.881, + 6246.032, + 32802.74 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.393 + ] + }, + "WT": { + "HLA-C*06:02": [ + -2.763 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 46.0, + 58.0, + 21.0, + 17.0, + 13.0, + 11.094, + 51.94, + 16.518 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38.0, + 50.0, + 70.0, + 19.0, + 30.0, + 19.0, + 10.133, + 67.38, + 25.132 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.882, + 0.002 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.003, + 0.894, + 0.001 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 25.103 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.133 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.014, + 0.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.015, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 20.0, + 17.306 + ] + }, + "WT": { + "HLA-C*06:02": [ + 33.0, + 15.161 + ] + } + }, + "wt_peptide": "SAGGSGANT" + } + }, + "transcripts": [ + "ENST00000374599.8-STARD8-G/S-268" + ], + "transcript_expr": [ + 0.165 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1103 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 0.165 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 0.165 + ], + "DNA VAF": 1.0, + "RNA VAF": 1.0, + "gene_expr": 0.753, + "best_peptide_mt": "SASGSGANT", + "best_peptide_wt": "SAGGSGANT", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-71378281-71378287-GAGATAT-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KFSQSTGDKV": { + "ic50s_MT": [ + "X", + "X", + "X", + 22701.098 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 29.269 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 27.539 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 29.68 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 34.01 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 40950.18 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 63.372 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 64.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 74.372 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 24.407 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9, 10", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 27717.5, + 40494.969, + 22209.93, + 23192.264, + "NA", + "NA", + 16909.75, + 10832.39 + ] + }, + "WT": { + "HLA-C*06:02": [ + 42062.9, + 44562.84, + 43911.91, + 39837.459, + "NA", + "NA", + 22896.253, + 17636.52 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.984 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.946 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 18.0, + 45.0, + 25.0, + 31.0, + "NA", + "NA", + 27.539, + 21.06, + 31.357 + ] + }, + "WT": { + "HLA-C*06:02": [ + 64.0, + 69.0, + 92.0, + 49.0, + "NA", + "NA", + 48.249, + 32.72, + 64.322 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.027, + 0.966, + 0.001 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.014, + 0.962, + 0.002 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 34.01 + ] + }, + "WT": { + "HLA-C*06:02": [ + 24.407 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.006, + 0.012 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.0, + 0.004, + 0.0 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 37.359 + ] + }, + "WT": { + "HLA-C*06:02": [ + 86.0, + 62.745 + ] + } + }, + "wt_peptide": "KFSQSTGDID" + } + }, + "transcripts": [ + "ENST00000423759.6-TAF1-GDI/G-327-329" + ], + "transcript_expr": [ + 5.557 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 5.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 1873 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 5.557 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 5.557 + ], + "DNA VAF": 0.894, + "RNA VAF": 0.745, + "gene_expr": 18.137, + "best_peptide_mt": "KFSQSTGDKV", + "best_peptide_wt": "KFSQSTGDID", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-77681732-77681733-T-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "TSSEKKAVI": { + "ic50s_MT": [ + "X", + "X", + "X", + 5745.992 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.9 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.572 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 9.547 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 10128.968 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 10.7 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 14.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 3.123 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 16.536 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "4", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 7829.44, + 10915.9, + 6866.08, + 4625.904, + 301.863, + 472.683, + 333.553, + 26060.109 + ] + }, + "WT": { + "HLA-C*06:02": [ + 11210.35, + 18063.1, + 13212.86, + 9047.586, + 2031.468, + 2096.863, + 1297.712, + 28949.54 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.053 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.376 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 2.1, + 4.0, + 6.3, + 16.0, + 3.8, + 5.4, + 1.171, + 49.98, + 1.76 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.3, + 7.4, + 14.0, + 32.0, + 15.0, + 16.0, + 3.376, + 56.95, + 3.247 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.969, + 0.005 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.012, + 0.964, + 0.003 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 9.547 + ] + }, + "WT": { + "HLA-C*06:02": [ + 16.536 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.032, + 0.002, + 0.216, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.001, + 0.067, + 0.003 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.4, + 1.743 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.3, + 3.946 + ] + } + }, + "wt_peptide": "TSSKKKAVI" + } + }, + "transcripts": [ + "ENST00000395603.7-ATRX-K/E-1137" + ], + "transcript_expr": [ + 12.547 + ], + "mane_select": [ + false + ], + "canonical": [ + false + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2454 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 12.547 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 12.547 + ], + "DNA VAF": 1.0, + "RNA VAF": 0.99, + "gene_expr": 57.053, + "best_peptide_mt": "TSSEKKAVI", + "best_peptide_wt": "TSSKKKAVI", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-78015862-78015863-G-C": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "HSMVHESLI": { + "ic50s_MT": [ + "X", + "X", + "X", + 2238.983 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.941 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 2.149 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.941 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.201 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 7997.252 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 6.25 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 6.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 8.828 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 3.741 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "5", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 2725.64, + 2745.15, + 2510.18, + 1967.786, + 31.175, + 157.243, + 701.065, + 14422.33 + ] + }, + "WT": { + "HLA-C*06:02": [ + 13435.44, + 13308.7, + 10815.98, + 2289.621, + 170.927, + 615.985, + 5178.524, + 12457.17 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.974 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.328 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.61, + 0.86, + 2.6, + 4.8, + 0.6, + 2.3, + 2.149, + 27.05, + 1.514 + ] + }, + "WT": { + "HLA-C*06:02": [ + 4.2, + 5.0, + 12.0, + 6.0, + 2.5, + 6.5, + 8.846, + 23.75, + 2.951 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.025, + 0.942, + 0.037 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.02, + 0.957, + 0.013 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.201 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.741 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.021, + 0.008, + 0.179, + 0.146 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.002, + 0.001, + 0.023, + 0.064 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 1.983 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.0, + 10.656 + ] + } + }, + "wt_peptide": "HSMVDESLI" + } + }, + "transcripts": [ + "ENST00000341514.11-ATP7A-D/H-870", + "ENST00000343533.10-ATP7A-D/H-880", + "ENST00000685264.1-ATP7A-D/H-870", + "ENST00000686033.1-ATP7A-D/H-870", + "ENST00000692908.1-ATP7A-D/H-792", + "ENST00000693398.1-ATP7A-D/H-870" + ], + "transcript_expr": [ + 1.293, + 0.114, + 0.0, + 0.0, + 0.0, + 0.067 + ], + "mane_select": [ + true, + false, + false, + false, + false, + false + ], + "canonical": [ + true, + false, + false, + false, + false, + false + ], + "tsl": [ + 1.0, + 5.0, + "NA", + "NA", + "NA", + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None", + "None", + "None", + "None" + ], + "transcript_length": [ + 1500, + 1510, + 1500, + 1435, + 1422, + 929 + ], + "transcript_count": 6, + "peptide_count": 1, + "total_expr": 1.474 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 6 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 1.474 + ], + "DNA VAF": 0.982, + "RNA VAF": 0.951, + "gene_expr": 5.153, + "best_peptide_mt": "HSMVHESLI", + "best_peptide_wt": "HSMVDESLI", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-107601385-107601386-G-T": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "IKLEETSLV": { + "ic50s_MT": [ + "X", + "X", + "X", + 4074.83 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 5.75 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 6.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 4.374 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.329 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 3332.326 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 4.086 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 4.678 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 2.786 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.504 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "1", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 6162.36, + 3320.77, + 5182.46, + 2496.636, + 11529.487, + 3166.431, + 3415.51, + 4734.15 + ] + }, + "WT": { + "HLA-C*06:02": [ + 5690.29, + 3561.45, + 4062.65, + 2693.073, + 3103.202, + 848.34, + 2034.188, + 6725.09 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.075 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 1.2, + 4.9, + 6.6, + 35.0, + 19.0, + 6.65, + 11.31, + 1.594 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.5, + 1.2, + 3.9, + 7.3, + 19.0, + 8.1, + 4.678, + 14.53, + 1.828 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.024, + 0.965, + 0.034 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.019, + 0.954, + 0.031 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.329 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.504 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.026, + 0.001, + 0.035, + 0.072 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.037, + 0.001, + 0.062, + 0.099 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.6, + 7.147 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.3, + 4.271 + ] + } + }, + "wt_peptide": "SKLEETSLV" + }, + "KRIKLEETSL": { + "ic50s_MT": [ + "X", + "X", + "X", + 4782.746 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 3.205 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 3.31 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 1.24 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 12.974 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 5413.563 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 3.55 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 3.8 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 1.949 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 9.074 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "3", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 10634.83, + 38614.398, + 3567.97, + 5997.522, + "NA", + "NA", + 138.757, + 688.75 + ] + }, + "WT": { + "HLA-C*06:02": [ + 12458.81, + 39093.21, + 3848.7, + 6978.426, + "NA", + "NA", + 265.693, + 496.01 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.212 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.961 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 3.1, + 38.0, + 3.1, + 5.8, + "NA", + "NA", + 0.496, + 3.31, + 13.03 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3.8, + 40.0, + 3.3, + 7.4, + "NA", + "NA", + 0.956, + 2.68, + 8.694 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.009, + 0.795, + 0.004 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.007, + 0.886, + 0.006 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 12.974 + ] + }, + "WT": { + "HLA-C*06:02": [ + 9.074 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.02, + 0.003, + 0.619, + 0.269 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.013, + 0.004, + 0.291, + 0.059 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 1.9, + 0.58 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.5, + 1.399 + ] + } + }, + "wt_peptide": "KRSKLEETSL" + } + }, + "transcripts": [ + "ENST00000683843.1-FRMPD3-S/I-1116", + "ENST00000276185.9-FRMPD3-S/I-1116", + "ENST00000684358.1-FRMPD3-S/I-981" + ], + "transcript_expr": [ + 0.0, + 0.0, + 0.0 + ], + "mane_select": [ + true, + false, + false + ], + "canonical": [ + true, + false, + false + ], + "tsl": [ + "NA", + 5.0, + "NA" + ], + "biotype": [ + "protein_coding", + "protein_coding", + "protein_coding" + ], + "transcript_cds_flags": [ + "None", + "None", + "None" + ], + "transcript_length": [ + 1777, + 1777, + 1642 + ], + "transcript_count": 3, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 3 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.391, + "RNA VAF": 0.5, + "gene_expr": 0.1, + "best_peptide_mt": "IKLEETSLV", + "best_peptide_wt": "SKLEETSLV", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-141003559-141003560-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "KRTSPEELV": { + "ic50s_MT": [ + "X", + "X", + "X", + 1261.089 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 1.5 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 0.768 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 2.015 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 1252.15 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 1.843 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 1.9 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 0.492 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 1.925 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 4266.36, + 1599.5, + 2077.17, + 922.678, + 98.358, + 348.795, + 150.582, + 23808.91 + ] + }, + "WT": { + "HLA-C*06:02": [ + 3339.11, + 1358.71, + 1567.83, + 1145.591, + 153.042, + 526.708, + 91.467, + 23449.87 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -1.1 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.062 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 0.99, + 0.5, + 2.2, + 1.5, + 1.5, + 4.3, + 0.54, + 44.94, + 1.903 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.77, + 0.44, + 1.9, + 2.0, + 2.3, + 5.9, + 0.266, + 44.16, + 1.786 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.124, + 0.91, + 0.023 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.043, + 0.93, + 0.024 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 2.015 + ] + }, + "WT": { + "HLA-C*06:02": [ + 1.925 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.14, + 0.008, + 0.371, + 0.006 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.258, + 0.009, + 0.522, + 0.043 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 0.4, + 1.137 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.21, + 0.775 + ] + } + }, + "wt_peptide": "KRTSPEELL" + }, + "LVNDHAREN": { + "ic50s_MT": [ + "X", + "X", + "X", + 4987.505 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 8.8 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 4.6 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 20.596 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 1.81 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 6824.285 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 13.5 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 12.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 25.29 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 2.15 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "2", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 30185.01, + 3030.01, + 11986.87, + 1904.939, + 77.412, + 53.036, + 9375.984, + 6945.0 + ] + }, + "WT": { + "HLA-C*06:02": [ + 32116.33, + 4481.46, + 14175.55, + 3646.022, + 251.079, + 178.472, + 10845.108, + 9167.11 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -0.899 + ] + }, + "WT": { + "HLA-C*06:02": [ + -1.001 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 22.0, + 0.94, + 13.0, + 4.6, + 1.3, + 0.9, + 14.156, + 14.88, + 1.284 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.0, + 1.5, + 15.0, + 12.0, + 3.4, + 2.5, + 16.156, + 18.36, + 1.599 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.079, + 0.954, + 0.026 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.039, + 0.957, + 0.022 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 1.81 + ] + }, + "WT": { + "HLA-C*06:02": [ + 2.15 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.0, + 0.002, + 0.01, + 0.003 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.009, + 0.005 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 19.0, + 22.192 + ] + }, + "WT": { + "HLA-C*06:02": [ + 26.0, + 24.579 + ] + } + }, + "wt_peptide": "LLNDHAREN" + } + }, + "transcripts": [ + "ENST00000449283.2-SPANXB1-L/V-74" + ], + "transcript_expr": [ + 0.0 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 103 + ], + "transcript_count": 1, + "peptide_count": 2, + "total_expr": 0.0 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 2 + ], + "set_expr": [ + 0.0 + ], + "DNA VAF": 0.83, + "RNA VAF": 0.0, + "gene_expr": 0.0, + "best_peptide_mt": "KRTSPEELV", + "best_peptide_wt": "KRTSPEELL", + "best_hla_allele": "HLA-C*06:02" + }, + "chrX-154349376-154349377-C-G": { + "good_binders": { + "Transcript Set 1": { + "peptides": { + "GQKSSFTVH": { + "ic50s_MT": [ + "X", + "X", + "X", + 35550.922 + ], + "combined_percentiles_MT": [ + "X", + "X", + "X", + 40.987 + ], + "binding_percentiles_MT": [ + "X", + "X", + "X", + 56.0 + ], + "presentation_percentiles_MT": [ + "X", + "X", + "X", + 3.713 + ], + "immunogenicity_percentiles_MT": [ + "X", + "X", + "X", + 6.105 + ], + "ic50s_WT": [ + "X", + "X", + "X", + 41140.225 + ], + "combined_percentiles_WT": [ + "X", + "X", + "X", + 47.046 + ], + "binding_percentiles_WT": [ + "X", + "X", + "X", + 58.0 + ], + "presentation_percentiles_WT": [ + "X", + "X", + "X", + 37.18 + ], + "immunogenicity_percentiles_WT": [ + "X", + "X", + "X", + 7.443 + ], + "hla_types": [ + "HLA-A*29:02", + "HLA-B*45:01", + "HLA-B*82:02", + "HLA-C*06:02" + ], + "mutation_position": "9", + "problematic_positions": "None", + "anchor_fails": "None", + "individual_ic50_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI" + ], + "MT": { + "HLA-C*06:02": [ + 26351.48, + 42710.0, + 36931.66, + 22451.545, + 113451.438, + 183472.094, + 7200.27, + 34170.18 + ] + }, + "WT": { + "HLA-C*06:02": [ + 38841.09, + 43864.89, + 43439.36, + 12790.861, + 113451.437, + 49495.988, + 22535.644, + 37582.0 + ] + } + }, + "individual_binding_score_calls": { + "algorithms": [ + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + -2.794 + ] + }, + "WT": { + "HLA-C*06:02": [ + -3.034 + ] + } + }, + "individual_binding_percentile_calls": { + "algorithms": [ + "NetMHCpan", + "NetMHC", + "NetMHCcons", + "PickPocket", + "SMM", + "SMMPMBEC", + "MHCflurry", + "MHCnuggetsI", + "MixMHCpred" + ], + "MT": { + "HLA-C*06:02": [ + 16.0, + 56.0, + 56.0, + 62.0, + 70.0, + 76.0, + 11.389, + 71.37, + 25.975 + ] + }, + "WT": { + "HLA-C*06:02": [ + 47.0, + 64.0, + 87.0, + 43.0, + 70.0, + 58.0, + 47.092, + 82.13, + 32.942 + ] + } + }, + "individual_immunogenicity_calls": { + "algorithms": [ + "BigMHC_IM", + "DeepImmuno", + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 0.008, + 0.993, + 0.008 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.015, + 0.989, + 0.007 + ] + } + }, + "individual_immunogenicity_percentile_calls": { + "algorithms": [ + "PRIME" + ], + "MT": { + "HLA-C*06:02": [ + 6.105 + ] + }, + "WT": { + "HLA-C*06:02": [ + 7.443 + ] + } + }, + "individual_presentation_calls": { + "algorithms": [ + "NetMHCpanEL", + "BigMHC_EL", + "MHCflurryEL Presentation", + "MHCflurryEL Processing" + ], + "MT": { + "HLA-C*06:02": [ + 0.003, + 0.0, + 0.202, + 0.828 + ] + }, + "WT": { + "HLA-C*06:02": [ + 0.0, + 0.001, + 0.006, + 0.088 + ] + } + }, + "individual_presentation_percentile_calls": { + "algorithms": [ + "NetMHCpanEL", + "MHCflurryEL Presentation" + ], + "MT": { + "HLA-C*06:02": [ + 5.6, + 1.827 + ] + }, + "WT": { + "HLA-C*06:02": [ + 37.0, + 37.359 + ] + } + }, + "wt_peptide": "GQKSSFTVD" + } + }, + "transcripts": [ + "ENST00000369850.10-FLNA-D/H-2581" + ], + "transcript_expr": [ + 21.322 + ], + "mane_select": [ + true + ], + "canonical": [ + true + ], + "tsl": [ + 1.0 + ], + "biotype": [ + "protein_coding" + ], + "transcript_cds_flags": [ + "None" + ], + "transcript_length": [ + 2647 + ], + "transcript_count": 1, + "peptide_count": 1, + "total_expr": 21.322 + } + }, + "sets": [ + "Transcript Set 1" + ], + "transcript_counts": [ + 1 + ], + "peptide_counts": [ + 1 + ], + "set_expr": [ + 21.322 + ], + "DNA VAF": 0.992, + "RNA VAF": 0.998, + "gene_expr": 706.463, + "best_peptide_mt": "GQKSSFTVH", + "best_peptide_wt": "GQKSSFTVD", + "best_hla_allele": "HLA-C*06:02" + } +} \ No newline at end of file diff --git a/tests/test_data/aggregate_all_epitopes/HCC1395.limiting_alleles.output.tsv b/tests/test_data/aggregate_all_epitopes/HCC1395.limiting_alleles.output.tsv new file mode 100644 index 000000000..efb814228 --- /dev/null +++ b/tests/test_data/aggregate_all_epitopes/HCC1395.limiting_alleles.output.tsv @@ -0,0 +1,317 @@ +ID Index A*29:02 B*45:01 B*82:02 C*06:02 Gene AA Change Num Passing Transcripts Best Peptide Best Transcript MANE Select Canonical TSL Allele Pos Prob Pos Num Included Peptides Num Passing Peptides IC50 MT IC50 WT %ile MT %ile WT IC50 %ile MT IC50 %ile WT IM %ile MT IM %ile WT Pres %ile MT Pres %ile WT RNA Expr RNA VAF Allele Expr RNA Depth DNA VAF Tier Evaluation +chr9-133354714-133354715-G-C 474.SURF1.ENST00000371974.8.missense.89N/K 2 SURF1 N89K 1 RRKWKLKLI ENST00000371974.8 True True 1 HLA-C*06:02 7 None 4 2 212.834 161.921 0.370 0.290 0.440 0.300 0.094 0.072 0.606 0.480 46.709 0.762 35.592 563.000 0.700 Pass Pending +chr19-19336157-19336158-A-C 804.MAU2.ENST00000262815.13.missense.111S/R 1 MAU2 S111R 1 VKFEAARLL ENST00000262815.13 True True 1 HLA-C*06:02 7 None 1 1 212.075 484.278 0.396 0.951 0.448 1.202 0.105 0.490 0.221 0.784 34.844 0.437 15.227 238.000 0.345 Pass Pending +chr1-43432295-43432296-G-C 25.SZT2.ENST00000634258.3.missense.1767G/R 1 SZT2 G1767R 2 RRLHLPRHV ENST00000634258.3 True True 5 HLA-C*06:02 7 None 3 1 479.931 2414.979 0.254 2.298 0.750 3.300 0.033 0.876 0.119 0.610 34.708 0.344 11.940 96.000 0.338 Pass Pending +chrX-41344254-41344255-G-C 893.DDX3X.ENST00000399959.7.missense.293R/T 2 DDX3X R293T 19 RKFSYRSTV ENST00000399959.7 False False 1 HLA-C*06:02 8 None 7 2 513.090 906.664 0.794 1.600 0.986 1.600 0.839 2.084 0.355 0.971 158.794 0.999 158.635 1381.000 0.966 PoorBinder Pending +chr19-16093698-16093699-G-C 796.TPM4.ENST00000643579.2.missense.204E/Q TPM4 E204Q 5 TRAQFAERTV ENST00000643579.2 True True NA HLA-C*06:02 4 None 3 0 630.944 498.055 0.804 0.410 1.630 1.077 0.647 0.342 0.804 0.410 370.472 0.654 242.289 4066.000 0.480 PoorBinder Pending +chr1-179109009-179109010-T-C 64.ABL2.ENST00000512653.5.missense.738T/A ABL2 T738A 1 TGFFAPRLI ENST00000512653.5 False False 1 HLA-C*06:02 5 None 1 0 1136.267 1199.551 0.854 0.831 2.100 1.900 0.267 0.132 0.499 0.421 50.587 0.429 21.702 28.000 0.373 PoorBinder Pending +chr4-108650681-108650682-C-G 239.OSTC.ENST00000361564.9.missense.9F/L 1 OSTC F9L 3 LYRVPLLVL ENST00000361564.9 True True 1 HLA-C*06:02 6 None 4 1 2500.650 5566.561 2.527 4.626 3.940 6.600 1.620 1.465 0.964 1.030 173.877 0.486 84.504 1028.000 0.462 PoorBinder Pending +chr10-37957500-37957501-C-T 490.ZNF25.ENST00000302609.8.missense.21E/K ZNF25 E21K 1 FTKEKWKLL ENST00000302609.8 True True 1 HLA-C*06:02 5 None 2 0 584.880 1237.226 0.721 1.183 1.200 1.900 0.547 0.536 0.480 0.850 13.090 0.471 6.165 187.000 0.485 PoorBinder Pending +chr3-33053544-33053545-G-T 186.GLB1.ENST00000307363.10.missense.246S/R GLB1 S246R 3 GRNITDAFL ENST00000307363.10 True True 1 HLA-C*06:02 2 None 1 0 1932.555 12647.509 2.158 19.079 3.300 25.520 0.666 2.645 0.941 14.579 77.589 0.253 19.630 782.000 0.314 PoorBinder Pending +chr19-57397065-57397066-G-T 811.ZNF548.ENST00000336128.12.missense.24D/Y ZNF548 D24Y 4 VVFEYVAIY ENST00000336128.12 True True 2 HLA-C*06:02 5 None 2 0 740.015 1571.649 1.137 1.616 1.300 2.300 0.052 0.317 1.017 1.566 13.433 0.378 5.078 127.000 0.468 PoorBinder Pending +chr15-50643416-50643417-T-G 695.TRPM7.ENST00000646667.1.missense.153K/T TRPM7 K153T 2 ELHPRITQL ENST00000646667.1 True True NA HLA-C*06:02 7 None 1 0 2515.010 2551.670 1.208 0.867 2.600 3.200 1.616 0.915 0.365 0.471 28.628 0.450 12.883 416.000 0.500 PoorBinder Pending +chr17-5007046-5007047-C-T 733.KIF1C.ENST00000320785.10.missense.433S/F KIF1C S433F 1 FSPNTEFQI ENST00000320785.10 True True 1 HLA-C*06:02 7 None 1 0 4187.998 3598.131 2.513 1.682 6.400 3.500 1.532 1.464 1.303 1.217 121.453 0.297 36.072 1679.000 0.316 PoorBinder Pending +chr6-70190343-70190344-G-C 319.COL19A1.ENST00000620364.5.missense.1019K/N COL19A1 K1019N 1 VSFEEINKY ENST00000620364.5 True True 1 HLA-C*06:02 7 None 3 0 1379.179 1252.336 0.855 1.050 1.200 1.300 0.301 0.377 0.370 0.378 10.708 0.269 2.880 52.000 0.255 PoorBinder Pending +chr2-47806319-47806320-G-A 108.MSH6.ENST00000234420.11.missense.1255D/N MSH6 D1255N 5 HYHSLVENY ENST00000234420.11 True True 1 HLA-C*06:02 8 None 2 0 3123.500 2151.916 2.430 2.450 7.200 5.570 0.634 0.841 0.199 0.704 48.832 0.338 16.505 352.000 0.318 PoorBinder Pending +chr8-38428419-38428420-G-A 410.FGFR1.ENST00000447712.7.missense.125S/L FGFR1 S125L 1 NVSDALPSL ENST00000447712.7 True True 1 HLA-C*06:02 9 None 1 0 5434.319 12987.563 3.000 18.735 5.100 18.770 1.304 9.833 0.812 24.822 143.964 0.999 143.820 1501.000 1.000 PoorBinder Pending +chr1-168179177-168179178-A-T 61.TIPRL.ENST00000367833.7.missense.34E/V TIPRL E34V 1 MKSADVVKL ENST00000367833.7 True True 1 HLA-C*06:02 7 None 1 0 5157.296 4532.154 1.745 2.950 2.900 3.000 0.820 3.570 0.855 1.869 55.746 0.332 18.508 927.000 0.273 PoorBinder Pending +chrX-78015862-78015863-G-C 929.ATP7A.ENST00000341514.11.missense.870D/H ATP7A D870H 6 HSMVHESLI ENST00000341514.11 True True 1 HLA-C*06:02 5 None 1 0 2238.983 7997.252 1.941 6.250 2.149 6.000 1.201 3.741 1.941 8.828 5.153 0.951 4.901 41.000 0.982 PoorBinder Pending +chr2-63942505-63942506-C-G 116.VPS54.ENST00000272322.9.missense.453D/H VPS54 D453H 1 HIFSKFTIF ENST00000272322.9 True True 5 HLA-C*06:02 1 None 1 0 7387.553 9390.906 3.124 11.294 10.000 16.920 1.723 4.465 1.097 2.395 12.384 1.000 12.384 86.000 1.000 PoorBinder Pending +chr6-3723707-3723708-C-G 290.PXDC1.ENST00000380283.5.missense.203E/Q PXDC1 E203Q 1 NGSEFPSQL ENST00000380283.5 True True 1 HLA-C*06:02 8 None 1 0 6331.993 5567.435 3.750 2.200 7.400 5.000 0.248 0.125 0.648 0.659 22.483 0.539 12.118 406.000 0.418 PoorBinder Pending +chr15-40622779-40622780-C-T 672.KNL1.ENST00000399668.7.missense.839P/L KNL1 P839L 1 ESVQKPKFL ENST00000399668.7 True True 1 HLA-C*06:02 9 None 1 0 10482.949 26720.645 3.850 42.939 9.400 43.878 0.928 10.310 1.426 32.612 13.527 0.492 6.655 128.000 0.444 PoorBinder Pending +chr13-113425167-113425168-G-T 623.ADPRHL1.ENST00000612156.3.missense.220H/N ADPRHL1 H220N 1 EYQENWFYF ENST00000612156.3 True True 5 HLA-C*06:02 5 None 1 0 10237.203 6772.910 5.455 3.725 14.000 7.100 1.566 0.611 1.301 0.608 2.743 0.917 2.515 24.000 0.517 PoorBinder Pending +chr20-35384131-35384132-C-G 830.UQCC1.ENST00000374385.10.missense.44W/S 1 UQCC1 W44S 2 SRTSQSPQM ENST00000374385.10 True True 1 HLA-C*06:02 6 None 1 1 365.305 752.965 0.849 1.800 1.000 2.400 13.411 10.658 0.364 0.499 47.722 0.327 15.605 581.000 0.434 PoorImmunogenicity Pending +chr20-2312957-2312958-C-T 816.ENSG00000286022.ENST00000651531.1.missense.220R/C 1 ENSG00000286022 R220C 2 FRCDAATDV ENST00000651531.1 False True NA HLA-C*06:02 3 3 2 1 64.681 51.930 0.281 0.170 0.200 0.145 0.726 0.607 0.603 0.414 NA 0.000 NA 0.000 0.650 ProbPos Pending +chr10-125859825-125859826-G-C 500.DHX32.ENST00000284690.4.missense.209P/R DHX32 P209R 1 ARRELKLI ENST00000284690.4 True True 1 HLA-C*06:02 3 None 3 0 1183.686 3787.844 2.626 1.196 2.551 1.385 7.363 2.732 2.376 0.828 53.951 0.998 53.843 518.000 1.000 Poor Pending +chrX-1419095-1419096-G-A 878.ASMTL.ENST00000381317.9.missense.422P/S ASMTL P422S 3 SSETRLRFM ENST00000381317.9 True True 1 HLA-C*06:02 2 None 3 0 847.173 8066.235 1.623 8.752 1.747 9.160 1.080 3.684 1.727 4.627 74.609 0.223 16.638 847.000 0.226 Poor Pending +chr22-41524890-41524891-G-C 859.ACO2.ENST00000216254.9.missense.510E/Q ACO2 E510Q 7 KFNPQTDYL ENST00000216254.9 True True 1 HLA-C*06:02 5 None 3 0 2737.512 3069.029 1.600 2.650 4.900 7.270 0.880 0.639 0.579 0.960 119.616 0.238 28.469 1640.000 0.216 Poor Pending +chr3-121697676-121697677-G-C 202.GOLGB1.ENST00000340645.9.missense.944A/G GOLGB1 A944G 2 SRAEEGKKEQV ENST00000340645.9 False False 1 HLA-C*06:02 6 None 2 0 2237.928 2158.783 2.486 3.271 2.059 3.102 8.203 5.342 2.486 3.100 45.429 0.967 43.930 307.000 1.000 Poor Pending +chr9-35609475-35609476-C-T 455.TESK1.ENST00000336395.6.missense.539H/Y TESK1 H539Y 1 YSLPRAAAL ENST00000336395.6 True True 1 HLA-C*06:02 1 None 1 0 918.450 6861.768 1.393 4.100 1.500 4.500 4.743 7.041 0.126 0.376 9.206 1.000 9.206 97.000 1.000 Poor Pending +chr7-112342710-112342711-G-C 379.ZNF277.ENST00000361822.8.missense.445L/F ZNF277 L445F 1 SSIFNQLLL ENST00000361822.8 True True 1 HLA-C*06:02 4 None 2 0 1525.098 2320.805 2.400 2.671 3.600 3.600 2.200 2.241 1.043 1.276 58.592 0.347 20.331 505.000 0.434 Poor Pending +chr1-39429921-39429922-G-C 21.MACF1.ENST00000564288.6.missense.5662E/Q MACF1 E5662Q 3 RTLQQARQL ENST00000564288.6 True True 5 HLA-C*06:02 4 None 2 0 3298.866 2025.240 2.250 1.310 3.200 2.000 5.425 3.810 0.538 0.216 126.838 0.372 47.184 819.000 0.333 Poor Pending +chr19-16572288-16572289-C-G 800.SLC35E1.ENST00000595753.6.missense.26E/Q SLC35E1 E26Q 1 ARQGARVAAL ENST00000595753.6 True True 1 HLA-C*06:02 3 None 1 0 2792.363 2041.078 2.294 2.640 2.788 2.580 5.945 12.656 1.306 2.403 38.810 0.816 31.669 38.000 0.698 Poor Pending +chr1-154590262-154590263-T-A 45.ADAR.ENST00000368474.9.missense.806E/V ADAR E806V 11 ERMGFTVVT ENST00000368474.9 True True 1 HLA-C*06:02 7 None 2 0 3459.939 3803.596 2.873 3.950 3.200 3.700 0.305 0.997 2.323 5.774 131.835 0.348 45.879 1233.000 0.302 Poor Pending +chr5-1331835-1331836-C-A 256.CLPTM1L.ENST00000320895.10.missense.313K/N CLPTM1L K313N 3 SFWNKKKSM ENST00000320895.10 True True 1 HLA-C*06:02 4 None 2 0 3130.994 5890.775 3.350 5.100 4.900 8.100 31.008 39.716 0.887 1.318 169.373 0.325 55.046 1031.000 0.378 Poor Pending +chr7-102317255-102317256-A-G 377.SH2B2.ENST00000444095.3.missense.419H/R SH2B2 H419R 2 FRGTLSRV ENST00000444095.3 True True 2 HLA-C*06:02 2 None 2 0 943.696 7891.132 0.685 5.651 0.650 4.700 2.346 15.777 1.149 6.108 6.055 0.223 1.350 94.000 0.181 Poor Pending +chr7-82916602-82916603-C-A 356.PCLO.ENST00000437081.1.missense.515D/Y PCLO D515Y 2 EIYAKLRYL ENST00000437081.1 False False 1 HLA-C*06:02 3 None 2 0 700.483 2134.793 0.890 2.600 1.600 4.200 0.173 1.331 0.451 1.480 4.482 0.171 0.766 35.000 0.222 Poor Pending +chr16-25246937-25246938-C-T 717.ZKSCAN2.ENST00000328086.12.missense.420E/K ZKSCAN2 E420K 1 FFKDMDALL ENST00000328086.12 True True 1 HLA-C*06:02 3 None 1 0 1469.265 2971.534 1.038 3.058 1.540 3.390 0.711 1.518 0.545 1.841 4.925 0.441 2.172 68.000 0.454 Poor Pending +chr2-31366060-31366061-G-C 107.XDH.ENST00000379416.4.missense.791R/G XDH R791G 1 NRIVVGVKRM ENST00000379416.4 True True 1 HLA-C*06:02 6 None 1 0 3050.971 2349.515 2.210 2.493 2.420 2.428 5.524 8.287 1.838 2.329 9.677 1.000 9.677 83.000 1.000 Poor Pending +chr4-154491218-154491219-G-C 249.DCHS2.ENST00000357232.10.missense.46S/C DCHS2 S46C 2 ARTQRCLLW ENST00000357232.10 True True 1 HLA-C*06:02 6 6 3 0 1237.637 748.136 2.218 1.387 2.368 1.498 8.485 5.046 1.349 0.763 2.425 1.000 2.425 17.000 0.963 Poor Pending +chr8-66813873-66813874-C-T 421.SGK3.ENST00000521198.7.missense.92A/V SGK3 A92V 6 FIKQRRVGL ENST00000521198.7 True True 1 HLA-C*06:02 7 None 5 0 1208.969 2282.620 2.011 4.519 2.022 5.800 22.636 34.530 1.315 2.469 2.109 0.571 1.204 7.000 0.230 Poor Pending +chrX-77681732-77681733-T-C 928.ATRX.ENST00000395603.7.missense.1137K/E ATRX K1137E 1 TSSEKKAVI ENST00000395603.7 False False 1 HLA-C*06:02 4 None 1 0 5745.992 10128.968 3.900 10.700 4.000 14.000 9.547 16.536 1.572 3.123 57.053 0.990 56.482 293.000 1.000 Poor Pending +chr6-118491773-118491774-G-A 327.CEP85L.ENST00000368491.8.missense.450S/F CEP85L S450F 3 LAFTEKEVL ENST00000368491.8 True True 1 HLA-C*06:02 3 None 2 0 1999.320 9632.973 3.472 13.500 3.600 15.000 9.278 15.426 1.463 3.206 16.147 0.421 6.798 95.000 0.581 Poor Pending +chr5-145817966-145817967-A-G 280.PRELID2.ENST00000683046.1.missense.99C/R PRELID2 C99R 5 IRSHRLTWT ENST00000683046.1 True True NA HLA-C*06:02 5 None 4 0 1902.386 5194.026 2.650 4.515 2.400 3.830 1.405 1.915 17.772 27.862 7.144 0.386 2.758 88.000 0.324 Poor Pending +chr22-50243800-50243801-T-C 873.TUBGCP6.ENST00000248846.10.missense.220H/R TUBGCP6 H220R 2 GALVRSRTY ENST00000248846.10 True True 1 HLA-C*06:02 5 None 3 0 3659.563 3736.638 3.939 2.300 4.179 2.732 6.227 1.512 1.385 1.128 24.241 0.775 18.787 334.000 0.750 Poor Pending +chr7-155462475-155462476-A-G 398.EN2.ENST00000297375.4.missense.264Q/R EN2 Q264R 1 FRTNRYLTE ENST00000297375.4 True True 1 HLA-C*06:02 2 None 1 0 1085.050 13282.926 1.850 12.250 1.700 14.000 1.599 4.657 7.065 19.522 0.408 0.375 0.153 16.000 0.263 Poor Pending +chr11-64320894-64320895-T-C 564.PRDX5.ENST00000265462.9.missense.157F/L PRDX5 F157L 1 LGKETDLLL ENST00000265462.9 True True 1 HLA-C*06:02 1 None 1 0 7252.458 1911.056 4.200 0.965 6.600 3.000 1.687 0.747 2.701 0.900 580.692 0.439 254.924 6089.000 0.427 Poor Pending +chr4-373601-373602-C-T 232.ZNF141.ENST00000240499.8.missense.389H/Y ZNF141 H389Y 1 VLNEHKKIY ENST00000240499.8 True True 1 HLA-C*06:02 9 None 1 0 2945.431 8597.267 1.707 10.394 2.200 11.887 0.835 5.026 0.996 10.479 2.222 0.821 1.824 39.000 0.917 Poor Pending +chr8-125028638-125028639-T-C 425.WASHC5.ENST00000318410.12.missense.1135Y/C WASHC5 Y1135C 1 FLEDYVRCT ENST00000318410.12 True True 1 HLA-C*06:02 8 8 1 0 2021.110 852.214 6.000 2.550 5.600 2.200 0.897 0.091 16.596 7.958 65.088 0.212 13.799 448.000 0.139 Poor Pending +chr11-6401000-6401001-C-T 541.APBB1.ENST00000609360.6.missense.554A/T APBB1 A554T 6 YYLGNVPVT ENST00000609360.6 True True 5 HLA-C*06:02 9 None 1 0 3635.592 2357.170 2.978 3.295 5.700 3.595 2.836 3.111 2.265 0.786 6.678 1.000 6.678 85.000 0.990 Poor Pending +chr8-132141242-132141243-C-G 438.KCNQ3.ENST00000388996.10.missense.451D/H KCNQ3 D451H 3 FTPLNVHAI ENST00000388996.10 True True 1 HLA-C*06:02 7 None 1 0 3125.171 6156.961 0.640 2.400 1.600 3.400 0.260 1.286 0.392 1.769 0.019 1.000 0.019 2.000 0.291 Poor Pending +chr11-862686-862687-C-G 521.TSPAN4.ENST00000397397.7.missense.67I/M TSPAN4 I67M 7 ITGAFVMAM ENST00000397397.7 True True 1 HLA-C*06:02 9 None 2 0 9414.460 10412.885 3.950 5.600 11.000 12.000 0.502 0.323 2.964 3.164 72.214 0.996 71.925 550.000 1.000 Poor Pending +chr7-112821984-112821985-G-T 380.BMT2.ENST00000297145.9.missense.326T/K BMT2 T326K 1 FRKISLKTK ENST00000297145.9 True True 1 HLA-C*06:02 9 None 1 0 4171.512 1550.388 3.106 1.323 4.600 1.446 0.703 0.840 2.766 3.377 34.269 0.188 6.443 224.000 0.179 Poor Pending +chr5-133103958-133103959-T-C 268.HSPA4.ENST00000304858.7.missense.751L/P HSPA4 L751P 1 LNPQNKQSL ENST00000304858.7 True True 1 HLA-C*06:02 3 None 1 0 8800.510 7362.423 4.710 6.300 5.600 7.500 3.820 12.242 1.761 3.089 114.662 0.996 114.203 1368.000 1.000 Poor Pending +chr13-45399008-45399009-C-T 616.SLC25A30.ENST00000519676.6.missense.228M/I SLC25A30 M228I 2 VRTRIMNQRVL ENST00000519676.6 True True 1 HLA-C*06:02 5 None 1 0 4097.368 2358.101 4.220 3.850 2.400 2.500 6.592 6.898 5.878 9.579 20.311 0.520 10.562 223.000 0.451 Poor Pending +chr9-137255473-137255474-G-C 476.NELFB.ENST00000343053.6.missense.37G/R NELFB G37R 1 DRAPSRAV ENST00000343053.6 True True 1 HLA-C*06:02 2 None 1 0 7036.604 30864.890 4.500 28.460 5.000 30.000 9.285 33.739 1.610 8.608 32.319 0.812 26.243 80.000 0.600 Poor Pending +chr9-4286160-4286161-G-T 453.GLIS3.ENST00000381971.8.missense.89Q/K GLIS3 Q89K 1 ALSPRRKML ENST00000381971.8 True True 5 HLA-C*06:02 7 None 1 0 2440.730 815.385 2.409 1.610 3.100 1.700 2.317 1.619 1.226 0.816 2.761 0.043 0.119 23.000 0.153 Poor Pending +chr22-50177151-50177152-C-T 872.PANX2.ENST00000395842.3.missense.147S/F PANX2 S147F 2 LAFTRLTSEL ENST00000395842.3 True True 2 HLA-C*06:02 3 None 1 0 4236.820 11854.784 4.862 15.079 4.925 14.000 12.198 18.134 4.766 12.329 10.842 1.000 10.842 124.000 0.996 Poor Pending +chr20-4182496-4182497-C-A 818.SMOX.ENST00000305958.9.missense.340Q/K SMOX Q340K 1 KRKYTSFF ENST00000305958.9 True True 1 HLA-C*06:02 3 None 1 0 6555.995 6823.720 4.681 4.537 4.400 5.000 4.963 4.074 9.909 10.866 34.520 0.539 18.606 456.000 0.600 Poor Pending +chr18-36067341-36067342-C-G 770.RPRD1A.ENST00000399022.9.missense.21Q/H RPRD1A Q21H 2 SQHSVQTLSL ENST00000399022.9 True True 1 HLA-C*06:02 3 None 2 0 6768.180 13614.600 6.340 13.755 8.980 18.670 31.045 32.315 2.991 8.020 57.249 0.500 28.625 602.000 0.417 Poor Pending +chr3-172353066-172353067-C-T 222.FNDC3B.ENST00000415807.7.missense.927P/S FNDC3B P927S 1 LLSETTYRI ENST00000415807.7 True True 1 HLA-C*06:02 3 None 1 0 8231.150 10805.217 5.855 4.676 7.800 7.100 2.449 1.672 2.202 1.161 92.076 0.317 29.188 928.000 0.356 Poor Pending +chr1-183880710-183880711-A-C 66.RGL1.ENST00000360851.4.missense.174Y/S RGL1 Y174S 2 LLDSLTRMM ENST00000360851.4 True True 1 HLA-C*06:02 4 None 1 0 2323.898 3763.695 2.998 5.675 3.200 5.950 0.665 0.836 2.861 6.274 0.461 0.286 0.132 7.000 0.300 Poor Pending +chr1-16972417-16972418-C-G 2.CROCC.ENST00000375541.10.missense.2009S/C CROCC S2009C 1 LRRSSAPFC ENST00000375541.10 True True 5 HLA-C*06:02 9 9 1 0 5372.915 6036.635 5.264 9.225 4.800 9.050 5.727 5.543 11.259 28.612 11.754 1.000 11.754 56.000 0.988 Poor Pending +chr8-125436370-125436372-CC-TT 436.TRIB1.ENST00000519576.1.missense.109S/F TRIB1 S109F 2 LLHPWFEFV ENST00000519576.1 False False 1 HLA-C*06:02 8 None 1 0 2555.185 3632.808 2.724 2.287 3.452 4.300 0.161 0.486 1.365 0.902 78.491 NA NA NA 0.136 Poor Pending +chrX-40655057-40655058-G-T 892.MED14.ENST00000324817.6.missense.1325F/L MED14 F1325L 1 LLPDQATQL ENST00000324817.6 True True 1 HLA-C*06:02 2 None 1 0 9441.513 6149.382 3.965 4.072 6.100 5.700 3.929 5.044 0.442 0.224 18.572 1.000 18.572 146.000 1.000 Poor Pending +chr4-176120050-176120052-AG-GA 252.WDR17.ENST00000508596.6.missense.164-165KV/KI WDR17 KV164-165KI 2 FRWHTHQKGKI ENST00000508596.6 True True 1 HLA-C*06:02 11 None 1 0 2657.811 3244.824 2.850 2.650 2.000 1.300 20.250 18.009 4.174 6.478 0.514 NA NA NA 0.508 Poor Pending +chr5-14507134-14507135-C-T 263.TRIO.ENST00000344204.9.missense.2876R/C TRIO R2876C 1 MADQGCLL ENST00000344204.9 True True 1 HLA-C*06:02 6 6 1 0 5494.700 1836.907 8.680 2.300 7.560 2.200 47.503 27.161 7.611 1.809 74.348 0.250 18.587 376.000 0.259 Poor Pending +chr11-63544840-63544860-GTGAGCACTTTGTCACCCAGC-G 561.PLAAT4.ENST00000255688.8.FS.113-120GTGAGCACTTTGTCACCCAGC/G 1 PLAAT4 FS113-120 2 SRNCEIWQVPL ENST00000255688.8 True True 1 HLA-C*06:02 6, 7, 8, 9, 10 4 2 1 6763.095 1598.553 3.539 1.247 1.954 0.900 3.679 1.594 9.280 1.921 43.703 0.115 5.026 426.000 0.071 Poor Pending +chr3-52395054-52395055-C-T 195.DNAH1.ENST00000420323.7.missense.3655P/L DNAH1 P3655L 1 PRFIELQTA ENST00000420323.7 True True 1 HLA-C*06:02 6 None 1 0 2770.125 6851.897 5.839 5.656 5.300 5.745 4.443 5.568 11.903 5.740 3.000 0.550 1.650 20.000 0.263 Poor Pending +chr12-112043094-112043095-A-C 590.NAA25.ENST00000261745.9.missense.789S/R NAA25 S789R 1 TRGLEDTM ENST00000261745.9 True True 1 HLA-C*06:02 2 None 1 0 7705.444 25056.852 7.260 29.822 8.520 28.000 4.633 19.071 13.116 32.822 23.927 1.000 23.927 192.000 1.000 Poor Pending +chr6-33723018-33723020-CA-TG 308.IP6K3.ENST00000293756.5.missense.311-312SV/SI IP6K3 SV311-312SI 1 LRALLSII ENST00000293756.5 True True 1 HLA-C*06:02 7 None 1 0 4377.809 3064.893 2.200 3.464 2.100 2.656 1.431 5.458 4.929 2.936 0.009 NA NA NA 0.718 Poor Pending +chr6-109451607-109451608-G-T 322.MICAL1.ENST00000358577.7.missense.309L/M MICAL1 L309M 1 LRLGVMRQPF ENST00000358577.7 False False 1 HLA-C*06:02 6 None 1 0 6448.933 6714.950 6.136 6.071 6.600 7.400 9.094 8.806 3.786 3.010 12.825 1.000 12.825 96.000 0.981 Poor Pending +chr22-37631020-37631021-C-G 855.GGA1.ENST00000343632.9.missense.484P/A GGA1 P484A 1 ARPPQQPVP ENST00000343632.9 True True 1 HLA-C*06:02 1 None 1 0 10012.355 15776.426 5.700 18.928 5.800 18.221 17.313 47.457 2.773 22.309 51.482 0.435 22.395 386.000 0.436 Poor Pending +chr1-150261628-150261629-G-A 42.CA14.ENST00000369111.9.missense.83G/S CA14 G83S 2 DLHNNSHTV ENST00000369111.9 True True 1 HLA-C*06:02 6 None 2 0 2980.250 4815.960 3.604 4.450 4.034 4.600 2.984 4.951 3.004 3.313 0.137 0.500 0.069 4.000 0.321 Poor Pending +chr6-157133135-157133136-G-C 333.ARID1B.ENST00000346085.10.missense.910G/A ARID1B G910A 1 QMHAAISSF ENST00000346085.10 False False 1 HLA-C*06:02 5 None 1 0 11576.119 11546.206 6.033 5.919 12.000 15.000 2.666 2.354 3.294 2.343 39.757 1.000 39.757 163.000 1.000 Poor Pending +chr6-29726902-29726904-AA-CT 301.HLA-F.ENST00000259951.12.missense.353N/L HLA-F N353L 1 YSVVSGLLM ENST00000259951.12 True True NA HLA-C*06:02 7 None 2 0 3204.153 2164.716 3.200 2.833 3.800 3.203 4.175 3.165 2.146 1.807 74.251 NA NA NA 0.648 Poor Pending +chr2-102015965-102015966-C-T 131.IL1R2.ENST00000332549.8.missense.143T/I IL1R2 T143I 3 FISYPQILI ENST00000332549.8 True True 1 HLA-C*06:02 9 None 3 0 2755.746 12392.797 4.535 16.500 5.160 13.646 4.939 19.494 2.796 32.112 0.517 0.300 0.155 10.000 0.200 Poor Pending +chr15-49282070-49282071-G-T 693.GALK2.ENST00000560031.6.missense.197A/S GALK2 A197S 1 LSEEGTAKL ENST00000560031.6 True True 1 HLA-C*06:02 2 None 1 0 9594.131 10272.165 8.650 7.350 13.000 10.000 7.194 4.846 3.335 1.924 24.473 1.000 24.473 184.000 1.000 Poor Pending +chr3-186164997-186164998-C-T 230.DGKG.ENST00000344484.8.missense.681E/K DGKG E681K 2 LSDQLLKVV ENST00000344484.8 False False 1 HLA-C*06:02 7 None 1 0 4161.532 2990.116 5.000 6.677 5.800 8.100 0.680 2.055 3.289 5.471 0.612 1.000 0.612 2.000 0.518 Poor Pending +chr19-35841840-35841841-C-A 806.NPHS1.ENST00000378910.10.missense.897G/C NPHS1 G897C 1 YHQCGVHSSL ENST00000378910.10 True True 1 HLA-C*06:02 4 4 1 0 4576.203 5194.680 4.359 2.797 6.552 4.390 5.327 3.794 1.970 1.024 0.377 1.000 0.377 2.000 0.081 Poor Pending +chr1-27359862-27359863-T-G 6.MAP3K6.ENST00000357582.3.missense.772I/L MAP3K6 I772L 1 LHDNHIVHRDL ENST00000357582.3 True True 1 HLA-C*06:02 11 None 1 0 8165.070 11235.288 7.029 11.388 9.264 11.776 5.558 6.538 7.029 13.579 32.590 0.315 10.266 295.000 0.260 Poor Pending +chr19-17052841-17052842-C-G 801.HAUS8.ENST00000253669.10.missense.304K/N HAUS8 K304N 1 TAKNDLEL ENST00000253669.10 True True 1 HLA-C*06:02 4 None 1 0 6367.606 9384.394 7.869 8.700 9.107 9.300 49.809 40.670 5.816 3.782 10.348 0.602 6.229 98.000 0.548 Poor Pending +chr10-32567832-32567833-C-T 489.CCDC7.ENST00000639629.1.missense.454S/L CCDC7 S454L 1 LEKETRKLL ENST00000639629.1 False True 5 HLA-C*06:02 8 None 1 0 7928.272 14469.725 5.881 9.059 9.400 16.000 5.958 10.516 3.586 2.529 20.750 0.208 4.316 226.000 0.359 Poor Pending +chr5-1814504-1814505-G-A 259.NDUFS6.ENST00000469176.1.missense.118R/H NDUFS6 R118H 1 PAHPHTPLH ENST00000469176.1 False False 2 HLA-C*06:02 3 None 1 0 9806.038 13251.355 15.012 18.062 15.024 20.123 6.106 8.218 14.740 19.372 181.433 0.500 90.716 6.000 0.410 Poor Pending +chr7-82908982-82908983-C-G 352.PCLO.ENST00000333891.14.missense.4444W/S PCLO W4444S 1 DSFDKPRESRL ENST00000333891.14 True True 2 HLA-C*06:02 2 None 1 0 5570.197 18279.600 6.804 13.000 7.648 14.000 24.220 28.466 3.092 3.790 4.482 0.567 2.541 30.000 0.409 Poor Pending +chr1-204125889-204125890-C-T 70.SOX13.ENST00000367204.6.missense.542S/L SOX13 S542L 1 VQMSSLDVL ENST00000367204.6 True True 1 HLA-C*06:02 6 None 1 0 6637.129 4710.542 3.676 6.209 7.700 6.317 1.713 4.465 3.276 5.958 2.664 0.105 0.280 19.000 0.339 Poor Pending +chr15-40622778-40622779-C-T 668.KNL1.ENST00000399668.7.missense.839P/S KNL1 P839S 1 FLKEKQNV ENST00000399668.7 True True 1 HLA-C*06:02 2 None 1 0 7683.072 13539.701 7.240 18.128 6.000 18.000 85.918 89.263 12.066 14.796 13.527 0.492 6.655 128.000 0.444 Poor Pending +chr1-227091907-227091908-T-G 99.CDC42BPA.ENST00000366766.8.missense.778K/T CDC42BPA K778T 1 LLTEENKTL ENST00000366766.8 True True 5 HLA-C*06:02 8 None 1 0 6732.459 10873.180 6.000 10.037 9.100 12.000 3.794 10.793 3.146 3.332 40.050 0.063 2.523 317.000 0.231 Poor Pending +chrX-107601385-107601386-G-T 941.FRMPD3.ENST00000683843.1.missense.1116S/I FRMPD3 S1116I 3 IKLEETSLV ENST00000683843.1 True True NA HLA-C*06:02 1 None 2 0 4074.830 3332.326 5.750 4.086 6.600 4.678 1.329 1.504 4.374 2.786 0.100 0.500 0.050 4.000 0.391 Poor Pending +chr5-141332647-141332648-C-T 275.PCDHGA1.ENST00000517417.3.missense.655S/F PCDHGA1 S655F 1 FATVTLTV ENST00000517417.3 True True 1 HLA-C*06:02 1 None 1 0 6011.591 11020.150 4.300 9.339 4.328 10.133 8.031 17.942 3.786 6.323 0.326 0.571 0.186 7.000 0.681 Poor Pending +chr14-55180753-55180754-G-A 636.DLGAP5.ENST00000247191.7.missense.202S/L DLGAP5 S202L 1 PVMPTLLRM ENST00000247191.7 True True 1 HLA-C*06:02 6 None 1 0 8379.260 6766.322 9.250 15.692 9.300 13.785 7.288 17.599 13.990 17.872 53.642 0.224 12.016 825.000 0.240 Poor Pending +chrX-1419025-1419026-G-A 875.ASMTL.ENST00000381317.9.missense.445T/M ASMTL T445M 1 MAFNLSRFSSA ENST00000381317.9 True True 1 HLA-C*06:02 1 None 1 0 10150.430 13960.746 14.447 13.816 6.230 11.560 11.796 13.355 19.809 17.139 74.609 0.460 34.320 804.000 0.467 Poor Pending +chr8-123220246-123220247-C-A 424.C8orf76.ENST00000276704.6.missense.333E/D C8orf76 E333D 1 IKDEVHPDV ENST00000276704.6 True True 1 HLA-C*06:02 8 None 1 0 9317.899 7302.102 7.338 4.800 11.609 6.201 6.977 4.510 4.807 0.990 45.915 0.173 7.943 352.000 0.129 Poor Pending +chr1-27793606-27793607-C-G 8.STX12.ENST00000373943.9.missense.88P/R STX12 P88R 1 LLKELGSLRL ENST00000373943.9 True True 1 HLA-C*06:02 9 None 1 0 11123.982 18858.066 11.204 17.000 12.097 16.000 10.310 9.751 11.247 20.096 26.914 1.000 26.914 432.000 1.000 Poor Pending +chr1-52961569-52961570-C-A 29.SCP2.ENST00000371514.8.missense.155A/D SCP2 A155D 1 LSDHPVAPQM ENST00000371514.8 True True 1 HLA-C*06:02 3 None 1 0 11772.125 14561.625 10.430 18.480 12.260 19.960 36.780 28.580 7.077 5.496 51.669 0.534 27.591 219.000 0.482 Poor Pending +chr8-125102410-125102411-G-C 427.NSMCE2.ENST00000287437.8.missense.27L/F NSMCE2 L27F 1 SALSSFKNF ENST00000287437.8 True True 1 HLA-C*06:02 6 None 1 0 10695.921 8544.479 10.329 6.345 18.000 14.910 3.175 3.591 1.254 1.291 78.578 0.242 19.016 996.000 0.262 Poor Pending +chr2-219471924-219471925-A-G 178.SPEG.ENST00000312358.12.missense.1258Y/C SPEG Y1258C 1 CKSVIANKL ENST00000312358.12 True True 5 HLA-C*06:02 1 1 1 0 15426.078 4180.749 7.310 0.887 16.040 2.250 1.221 0.341 3.484 0.112 66.211 0.397 26.286 126.000 0.333 Poor Pending +chr7-97006043-97006044-G-C 376.DLX6.ENST00000518156.3.missense.23E/Q DLX6 E23Q 1 SSKSAFMQF ENST00000518156.3 True True 1 HLA-C*06:02 8 None 1 0 4357.518 3597.798 10.241 8.411 15.000 12.000 5.482 2.982 0.933 0.572 2.584 0.424 1.096 33.000 0.411 Poor Pending +chr4-40808808-40808809-A-G 234.NSUN7.ENST00000381782.7.missense.676Y/C NSUN7 Y676C 1 TQHLCCRWV ENST00000381782.7 True True 1 HLA-C*06:02 5 5,6 1 0 5833.522 3314.570 5.800 3.300 5.700 3.400 1.987 0.206 12.859 6.878 0.405 0.333 0.135 6.000 0.471 Poor Pending +chr2-71611503-71611504-C-G 128.DYSF.ENST00000413539.6.missense.1380L/V 1 DYSF L1380V 9 VANISSPSL ENST00000413539.6 False False 1 HLA-C*06:02 1 None 3 1 5227.402 7429.249 6.371 7.162 8.100 8.500 4.735 5.719 0.969 1.437 0.119 1.000 0.119 2.000 1.000 Poor Pending +chr20-41165771-41165772-C-G 834.PLCG1.ENST00000373271.5.missense.582S/C PLCG1 S582C 1 TGAPDGCFL ENST00000373271.5 False False 1 HLA-C*06:02 7 7 1 0 14114.554 11199.621 10.450 7.650 24.000 19.000 1.322 0.923 4.134 2.290 67.838 0.444 30.120 392.000 0.429 Poor Pending +chr2-669669-669670-C-T 102.TMEM18.ENST00000281017.8.missense.111M/I TMEM18 M111I 1 NAMIIVVIW ENST00000281017.8 True True 1 HLA-C*06:02 8 None 1 0 9816.856 14300.477 13.695 14.000 14.290 17.242 0.826 0.703 3.179 3.103 55.263 0.306 16.910 980.000 0.262 Poor Pending +chr18-80136551-80136552-C-T 774.ADNP2.ENST00000262198.9.missense.380P/L ADNP2 P380L 1 LSQPVGLV ENST00000262198.9 True True 1 HLA-C*06:02 7 None 1 0 11014.047 18566.095 13.026 23.149 11.583 22.677 18.660 39.665 16.596 24.322 19.521 1.000 19.521 143.000 0.932 Poor Pending +chrX-43656385-43656386-C-A 918.MAOA.ENST00000338702.4.missense.15D/E MAOA D15E 1 HMFEVVVI ENST00000338702.4 True True 1 HLA-C*06:02 4 None 1 0 7047.562 4898.526 6.484 5.650 7.267 6.000 20.312 18.850 2.829 2.431 0.784 1.000 0.784 2.000 1.000 Poor Pending +chr20-23354058-23354059-C-G 826.NXT1.ENST00000254998.3.missense.6F/L NXT1 F6L 1 SVDLKTYV ENST00000254998.3 True True 1 HLA-C*06:02 4 None 1 0 10507.709 10973.266 12.500 10.044 13.884 7.900 41.097 46.863 8.758 8.494 38.946 0.422 16.435 519.000 0.375 Poor Pending +chr13-25541936-25541938-GA-CT 597.ATP8A2.ENST00000381655.7.missense.224D/L ATP8A2 D224L 3 QGLSHTALM ENST00000381655.7 True True 1 HLA-C*06:02 8 None 2 0 7701.703 9588.191 4.445 13.000 8.200 13.960 1.572 4.584 4.379 11.616 0.145 NA NA NA 0.319 Poor Pending +chr4-103145955-103145956-C-G 237.CENPE.ENST00000265148.9.missense.1429R/T CENPE R1429T 1 TLQESHDEM ENST00000265148.9 True True 2 HLA-C*06:02 1 None 1 0 9564.146 11675.730 11.177 12.037 14.000 15.000 13.553 14.374 5.927 5.996 29.958 0.242 7.250 380.000 0.239 Poor Pending +chr17-29286059-29286060-C-G 757.NUFIP2.ENST00000225388.9.missense.645R/T NUFIP2 R645T 1 SAKEQRYQT ENST00000225388.9 True True 1 HLA-C*06:02 9 None 1 0 14069.192 27877.500 14.000 28.350 12.000 35.700 57.496 60.735 21.130 7.415 31.008 0.998 30.946 661.000 1.000 Poor Pending +chr10-125729432-125729433-C-G 496.EDRF1.ENST00000356792.9.missense.324P/A EDRF1 P324A 1 AIFGGGRYPAV ENST00000356792.9 True True 1 HLA-C*06:02 1 None 1 0 11726.181 27372.588 6.200 29.000 7.900 28.000 5.756 9.803 4.895 33.680 17.377 0.185 3.215 205.000 0.155 Poor Pending +chr10-132163376-132163377-C-G 517.JAKMIP3.ENST00000684848.1.missense.797R/G JAKMIP3 R797G 11 ILGERMEL ENST00000684848.1 True True NA HLA-C*06:02 3 None 2 0 10074.341 6660.773 6.950 6.710 5.200 7.800 54.596 83.679 4.670 3.177 3.848 0.625 2.405 24.000 0.462 Poor Pending +chr1-86453473-86453474-G-A 37.CLCA2.ENST00000370565.5.missense.754G/E CLCA2 G754E 1 GSFSVLEV ENST00000370565.5 True True 1 HLA-C*06:02 7 None 1 0 8492.946 20753.103 6.444 16.476 8.000 18.000 17.182 41.281 4.544 11.439 0.509 1.000 0.509 2.000 0.575 Poor Pending +chr7-92077866-92077867-G-C 361.AKAP9.ENST00000356239.8.missense.2313D/H AKAP9 D2313H 1 LKITTHNKV ENST00000356239.8 True True 1 HLA-C*06:02 6 None 1 0 11726.369 15646.735 11.713 14.238 18.440 23.230 2.800 4.557 6.108 7.220 36.250 0.408 14.790 238.000 0.412 Poor Pending +chr5-134893641-134893642-T-C 269.TXNDC15.ENST00000358387.9.missense.248S/P TXNDC15 S248P 1 DAPQHSSLS ENST00000358387.9 True True 1 HLA-C*06:02 3 None 1 0 12894.035 16771.027 17.631 26.000 17.000 23.000 6.102 7.735 24.290 37.612 42.950 0.996 42.778 447.000 0.993 Poor Pending +chr8-125436370-125436371-C-T 433.TRIB1.ENST00000519576.1.missense.109S/F TRIB1 S109F 1 FVLEPGYI ENST00000519576.1 False False 1 HLA-C*06:02 1 None 1 0 12062.875 18595.580 9.242 18.541 9.000 19.000 9.484 18.083 12.353 24.180 78.491 0.102 8.006 795.000 0.133 Poor Pending +chr17-80086142-80086143-G-C 764.CCDC40.ENST00000397545.9.missense.792E/D CCDC40 E792D 1 VTQEQDEQL ENST00000397545.9 True True 5 HLA-C*06:02 6 None 1 0 7955.613 6905.930 10.285 7.775 12.270 8.300 33.581 23.176 3.530 2.601 5.546 0.300 1.664 10.000 0.181 Poor Pending +chr2-175093191-175093192-C-G 145.ATF2.ENST00000264110.7.missense.352D/H ATF2 D352H 1 AANEDPHEK ENST00000264110.7 True True 1 HLA-C*06:02 7 None 1 0 15444.168 21254.191 15.000 23.000 20.000 29.000 2.445 7.676 2.561 6.824 100.906 0.445 44.903 878.000 0.461 Poor Pending +chr18-14106118-14106119-G-C 768.ZNF519.ENST00000590202.3.missense.141P/A ZNF519 P141A 1 IAMNKYQHKFL ENST00000590202.3 True True 1 HLA-C*06:02 2 None 1 0 11799.630 29763.920 6.460 33.427 5.344 46.000 5.719 16.015 26.712 31.612 8.050 0.350 2.817 20.000 0.453 Poor Pending +chr19-422192-422193-G-C 776.SHC2.ENST00000264554.11.missense.525H/D SHC2 H525D 1 DAGQPKHLL ENST00000264554.11 True True 1 HLA-C*06:02 1 None 1 0 8069.426 2645.181 8.926 4.050 8.952 5.000 14.820 5.531 2.767 0.766 8.139 0.070 0.570 115.000 0.110 Poor Pending +chr15-40622778-40622780-CC-TT 670.KNL1.ENST00000399668.7.missense.839P/L KNL1 P839L 1 FLKEKQNV ENST00000399668.7 True True 1 HLA-C*06:02 2 None 1 0 7683.072 13539.701 7.240 18.128 6.000 18.000 85.918 89.263 12.066 14.796 13.527 NA NA NA 0.450 Poor Pending +chr8-22566400-22566401-G-C 399.SORBS3.ENST00000240123.12.missense.336R/P SORBS3 R336P 1 YLGSAPSL ENST00000240123.12 True True 1 HLA-C*06:02 6 None 1 0 14182.723 8768.131 9.400 4.400 12.000 5.100 26.415 15.408 4.170 2.137 23.107 0.374 8.642 195.000 0.464 Poor Pending +chr2-236392010-236392011-C-T 184.IQCA1.ENST00000409907.8.missense.460E/K IQCA1 E460K 1 VDRERKRPV ENST00000409907.8 True True 1 HLA-C*06:02 6 None 1 0 7632.566 10814.392 13.080 13.403 11.000 14.000 31.111 14.508 12.480 11.903 14.414 0.087 1.254 149.000 0.233 Poor Pending +chr9-137199427-137199428-T-A 475.TPRN.ENST00000409012.6.missense.428E/D TPRN E428D 1 FLPAASDEA ENST00000409012.6 True True 1 HLA-C*06:02 7 None 1 0 7122.345 4962.199 17.355 12.578 17.405 16.000 23.126 22.839 16.153 8.678 10.805 0.333 3.598 93.000 0.296 Poor Pending +chrX-15355261-15355262-C-T 888.VEGFD.ENST00000297904.4.missense.177E/K VEGFD E177K 1 TSVPKLVPV ENST00000297904.4 True True 1 HLA-C*06:02 5 None 1 0 11326.942 13982.521 7.162 10.550 20.160 18.980 2.324 2.070 0.951 2.517 0.674 1.000 0.674 5.000 0.987 Poor Pending +chr9-35750917-35750918-C-T 457.RGP1.ENST00000378078.5.missense.139T/I RGP1 T139I 1 SVKYVYKLII ENST00000378078.5 True True 1 HLA-C*06:02 9 None 1 0 13990.030 10686.365 13.500 12.367 14.000 12.000 9.527 12.733 29.612 22.980 12.548 0.995 12.485 194.000 0.979 Poor Pending +chr3-171138369-171138370-G-T 215.TNIK.ENST00000357327.9.missense.448R/S TNIK R448S 1 RRAEHEQEYKS ENST00000357327.9 False False 1 HLA-C*06:02 11 None 1 0 8498.657 10134.145 11.293 7.955 9.700 8.110 27.922 18.317 13.579 5.289 3.976 0.167 0.664 12.000 0.270 Poor Pending +chrX-9937278-9937279-G-C 885.SHROOM2.ENST00000380913.8.missense.1245D/H SHROOM2 D1245H 1 LEKHQIKTL ENST00000380913.8 True True 1 HLA-C*06:02 4 None 1 0 13470.755 8840.095 5.950 3.550 12.490 7.900 2.878 1.101 1.949 0.796 0.608 1.000 0.608 4.000 1.000 Poor Pending +chr13-98431277-98431278-G-T 618.FARP1.ENST00000319562.11.missense.714R/L FARP1 R714L 3 LAALAEITEM ENST00000319562.11 True True 1 HLA-C*06:02 1 None 3 0 18547.066 16339.945 14.601 13.000 14.890 14.000 13.965 16.161 14.594 8.484 26.190 0.994 26.033 169.000 1.000 Poor Pending +chr14-60724007-60724008-C-G 638.SIX4.ENST00000216513.5.missense.23E/Q SIX4 E23Q 1 QSASEGQEA ENST00000216513.5 True True 1 HLA-C*06:02 1 None 1 0 10447.068 21950.088 22.807 27.000 24.000 28.000 21.614 29.829 20.790 21.596 15.017 0.987 14.822 76.000 1.000 Poor Pending +chr14-32773880-32773881-G-T 631.AKAP6.ENST00000280979.9.missense.1192M/I AKAP6 M1192I 1 IGKESETL ENST00000280979.9 True True 1 HLA-C*06:02 1 None 1 0 11339.865 8491.965 12.649 13.174 14.490 11.187 25.172 44.474 7.214 11.380 2.905 1.000 2.905 6.000 0.607 Poor Pending +chr12-889169-889170-C-G 578.WNK1.ENST00000530271.6.missense.2212Q/E WNK1 Q2212E 1 DLDAELRRT ENST00000530271.6 False False 1 HLA-C*06:02 5 None 1 0 14307.510 14185.341 29.909 32.500 27.000 28.471 29.817 41.109 42.180 43.612 97.460 0.700 68.222 593.000 0.604 Poor Pending +chr12-31697921-31697922-G-T 583.AMN1.ENST00000281471.11.missense.118H/N AMN1 H118N 1 SYLNEASL ENST00000281471.11 True True 1 HLA-C*06:02 4 None 2 0 12671.034 13494.556 10.922 11.509 11.187 11.389 36.116 30.145 7.778 8.465 15.000 0.178 2.670 73.000 0.453 Poor Pending +chr2-53901384-53901385-G-C 114.PSME4.ENST00000404125.6.missense.1084H/D PSME4 H1084D 1 DRQYETIGLDF ENST00000404125.6 True True 1 HLA-C*06:02 1 None 1 0 15332.364 6384.983 15.910 4.285 16.000 4.300 6.346 3.508 15.579 4.630 57.847 0.276 15.966 601.000 0.350 Poor Pending +chr15-74280668-74280669-G-T 703.CCDC33.ENST00000398814.8.missense.297M/I CCDC33 M297I 1 YYSSTSIKG ENST00000398814.8 True True 2 HLA-C*06:02 7 None 1 0 11018.344 12356.660 8.983 10.034 9.300 7.700 8.667 12.368 22.530 26.562 0.158 1.000 0.158 1.000 0.585 Poor Pending +chr19-12580947-12580948-G-A 788.ZNF490.ENST00000311437.11.missense.376S/F ZNF490 S376F 1 EAFKSSSF ENST00000311437.11 True True 1 HLA-C*06:02 8 None 1 0 13407.749 30931.912 13.500 52.500 14.000 51.000 30.768 59.887 3.483 68.143 15.981 0.257 4.107 167.000 0.351 Poor Pending +chr9-37784015-37784016-T-A 458.EXOSC3.ENST00000327304.10.missense.124K/N EXOSC3 K124N 1 IVTANSGDI ENST00000327304.10 True True 1 HLA-C*06:02 5 None 1 0 13025.552 13701.679 21.401 21.500 20.123 21.000 21.801 33.527 28.322 21.809 28.784 0.533 15.342 255.000 0.480 Poor Pending +chr9-137436071-137436072-C-T 478.ENTPD8.ENST00000371506.7.missense.331G/S ENTPD8 G331S 1 FNFSSCQSQ ENST00000371506.7 True True 5 HLA-C*06:02 8 6 1 0 6466.115 9033.067 16.500 22.919 17.000 20.123 14.754 31.384 23.822 30.822 0.236 0.500 0.118 4.000 0.346 Poor Pending +chr12-48693119-48693120-G-C 586.CCNT1.ENST00000261900.8.missense.698I/M CCNT1 I698M 1 YLNPRSGGMSS ENST00000261900.8 True True 1 HLA-C*06:02 9 None 1 0 16413.639 19560.237 21.038 22.114 18.000 22.000 21.076 22.228 33.290 32.309 23.125 1.000 23.125 230.000 1.000 Poor Pending +chr17-7588499-7588500-G-C 735.SOX15.ENST00000538513.6.missense.194Q/E SOX15 Q194E 1 SLPESDPRL ENST00000538513.6 False False 1 HLA-C*06:02 4 None 1 0 12722.974 18041.982 10.052 11.822 15.000 20.000 8.103 10.643 1.003 1.882 0.580 0.692 0.401 13.000 0.722 Poor Pending +chr6-152325133-152325134-C-T 332.SYNE1.ENST00000423061.6.missense.5132E/K SYNE1 E5132K 1 AQDQKKIL ENST00000423061.6 False False 1 HLA-C*06:02 5 None 1 0 13252.179 16300.629 11.800 11.343 13.750 11.687 44.755 9.937 7.825 12.639 5.739 0.286 1.641 7.000 0.323 Poor Pending +chr7-140024672-140024681-TCAAAGATCA-T 394.PARP12.ENST00000263549.8.inframe_del.662-665VIFE/E PARP12 VIFE662-665E 1 SVSDPSIFE ENST00000263549.8 True True 1 HLA-C*06:02 9 None 1 0 12999.516 1520.176 16.000 1.666 17.000 2.460 5.373 0.577 12.981 0.851 29.767 0.153 4.554 307.000 0.108 Poor Pending +chr6-43340177-43340178-C-G 311.ZNF318.ENST00000361428.3.missense.1274G/R ZNF318 G1274R 1 SSFRKFSWK ENST00000361428.3 True True 1 HLA-C*06:02 4 None 1 0 13427.648 9472.569 15.257 9.115 24.000 18.000 4.887 2.297 9.058 3.081 12.831 0.377 4.837 106.000 0.347 Poor Pending +chr17-7675087-7675088-C-T 740.TP53.ENST00000445888.6.missense.175R/H TP53 R175H 1 QHMTEVVRH ENST00000445888.6 False False 1 HLA-C*06:02 9 None 1 0 29413.660 35355.420 17.800 20.255 22.000 27.000 15.589 14.574 4.296 4.361 165.032 1.000 165.032 1415.000 0.989 Poor Pending +chr8-143805313-143805314-A-C 450.SCRIB.ENST00000356994.7.missense.823V/G SCRIB V823G 1 VEPENAGTI ENST00000356994.7 True True 2 HLA-C*06:02 7 None 1 0 19064.426 16102.765 8.070 5.850 17.000 9.800 8.140 1.664 4.645 1.856 61.627 0.055 3.389 402.000 0.164 Poor Pending +chr16-58516554-58516555-G-A 721.SETD6.ENST00000219315.9.missense.185R/H SETD6 R185H 1 LANIHSEYQ ENST00000219315.9 True True 1 HLA-C*06:02 5 None 1 0 11367.018 14816.372 18.462 23.922 18.225 23.843 4.270 15.694 26.309 36.112 11.622 0.340 3.951 100.000 0.335 Poor Pending +chr12-49526214-49526215-G-A 588.SPATS2.ENST00000552918.6.missense.533R/H SPATS2 R533H 1 HKPRTSQTEAV ENST00000552918.6 True True 2 HLA-C*06:02 1 None 1 0 19557.055 19560.241 18.500 19.680 19.000 19.895 11.420 19.465 22.680 23.430 23.424 1.000 23.424 334.000 0.968 Poor Pending +chr2-216428741-216428742-C-G 176.SMARCAL1.ENST00000357276.9.missense.432L/V SMARCAL1 L432V 1 EVDPKVVSNLM ENST00000357276.9 True True 2 HLA-C*06:02 6 None 1 0 16585.061 18065.375 14.964 16.542 15.544 17.289 14.928 15.795 10.336 11.777 14.405 0.520 7.491 179.000 0.457 Poor Pending +chr16-87417563-87417564-G-C 727.ZCCHC14.ENST00000671377.2.missense.427L/V ZCCHC14 L427V 1 SSVQTPQTQ ENST00000671377.2 True True NA HLA-C*06:02 3 None 1 0 12405.247 14310.489 17.500 17.338 18.000 16.675 3.774 5.879 17.309 22.809 12.705 0.248 3.151 153.000 0.277 Poor Pending +chr19-5928080-5928081-C-G 779.RANBP3.ENST00000439268.6.missense.229E/Q RANBP3 E229Q 1 AADEEKQPQ ENST00000439268.6 False False 1 HLA-C*06:02 7 None 1 0 16974.881 23327.545 33.418 51.500 32.836 61.000 52.331 65.615 22.815 26.328 36.036 1.000 36.036 320.000 0.987 Poor Pending +chr15-62819536-62819537-G-A 697.TLN2.ENST00000636159.2.missense.2265E/K TLN2 E2265K 1 KFKQQLAAF ENST00000636159.2 True True 5 HLA-C*06:02 1 None 1 0 18565.994 24045.532 14.227 21.749 21.000 23.000 14.265 21.318 1.631 2.361 20.006 0.351 7.022 154.000 0.452 Poor Pending +chr3-56617278-56617279-G-C 198.CCDC66.ENST00000394672.8.missense.671E/Q CCDC66 E671Q 1 TQDKGASLQ ENST00000394672.8 True True 1 HLA-C*06:02 9 None 1 0 19218.256 18459.341 22.926 24.536 23.000 26.072 20.181 22.543 21.153 23.309 24.974 1.000 24.974 133.000 1.000 Poor Pending +chr17-4545724-4545725-T-C 729.MYBBP1A.ENST00000254718.9.missense.653E/G MYBBP1A E653G 1 WVEVLVGIL ENST00000254718.9 True True 1 HLA-C*06:02 7 None 1 0 16151.965 9173.022 25.500 17.000 26.000 17.000 3.953 2.624 34.112 20.790 47.493 0.319 15.150 420.000 0.352 Poor Pending +chr9-120858190-120858191-G-A 466.PHF19.ENST00000616568.5.missense.518P/L PHF19 P518L 1 LSDSSAEGASV ENST00000616568.5 False False 1 HLA-C*06:02 1 None 1 0 16539.525 31723.815 32.435 53.820 27.870 70.295 37.118 41.639 32.596 51.680 47.989 0.447 21.451 103.000 0.517 Poor Pending +chr19-14049194-14049195-C-T 791.IL27RA.ENST00000263379.4.missense.428A/V IL27RA A428V 1 DVPPGTPAI ENST00000263379.4 True True 1 HLA-C*06:02 2 None 1 0 18374.320 14436.495 14.500 13.781 30.000 28.000 4.850 3.563 1.346 1.003 13.617 0.305 4.153 197.000 0.262 Poor Pending +chr20-17659330-17659331-C-T 825.RRBP1.ENST00000377813.6.missense.393E/K RRBP1 E393K 1 NQGKKVKGA ENST00000377813.6 True True 1 HLA-C*06:02 7 None 1 0 26271.494 30104.310 29.533 34.000 42.000 37.000 27.423 42.515 22.822 22.290 153.904 0.493 75.875 676.000 0.574 Poor Pending +chr11-46728135-46728136-T-C 547.F2.ENST00000311907.10.missense.424V/A F2 V424A 1 NFTENDLLA ENST00000311907.10 True True 1 HLA-C*06:02 9 None 1 0 11362.681 2436.731 14.605 3.086 14.877 3.000 14.333 2.517 19.290 3.531 0.048 1.000 0.048 1.000 0.357 Poor Pending +chr9-129102403-129102404-T-C 467.CRAT.ENST00000318080.7.missense.209Y/C CRAT Y209C 1 VVHNCQFF ENST00000318080.7 True True 1 HLA-C*06:02 5 5 1 0 15891.114 13445.444 10.500 6.050 9.300 6.600 11.613 1.027 24.180 11.759 11.624 0.018 0.209 169.000 0.275 Poor Pending +chr11-62752450-62752451-G-A 555.ZBTB3.ENST00000394807.5.missense.405S/F ZBTB3 S405F 1 LYLSFEYEA ENST00000394807.5 True True 1 HLA-C*06:02 5 None 1 0 17402.141 19820.723 18.572 24.780 26.000 27.000 5.248 24.115 9.550 14.796 13.703 0.601 8.236 148.000 0.670 Poor Pending +chr20-10054508-10054509-G-C 823.ANKEF1.ENST00000378392.6.missense.694K/N ANKEF1 K694N 1 TTSEGNKV ENST00000378392.6 True True 1 HLA-C*06:02 6 None 1 0 13822.942 11853.398 17.139 13.860 20.000 14.220 75.508 79.282 13.139 10.650 3.908 0.382 1.493 34.000 0.521 Poor Pending +chr17-45119014-45119029-TAGACGGTCGTTGTTG-T 761.PLCD3.ENST00000619929.5.inframe_del.233-238SNNDRL/S PLCD3 SNNDRL233-238S 1 HSEGAEIEE ENST00000619929.5 True True 1 HLA-C*06:02 1, 2 None 1 0 20202.129 33730.239 31.947 50.000 33.000 53.000 30.895 34.782 32.080 44.809 26.946 1.000 26.946 64.000 0.941 Poor Pending +chr4-48420360-48420361-A-G 235.SLAIN2.ENST00000264313.11.missense.533R/G SLAIN2 R533G 1 GTTAMGSGL ENST00000264313.11 True True 1 HLA-C*06:02 6 None 1 0 20704.131 17617.499 22.473 20.703 38.000 28.000 14.367 19.407 14.079 14.309 58.280 0.312 18.183 365.000 0.290 Poor Pending +chr6-46662451-46662452-C-G 314.SLC25A27.ENST00000371347.10.missense.154Q/E SLC25A27 Q154E 1 VEMQMEGKRKL ENST00000371347.10 True True 1 HLA-C*06:02 2 None 1 0 22929.869 11640.723 15.243 11.418 16.486 13.000 31.208 22.610 7.573 4.948 14.615 0.521 7.614 71.000 0.484 Poor Pending +chr2-61348284-61348285-C-G 115.USP34.ENST00000398571.7.missense.624D/H USP34 D624H 1 ALKEEHEDD ENST00000398571.7 True True 5 HLA-C*06:02 6 None 1 0 16504.939 19988.133 39.680 48.000 42.000 47.000 35.720 49.549 61.680 65.822 47.363 0.355 16.814 591.000 0.284 Poor Pending +chr2-190982493-190982494-G-C 154.STAT1.ENST00000361099.8.missense.491P/A STAT1 P491A 1 LSFFLTPA ENST00000361099.8 True True 1 HLA-C*06:02 8 None 1 0 26050.477 33378.509 42.777 60.007 29.000 60.000 51.931 57.130 50.372 64.372 172.622 0.520 89.763 1475.000 0.583 Poor Pending +chr1-36179727-36179728-G-A 15.MAP7D1.ENST00000373151.6.missense.765E/K MAP7D1 E765K 1 VQKEKPIPQEP ENST00000373151.6 False False 1 HLA-C*06:02 5 None 1 0 27898.930 29510.745 25.723 26.500 41.000 47.520 18.666 13.907 23.116 22.079 93.193 0.326 30.381 1643.000 0.309 Poor Pending +chr16-2295600-2295601-C-G 711.ABCA3.ENST00000301732.10.missense.801E/D ABCA3 E801D 1 ILPRDSTHRF ENST00000301732.10 True True 1 HLA-C*06:02 5 None 1 0 19481.000 20018.715 14.721 16.740 21.000 17.580 16.087 17.495 4.873 5.473 6.120 0.628 3.843 86.000 0.578 Poor Pending +chr16-3745299-3745300-G-C 713.CREBBP.ENST00000262367.10.missense.1297H/Q CREBBP H1297Q 1 QYDIIWPSGFV ENST00000262367.10 True True 1 HLA-C*06:02 1 None 1 0 22496.904 17537.855 21.653 14.500 35.000 20.654 10.150 7.072 17.153 10.425 54.323 0.303 16.460 251.000 0.239 Poor Pending +chr5-7886679-7886680-G-C 261.MTRR.ENST00000440940.7.missense.375E/Q MTRR E375Q 1 QIRAIPKKAFL ENST00000440940.7 True True 1 HLA-C*06:02 1 None 1 0 21032.195 21191.985 20.627 22.630 14.000 31.633 27.253 27.259 20.822 11.750 64.271 0.204 13.111 372.000 0.194 Poor Pending +chr19-6044262-6044263-G-C 781.RFX2.ENST00000303657.10.missense.37A/G RFX2 A37G 1 GSSNPKGAQM ENST00000303657.10 True True 1 HLA-C*06:02 1 None 1 0 24089.654 18666.695 20.500 15.000 25.000 17.000 48.952 43.652 7.334 4.439 15.809 1.000 15.809 45.000 0.989 Poor Pending +chr17-82961144-82961145-G-C 765.B3GNTL1.ENST00000320865.4.missense.198L/V B3GNTL1 L198V 1 LLFFYEHV ENST00000320865.4 True True 1 HLA-C*06:02 8 None 1 0 16664.893 13813.334 15.895 14.000 14.790 14.000 8.559 7.731 23.809 19.290 10.001 0.235 2.350 81.000 0.221 Poor Pending +chr20-59944225-59944226-A-G 843.FAM217B.ENST00000360816.8.missense.95S/G FAM217B S95G 1 SAGDLSDSE ENST00000360816.8 True True 1 HLA-C*06:02 3 None 1 0 16040.613 13459.374 27.859 19.318 29.000 24.000 15.362 10.444 24.080 17.639 16.580 0.446 7.395 130.000 0.578 Poor Pending +chrX-154349376-154349377-C-G 945.FLNA.ENST00000369850.10.missense.2581D/H FLNA D2581H 1 GQKSSFTVH ENST00000369850.10 True True 1 HLA-C*06:02 9 None 1 0 35550.922 41140.225 40.987 47.046 56.000 58.000 6.105 7.443 3.713 37.180 706.463 0.998 705.050 5609.000 0.992 Poor Pending +chr15-100900576-100900577-G-T 709.ALDH1A3.ENST00000329841.10.missense.296D/Y ALDH1A3 D296Y 1 DADLYLAVE ENST00000329841.10 True True 1 HLA-C*06:02 5 None 1 0 15990.246 20515.195 33.147 43.850 34.650 47.700 7.006 21.747 40.822 35.079 15.852 0.542 8.592 153.000 0.359 Poor Pending +chr15-45133932-45133933-G-A 687.DUOX1.ENST00000389037.7.missense.43R/K DUOX1 R43K 1 HKWGSKGSRL ENST00000389037.7 True True 1 HLA-C*06:02 2 None 1 0 16468.801 3115.106 16.328 1.545 22.957 2.400 42.916 20.613 3.942 0.642 0.947 1.000 0.947 2.000 1.000 Poor Pending +chr22-26540809-26540810-G-T 849.TPST2.ENST00000338754.9.missense.274P/H TPST2 P274H 1 GKHGGVSLSKI ENST00000338754.9 True True 1 HLA-C*06:02 3 None 1 0 23323.926 27697.875 16.500 17.121 21.000 20.000 11.340 6.577 10.336 11.558 28.333 0.210 5.950 371.000 0.203 Poor Pending +chrX-71378281-71378287-GAGATAT-G 924.TAF1.ENST00000423759.6.inframe_del.327-329GDI/G TAF1 GDI327-329G 1 KFSQSTGDKV ENST00000423759.6 True True 5 HLA-C*06:02 9, 10 None 1 0 22701.098 40950.180 29.269 63.372 27.539 64.000 34.010 24.407 29.680 74.372 18.137 0.745 13.512 153.000 0.894 Poor Pending +chr18-80138228-80138229-G-T 775.ADNP2.ENST00000262198.9.missense.939R/I ADNP2 R939I 1 ISAPKDSSS ENST00000262198.9 True True 1 HLA-C*06:02 1 None 1 0 28038.854 22403.804 29.959 32.629 34.000 35.386 25.919 29.873 26.680 33.112 19.521 0.959 18.721 122.000 1.000 Poor Pending +chr8-143795429-143795430-C-T 446.SCRIB.ENST00000356994.7.missense.1235G/D SCRIB G1235D 1 LSPEDPGKE ENST00000356994.7 True True 2 HLA-C*06:02 5 None 1 0 21060.686 21285.296 29.500 28.000 25.000 29.000 40.845 40.031 25.653 21.080 61.627 0.141 8.689 687.000 0.162 Poor Pending +chr7-77600798-77600799-C-T 348.PTPN12.ENST00000248594.11.missense.230H/Y PTPN12 H230Y 1 IYCSAGCGRT ENST00000248594.11 True True 1 HLA-C*06:02 2 3,7 1 0 28165.088 31538.180 48.500 54.000 46.000 52.026 57.592 65.102 52.872 58.372 128.676 0.161 20.717 732.000 0.203 Poor Pending +chr14-32600790-32600791-A-T 628.AKAP6.ENST00000280979.9.missense.910K/M AKAP6 K910M 1 TGSPMAEV ENST00000280979.9 True True 1 HLA-C*06:02 5 None 1 0 16756.820 16556.151 20.000 21.000 24.000 23.000 45.438 91.021 10.403 10.780 2.905 0.250 0.726 8.000 0.708 Poor Pending +chr14-91783159-91783160-T-A 646.TC2N.ENST00000360594.9.missense.471K/N TC2N K471N 1 AVNQWNETVI ENST00000360594.9 False False 1 HLA-C*06:02 6 None 1 0 16298.127 21060.297 19.153 21.000 21.000 21.000 16.110 22.146 23.153 17.425 1.985 0.125 0.248 16.000 0.151 Poor Pending +chrX-68717715-68717716-G-A 922.STARD8.ENST00000374599.8.missense.268G/S STARD8 G268S 1 SASGSGANT ENST00000374599.8 True True 1 HLA-C*06:02 3 None 1 0 16947.018 20371.274 20.000 31.500 20.000 30.000 25.103 33.133 18.653 24.080 0.753 1.000 0.753 3.000 1.000 Poor Pending +chr15-43149136-43149137-G-C 673.TMEM62.ENST00000260403.7.missense.284W/C TMEM62 W284C 1 DCKDNRRYRIF ENST00000260403.7 True True 1 HLA-C*06:02 2 2 1 0 23498.811 24930.150 22.000 18.000 23.000 19.000 13.593 11.400 33.612 20.622 3.179 1.000 3.179 39.000 0.960 Poor Pending +chr19-13765994-13765995-G-C 789.MRI1.ENST00000040663.8.missense.138R/T MRI1 R138T 1 LEKDLTDNRSI ENST00000040663.8 True True 1 HLA-C*06:02 6 None 1 0 24315.523 22895.830 25.891 32.123 31.000 33.000 20.610 32.247 17.653 19.790 24.532 0.201 4.931 389.000 0.224 Poor Pending +chr19-14049194-14049196-CC-TT 792.IL27RA.ENST00000263379.4.missense.428A/V IL27RA A428V 1 PTLWRLQDV ENST00000263379.4 True True 1 HLA-C*06:02 9 None 1 0 15144.356 24958.072 21.000 45.552 21.000 44.880 15.809 37.471 29.180 52.612 13.617 NA NA NA 0.268 Poor Pending +chr6-43587456-43587457-G-A 313.POLH.ENST00000372236.9.missense.153G/D POLH G153D 1 YIEGLPQDP ENST00000372236.9 True True 1 HLA-C*06:02 8 None 1 0 18779.564 21800.404 32.500 36.180 32.000 38.000 8.939 14.847 43.680 34.680 12.570 0.291 3.658 237.000 0.230 Poor Pending +chr11-6410863-6410864-C-T 545.APBB1.ENST00000609360.6.missense.162E/K APBB1 E162K 1 EAEEEEKDD ENST00000609360.6 True True 5 HLA-C*06:02 7 None 1 0 23444.674 23839.804 38.215 53.396 33.327 53.000 43.102 53.792 65.822 62.290 6.678 1.000 6.678 65.000 1.000 Poor Pending +chr16-74391670-74391671-C-T 725.NPIPB15.ENST00000692376.1.missense.308P/L NPIPB15 P308L 1 YLLVPLPL ENST00000692376.1 True True NA HLA-C*06:02 8 None 1 0 22304.596 41493.725 17.527 65.608 18.000 67.000 35.520 65.215 11.635 42.309 10.432 0.015 0.156 68.000 0.409 Poor Pending +chr7-128815875-128815876-C-G 389.CCDC136.ENST00000297788.9.missense.1103S/C CCDC136 S1103C 1 CSLESPEEN ENST00000297788.9 True True 1 HLA-C*06:02 1 1 1 0 18620.033 15643.091 31.052 26.116 28.000 26.000 30.460 26.231 43.822 28.153 4.998 0.250 1.250 32.000 0.200 Poor Pending +chr3-184239802-184239803-C-T 228.VWA5B2.ENST00000691901.1.missense.836A/V VWA5B2 A836V 1 ELAPPAVPPQV ENST00000691901.1 True True NA HLA-C*06:02 11 None 1 0 24316.744 37182.985 16.080 37.500 24.000 52.000 5.980 12.348 11.830 26.596 0.083 1.000 0.083 2.000 0.429 Poor Pending +chr6-32181195-32181196-G-T 304.AGER.ENST00000375069.7.missense.404L/M AGER L404M 1 ERAEMNQSEE ENST00000375069.7 False False 1 HLA-C*06:02 5 None 1 0 23205.215 24499.635 24.408 26.340 19.000 23.000 21.199 28.101 29.309 26.790 2.211 0.462 1.021 26.000 0.510 Poor Pending +chr1-223264671-223264672-G-C 83.SUSD4.ENST00000366878.9.missense.228L/V SUSD4 L228V 6 LQNVIWSSS ENST00000366878.9 True True 1 HLA-C*06:02 4 None 2 0 26936.102 34312.965 45.000 53.681 46.000 54.000 5.170 4.894 47.372 47.372 24.362 0.203 4.945 236.000 0.374 Poor Pending +chr16-49281350-49281351-C-T 718.CBLN1.ENST00000219197.11.missense.39D/N CBLN1 D39N 1 NSNPTSDPT ENST00000219197.11 True True 1 HLA-C*06:02 1 None 1 0 17484.131 25848.946 32.345 47.500 31.305 51.000 17.595 25.357 40.612 53.372 0.713 0.400 0.285 5.000 0.215 Poor Pending +chrX-9967396-9967397-G-A 887.CLDN34.ENST00000445307.4.missense.14V/I CLDN34 V14I 1 QFSIFALTTI ENST00000445307.4 True True NA HLA-C*06:02 4 None 1 0 19315.875 18871.027 23.769 17.500 27.539 14.000 7.063 3.868 28.680 29.180 0.013 1.000 0.013 1.000 0.989 Poor Pending +chr7-27130623-27130624-C-T 341.HOXA4.ENST00000610970.1.missense.37G/D HOXA4 G37D 1 GGPDGGPGY ENST00000610970.1 False False 1 HLA-C*06:02 4 None 1 0 27343.545 27697.790 24.319 29.374 41.000 47.000 26.638 31.749 3.956 4.532 1.689 0.375 0.633 16.000 0.375 Poor Pending +chr5-177460554-177460555-C-T 282.DBN1.ENST00000292385.9.missense.280E/K DBN1 E280K 1 EVEKAAAII ENST00000292385.9 False False 1 HLA-C*06:02 4 None 1 0 30343.260 14681.274 24.500 20.000 36.000 24.000 10.213 6.574 19.309 15.058 109.087 0.009 0.982 1076.000 0.285 Poor Pending +chr19-6755017-6755018-T-C 784.SH2D3A.ENST00000245908.11.missense.265E/G SH2D3A E265G 1 EAEEDEGEEN ENST00000245908.11 True True 1 HLA-C*06:02 7 None 1 0 42235.070 42403.820 75.176 78.496 86.000 87.000 53.783 56.992 55.116 55.558 3.820 1.000 3.820 5.000 0.985 Poor Pending +chr1-227091906-227091907-GC-G 94.CDC42BPA.ENST00000366766.8.FS.778GC/G CDC42BPA FS778 1 VLLTEENKN ENST00000366766.8 True True 5 HLA-C*06:02 9 None 1 0 46042.191 43418.145 58.670 57.420 67.000 80.000 50.340 40.671 66.112 26.498 40.050 0.061 2.443 312.000 0.236 Poor Pending +chr17-4818361-4818376-TGGACAGAATCCTGAA-T 732.PLD2.ENST00000572940.5.inframe_del.662-667VDRILK/V PLD2 VDRILK662-667V 1 KVGDEIVA ENST00000572940.5 False False 1 HLA-C*06:02 8 None 1 0 28033.615 34364.274 38.885 55.046 34.693 38.442 40.411 47.347 43.680 74.372 35.110 0.012 0.421 328.000 0.225 Poor Pending +chr22-37570267-37570268-C-G 853.LGALS2.ENST00000215886.6.missense.132E/Q LGALS2 E132Q 1 FNMSSFKLKQ ENST00000215886.6 True True 1 HLA-C*06:02 10 None 1 0 24541.225 26455.159 47.050 48.812 43.510 37.000 45.101 45.625 55.872 57.372 0.067 0.222 0.015 9.000 0.484 Poor Pending +chr1-36179726-36179728-GG-AA 12.MAP7D1.ENST00000474796.2.missense.763-764EE/EK MAP7D1 EE763-764EK 1 VQKEKPIPQ ENST00000474796.2 True True 2 HLA-C*06:02 5 None 1 0 26736.699 34130.013 35.000 45.000 45.000 51.000 21.351 17.822 13.250 16.328 93.193 NA NA NA 0.361 Poor Pending +chr22-37374977-37374978-G-A 852.ELFN2.ENST00000402918.7.missense.186P/L ELFN2 P186L 1 ELAGNLFN ENST00000402918.7 True True 4 HLA-C*06:02 6 None 1 0 43408.871 43850.435 64.857 72.777 66.970 72.553 52.057 53.815 74.372 86.143 0.890 0.368 0.328 19.000 0.168 Poor Pending +chr19-8969814-8969831-ACGTGGAATTTCCTTGTG-A 787.MUC16.ENST00000397910.8.FS.3175-3180ACGTGGAATTTCCTTGTG/A 1 MUC16 FS3175-3180 1 HRNHITNQV ENST00000397910.8 False True 5 HLA-C*06:02 NA None 6 1 212.282 NA 0.134 NA 0.570 NA 0.016 NA 0.089 NA 0.003 0.000 0.000 0.000 0.750 NoExpr Pending +chr5-115130597-115130604-ACTAACTG-A 266.TRIM36.ENST00000513154.6.FS.595-597ACTAACTG/A 1 TRIM36 FS595-597 3 VRMPVLIL ENST00000513154.6 True True 2 HLA-C*06:02 NA None 4 1 435.525 NA 0.297 NA 0.400 NA 0.194 NA 0.305 NA 1.136 0.000 0.000 0.000 0.920 NoExpr Pending +chr4-114833618-114833619-A-G 243.NDST4.ENST00000264363.7.missense.795S/P 1 NDST4 S795P 1 PRYNYPEAL ENST00000264363.7 True True 1 HLA-C*06:02 6 None 2 1 215.330 219.441 0.455 0.802 0.510 0.765 0.723 1.568 0.318 0.802 0.003 0.000 0.000 0.000 0.187 NoExpr Pending +chr14-91235009-91235029-GGTACAGCTCATCGAGGAGTT-G 644.GPR68.ENST00000650645.1.FS.8-14GGTACAGCTCATCGAGGAGTT/G GPR68 FS8-14 3 GREPAPRVL ENST00000650645.1 True True NA HLA-C*06:02 NA None 13 0 526.873 NA 0.336 NA 0.630 NA 0.177 NA 0.156 NA 0.177 0.000 0.000 34.000 0.093 NoExpr Pending +chr2-110933496-110933497-G-A 138.ACOXL.ENST00000439055.6.missense.305G/E ACOXL G305E 3 SRYAEALL ENST00000439055.6 True True 2 HLA-C*06:02 5 None 3 0 704.111 497.515 0.750 0.377 0.560 0.310 8.140 9.344 0.878 0.357 0.188 0.000 0.000 2.000 1.000 NoExpr Pending +chr11-5968293-5968294-G-C 530.OR56A5.ENST00000532411.2.missense.67S/R OR56A5 S67R 1 YYLLRLLSL ENST00000532411.2 True True NA HLA-C*06:02 5 None 2 0 1025.500 3356.741 0.570 1.225 0.580 1.600 0.892 0.687 0.171 0.752 0.000 1.000 0.000 2.000 1.000 NoExpr Pending +chr19-8955983-8955984-G-A 786.MUC16.ENST00000397910.8.missense.6929S/F MUC16 S6929F 1 STMGHTTVF ENST00000397910.8 False True 5 HLA-C*06:02 9 None 1 0 1002.415 10709.648 0.840 8.300 1.206 8.800 0.561 2.488 0.201 14.996 0.003 0.000 0.000 0.000 0.471 NoExpr Pending +chr12-10159995-10159996-G-C 582.OLR1.ENST00000309539.8.missense.236Q/E OLR1 Q236E 1 VRGAVSETY ENST00000309539.8 True True 1 HLA-C*06:02 7 None 1 0 657.589 326.696 1.295 0.466 1.800 0.580 2.075 0.442 0.373 0.188 0.273 0.000 0.000 0.000 0.195 NoExpr Pending +chr11-124319973-124319974-G-A 575.OR8D2.ENST00000624618.2.missense.75S/F OR8D2 S75F 1 YSFVITPKM ENST00000624618.2 True True NA HLA-C*06:02 3 None 3 0 937.560 1485.980 0.972 2.229 1.000 2.400 1.233 2.228 0.533 0.362 0.000 0.000 0.000 0.000 1.000 NoExpr Pending +chr6-73363141-73363172-CTTGATTCACGTGAATCGATTGGACCCTAACG-C 320.KHDC3L.ENST00000370367.4.FS.73-83CTTGATTCACGTGAATCGATTGGACCCTAACG/C KHDC3L FS73-83 1 LRSWYLGGL ENST00000370367.4 True True 1 HLA-C*06:02 NA None 1 0 847.280 NA 1.193 NA 1.900 NA 1.165 NA 1.028 NA 0.000 0.000 0.000 0.000 0.113 NoExpr Pending +chr11-123943666-123943667-G-C 574.OR6T1.ENST00000321252.3.missense.58Q/E OR6T1 Q58E 1 QRLHIEMYF ENST00000321252.3 True True NA HLA-C*06:02 6 None 2 0 1876.090 982.519 0.550 0.600 3.000 1.900 0.228 0.502 0.332 0.200 0.000 0.000 0.000 0.000 0.448 NoExpr Pending +chr19-50625545-50625546-G-A 808.SYT3.ENST00000338916.8.missense.474S/F SYT3 S474F 3 FSDPYVKAF ENST00000338916.8 False False 1 HLA-C*06:02 9 None 3 0 1417.643 4654.364 0.960 6.381 1.600 4.700 0.353 1.689 0.202 8.620 0.000 0.000 0.000 0.000 0.540 NoExpr Pending +chr11-64593669-64593670-G-C 568.SLC22A12.ENST00000377574.6.missense.233V/L SLC22A12 V233L 3 ARPLLMTL ENST00000377574.6 True True 1 HLA-C*06:02 5 None 3 0 1700.215 909.275 0.955 0.722 0.990 0.744 2.594 2.004 0.420 0.236 0.000 0.000 0.000 0.000 0.155 NoExpr Pending +chr13-25541937-25541938-A-T 603.ATP8A2.ENST00000381655.7.missense.224D/V ATP8A2 D224V 3 IRQGLSHTAL ENST00000381655.7 True True 1 HLA-C*06:02 10 None 5 0 1743.110 25171.980 0.967 32.000 0.789 32.000 1.468 4.790 0.927 47.372 0.145 0.000 0.000 0.000 0.306 NoExpr Pending +chrX-141003559-141003560-C-G 943.SPANXB1.ENST00000449283.2.missense.74L/V SPANXB1 L74V 1 KRTSPEELV ENST00000449283.2 True True 1 HLA-C*06:02 9 None 2 0 1261.089 1252.150 1.500 1.843 1.500 1.900 2.015 1.925 0.768 0.492 0.000 0.000 0.000 0.000 0.830 NoExpr Pending +chr17-3433668-3433669-G-T 728.OR1E2.ENST00000248384.1.missense.58P/H OR1E2 P58H 1 HLHTHVYLF ENST00000248384.1 True True NA HLA-C*06:02 5 None 1 0 1916.175 6718.765 1.214 4.115 2.700 8.900 0.424 2.328 0.660 1.637 0.000 0.000 0.000 2.000 0.312 NoExpr Pending +chr5-150120064-150120065-G-A 281.PDGFRB.ENST00000261799.9.missense.882T/I PDGFRB T882I 1 SIFNSLYTI ENST00000261799.9 True True 1 HLA-C*06:02 9 None 1 0 1871.945 9818.256 1.613 11.000 3.300 11.000 0.685 3.475 1.402 24.180 0.280 0.000 0.000 6.000 0.291 NoExpr Pending +chr13-25541936-25541937-G-C 591.ATP8A2.ENST00000381655.7.missense.224D/H ATP8A2 D224H 3 TALMQTREV ENST00000381655.7 True True 1 HLA-C*06:02 3 None 4 0 1850.970 792.810 1.767 1.250 3.000 1.300 2.674 3.324 0.422 0.743 0.145 0.000 0.000 0.000 0.304 NoExpr Pending +chr2-26458127-26458128-A-G 105.OTOF.ENST00000339598.8.missense.1202I/T OTOF I1202T 2 TRYKWLIIKTV ENST00000339598.8 False False 1 HLA-C*06:02 10 None 1 0 2133.930 3145.375 1.657 2.404 0.850 1.500 1.914 1.707 2.379 8.689 0.281 0.000 0.000 0.000 0.995 NoExpr Pending +chr3-39188114-39188115-A-T 193.XIRP1.ENST00000396251.1.missense.444L/H XIRP1 L444H 1 TFKNHFETL ENST00000396251.1 False False 1 HLA-C*06:02 5 None 2 0 2106.447 8032.062 1.900 4.780 2.950 7.800 0.689 0.855 0.213 0.496 0.042 0.000 0.000 0.000 0.661 NoExpr Pending +chr7-132508196-132508197-C-A 390.PLXNA4.ENST00000321063.9.missense.166S/I PLXNA4 S166I 1 HYLSGVNEI ENST00000321063.9 True True 5 HLA-C*06:02 9 None 1 0 3428.469 16127.559 0.680 16.653 3.500 19.020 0.455 4.646 0.212 12.603 0.575 0.000 0.000 2.000 0.281 NoExpr Pending +chr18-60371739-60371740-T-G 773.MC4R.ENST00000299766.5.missense.204M/L MC4R M204L 1 MFFTLLALM ENST00000299766.5 True True NA HLA-C*06:02 5 None 1 0 1311.905 839.106 2.550 2.056 2.300 1.911 0.635 0.575 3.507 3.977 0.000 0.000 0.000 0.000 1.000 NoExpr Pending +chr6-47000271-47000272-C-T 316.ADGRF1.ENST00000283297.5.missense.698G/R ADGRF1 G698R 1 TRDSSDNIML ENST00000283297.5 False False 1 HLA-C*06:02 2 None 1 0 1158.500 26213.375 2.800 22.753 2.800 30.000 4.281 14.129 2.349 15.725 0.655 0.000 0.000 0.000 0.491 NoExpr Pending +chr9-113369791-113369792-G-A 463.BSPRY.ENST00000374183.5.missense.287A/T BSPRY A287T 1 FQNGLHTWM ENST00000374183.5 True True 1 HLA-C*06:02 7 None 1 0 2174.949 2553.325 2.260 3.211 3.800 5.200 0.301 0.405 1.080 1.516 0.090 0.000 0.000 0.000 0.537 NoExpr Pending +chr4-176120051-176120052-G-A 253.WDR17.ENST00000280190.8.missense.189V/I WDR17 V189I 3 HTHQKGKIV ENST00000280190.8 False False 1 HLA-C*06:02 8 None 2 0 2657.255 2338.375 2.005 2.040 3.200 2.800 2.189 2.669 1.360 1.025 0.514 0.000 0.000 2.000 0.489 NoExpr Pending +chr4-110559663-110559664-G-C 242.ENPEP.ENST00000265162.10.missense.887R/T ENPEP R887T 1 NRYTLNNTN ENST00000265162.10 True True 1 HLA-C*06:02 8 None 1 0 2098.331 3040.549 2.920 4.935 2.840 4.600 1.323 3.250 12.530 20.309 0.032 0.000 0.000 0.000 0.239 NoExpr Pending +chr8-132948805-132948806-C-G 442.TG.ENST00000220616.9.missense.1755P/R TG P1755R 1 LLSSRSVLL ENST00000220616.9 True True 1 HLA-C*06:02 5 None 1 0 2772.010 6480.871 2.312 3.825 2.800 6.500 2.648 3.016 1.888 2.698 0.721 0.000 0.000 0.000 0.992 NoExpr Pending +chr15-94399982-94399983-G-T 706.MCTP2.ENST00000357742.10.missense.651K/N MCTP2 K651N 3 RFVEDSRNL ENST00000357742.10 True True 1 HLA-C*06:02 8 None 3 0 3164.351 4033.896 2.071 2.220 4.440 5.200 2.641 2.940 0.714 0.564 0.138 0.000 0.000 0.000 0.203 NoExpr Pending +chr5-23521053-23521054-C-G 264.PRDM9.ENST00000296682.4.missense.128S/C PRDM9 S128C 1 ASFSNECSL ENST00000296682.4 True True 1 HLA-C*06:02 7 7 1 0 2733.890 2134.276 2.583 1.765 3.500 2.200 2.467 1.730 2.135 1.217 0.024 0.000 0.000 0.000 0.417 NoExpr Pending +chr6-122781239-122781240-C-G 330.FABP7.ENST00000356535.4.missense.132P/A FABP7 P132A 1 FFSSAHTSHL ENST00000356535.4 False False 1 HLA-C*06:02 5 None 2 0 2031.300 1389.755 3.829 1.888 3.980 1.850 9.361 7.541 2.798 1.378 0.317 0.000 0.000 0.000 0.362 NoExpr Pending +chr10-13481023-13481024-C-G 484.BEND7.ENST00000378605.3.missense.274R/T BEND7 R274T 2 TRSGSLLFT ENST00000378605.3 False False 1 HLA-C*06:02 9 None 1 0 4993.885 9481.233 2.050 4.200 2.200 12.000 0.340 0.417 6.994 1.956 0.053 0.000 0.000 0.000 1.000 NoExpr Pending +chr4-121932625-121932626-C-A 245.TRPC3.ENST00000379645.8.missense.211C/F TRPC3 C211F 3 TLSPFEQEL ENST00000379645.8 True True 1 HLA-C*06:02 5 None 1 0 3541.898 3408.950 2.850 3.750 4.600 4.200 0.060 1.673 0.370 1.564 0.068 0.000 0.000 0.000 0.300 NoExpr Pending +chr3-38698510-38698511-G-A 189.SCN10A.ENST00000449082.3.missense.1570T/M SCN10A T1570M 3 QSYFSPMLF ENST00000449082.3 True True 1 HLA-C*06:02 7 None 5 0 2637.368 3616.841 3.748 4.044 5.600 7.800 1.325 1.495 0.967 1.228 0.004 0.000 0.000 0.000 0.273 NoExpr Pending +chr2-222689427-222689428-G-T 179.MOGAT1.ENST00000446656.4.missense.146W/L MOGAT1 W146L 1 SYLHVLPLL ENST00000446656.4 True True 5 HLA-C*06:02 9 None 1 0 4079.734 18674.560 2.751 16.082 4.300 22.000 0.864 5.480 0.249 1.514 0.091 0.000 0.000 2.000 0.349 NoExpr Pending +chr1-37721680-37721681-G-T 17.EPHA10.ENST00000373048.9.missense.709L/M EPHA10 L709M 2 GQFDHSHIVRM ENST00000373048.9 True True 5 HLA-C*06:02 11 None 1 0 2813.115 3289.369 3.600 3.650 3.700 5.100 7.269 5.941 1.788 1.121 0.059 0.000 0.000 0.000 0.382 NoExpr Pending +chr11-63290369-63290370-G-A 557.SLC22A10.ENST00000332793.11.missense.69E/K SLC22A10 E69K 2 LSKDALLRI ENST00000332793.11 True True 1 HLA-C*06:02 3 None 1 0 3047.901 7716.423 3.424 8.300 6.000 14.000 1.647 3.652 0.721 4.089 0.070 0.000 0.000 0.000 0.553 NoExpr Pending +chr6-29174125-29174126-C-T 299.OR2J2.ENST00000641417.1.missense.164T/I OR2J2 T164I 2 ISALHSSFI ENST00000641417.1 True True NA HLA-C*06:02 9 None 1 0 3364.601 18024.981 3.115 20.500 4.800 23.000 0.423 1.994 2.453 29.612 0.037 0.000 0.000 0.000 0.277 NoExpr Pending +chr3-122927970-122927971-G-C 206.SEMA5B.ENST00000357599.8.missense.223I/M SEMA5B I223M 5 RTIEKMNGV ENST00000357599.8 True True 1 HLA-C*06:02 6 None 1 0 3717.845 2279.199 2.963 1.582 4.300 3.200 2.527 0.864 0.655 0.219 0.169 0.000 0.000 0.000 1.000 NoExpr Pending +chr17-78484882-78484883-A-T 762.DNAH17.ENST00000389840.7.missense.2545M/K DNAH17 M2545K 1 QHKDHRHWY ENST00000389840.7 True True 5 HLA-C*06:02 3 None 1 0 3477.809 1938.914 3.116 1.828 4.431 2.795 0.792 0.847 2.734 1.443 0.134 0.000 0.000 2.000 0.232 NoExpr Pending +chr6-43283594-43283595-A-T 310.TTBK1.ENST00000259750.9.missense.952E/V TTBK1 E952V 1 SGGQALRSV ENST00000259750.9 True True 1 HLA-C*06:02 9 None 2 0 4397.388 16713.902 2.950 21.096 6.700 20.000 0.972 10.507 1.700 30.096 0.015 0.000 0.000 0.000 0.267 NoExpr Pending +chr15-44767453-44767453-T-TC 680.TRIM69.ENST00000329464.9.FS.395T/TC TRIM69 FS395 1 QRIHHSEGQL ENST00000329464.9 True True 1 HLA-C*06:02 NA None 1 0 5752.564 NA 2.600 NA 3.300 NA 18.904 NA 1.873 NA 21.208 0.000 0.000 4.000 0.324 NoExpr Pending +chr14-94463231-94463232-G-T 661.SERPINA9.ENST00000337425.10.missense.390T/N SERPINA9 T390N 1 TAATTNKFI ENST00000337425.10 False False 1 HLA-C*06:02 6 None 1 0 5811.420 6163.994 2.556 1.907 12.000 7.300 0.576 0.138 1.656 0.937 0.035 0.000 0.000 0.000 0.461 NoExpr Pending +chr11-59364558-59364559-T-A 554.OR5AN1.ENST00000641998.1.missense.34V/E OR5AN1 V34E 2 VLFTIFLEI ENST00000641998.1 True True NA HLA-C*06:02 8 None 1 0 4823.080 7656.564 3.195 6.025 9.200 14.000 0.239 0.151 2.345 4.766 0.154 0.000 0.000 0.000 0.116 NoExpr Pending +chr14-70060889-70060890-C-G 639.SLC8A3.ENST00000356921.7.missense.612E/Q SLC8A3 E612Q 1 ERQQNFFIAL ENST00000356921.7 True True 1 HLA-C*06:02 4 None 1 0 6319.885 6663.865 3.035 2.021 3.032 1.913 0.836 0.471 3.119 2.265 0.023 0.000 0.000 0.000 1.000 NoExpr Pending +chr7-87424004-87424005-A-C 360.ABCB4.ENST00000649586.2.missense.704N/K ABCB4 N704K 1 KKTEWPYFV ENST00000649586.2 True True NA HLA-C*06:02 1 None 1 0 5776.777 3681.226 3.329 4.170 5.700 6.901 0.088 0.076 1.165 2.000 0.044 0.000 0.000 0.000 0.181 NoExpr Pending +chr19-13931970-13931971-A-G 790.PODNL1.ENST00000588872.3.missense.523F/L PODNL1 F523L 1 STPRLRALL ENST00000588872.3 True True 3 HLA-C*06:02 9 None 1 0 5933.687 13326.803 3.257 6.904 15.000 25.000 2.614 5.407 1.636 2.416 7.123 0.000 0.000 12.000 0.142 NoExpr Pending +chr2-227893862-227893863-C-T 180.DAW1.ENST00000309931.3.missense.129T/M DAW1 T129M 1 ASGEELNML ENST00000309931.3 True True 1 HLA-C*06:02 8 None 1 0 3768.321 6667.913 5.400 6.150 6.300 8.700 0.572 0.781 3.660 2.117 0.488 0.000 0.000 0.000 0.336 NoExpr Pending +chr1-45058674-45058675-G-A 26.ZSWIM5.ENST00000359600.6.missense.396L/F ZSWIM5 L396F 1 VADPRFTL ENST00000359600.6 True True 1 HLA-C*06:02 6 None 1 0 4563.358 2862.120 4.296 2.966 4.393 3.331 30.412 25.471 1.417 1.163 0.606 0.000 0.000 0.000 0.354 NoExpr Pending +chr8-23368189-23368210-TGGCCACGTTGGCGGGGGCCTG-T 400.LOXL2.ENST00000389131.8.inframe_del.48-54QAPANVA/- LOXL2 QAPANVA48-54- 1 EYHQPKIQL ENST00000389131.8 True True 1 HLA-C*06:02 6, 7, 8, 9 None 1 0 4938.498 18441.500 4.050 36.000 5.600 38.000 13.559 48.047 0.623 11.779 102.877 0.000 0.000 110.000 0.706 NoExpr Pending +chr10-60186848-60186849-G-T 491.ANK3.ENST00000280772.7.missense.651L/M ANK3 L651M 1 NQMDIATTLM ENST00000280772.7 True True 1 HLA-C*06:02 10 None 1 0 6091.373 5856.350 3.729 2.153 3.970 2.332 1.111 0.805 4.294 2.788 0.163 0.000 0.000 0.000 0.134 NoExpr Pending +chr20-59301546-59301547-G-T 840.EDN3.ENST00000395654.3.missense.64G/W EDN3 G64W 2 VAGPGEWTV ENST00000395654.3 False False 1 HLA-C*06:02 7 None 1 0 4246.898 11166.819 6.250 10.350 9.800 15.000 1.626 5.128 1.309 3.385 0.019 0.000 0.000 0.000 0.220 NoExpr Pending +chr15-44767434-44767452-AAATGGACAGTTGGAGTTG-A 678.TRIM69.ENST00000560442.5.inframe_del.185-191KWTVGVV/I TRIM69 KWTVGVV185-191I 2 IRESIIRKG ENST00000560442.5 False False 1 HLA-C*06:02 1 None 1 0 4970.114 5079.230 5.900 4.400 6.800 3.600 0.564 0.681 11.809 11.909 21.208 0.000 0.000 3.000 0.299 NoExpr Pending +chr21-43172070-43172071-G-C 845.CRYAA.ENST00000291554.6.missense.105D/H CRYAA D105H 3 ERQHDHGYI ENST00000291554.6 True True 1 HLA-C*06:02 4 None 1 0 3878.268 1746.765 7.082 2.856 7.164 2.911 3.181 1.562 6.175 2.279 0.000 0.000 0.000 0.000 0.540 NoExpr Pending +chr7-117548739-117548740-G-T 381.CFTR.ENST00000003084.11.missense.437G/C CFTR G437C 1 FFSNFSLLC ENST00000003084.11 True True 1 HLA-C*06:02 9 9 1 0 4356.166 6952.814 6.372 6.016 6.045 5.400 1.629 1.755 9.008 26.180 1.844 0.000 0.000 0.000 0.116 NoExpr Pending +chrX-32389609-32389610-C-T 889.DMD.ENST00000357033.9.missense.1470R/H DMD R1470H 1 HLQESKMIL ENST00000357033.9 True True 1 HLA-C*06:02 1 None 1 0 8205.625 7437.055 4.367 5.210 8.000 5.620 5.133 5.964 2.079 2.377 3.178 0.000 0.000 0.000 1.000 NoExpr Pending +chr11-70087776-70087777-C-T 571.ANO1.ENST00000355303.10.missense.45P/L ANO1 P45L 1 LLNSLSVDL ENST00000355303.10 True True 1 HLA-C*06:02 9 None 1 0 5793.859 20782.764 8.673 45.359 8.800 40.000 1.874 15.058 9.223 67.872 0.764 0.000 0.000 0.000 0.187 NoExpr Pending +chr6-29374537-29374538-G-C 300.OR12D3.ENST00000396806.3.missense.250F/L OR12D3 F250L 1 LYGPVGFTYI ENST00000396806.3 True True NA HLA-C*06:02 1 None 2 0 9119.172 2751.205 5.604 1.790 7.400 1.900 0.412 0.125 3.611 1.342 0.006 0.000 0.000 0.000 0.398 NoExpr Pending +chr17-41771694-41771736-GTGTACTGGCGCCCGCAGGCCTCATCCTCCTCCATGATGCCCT-G 758.JUP.ENST00000310706.9.inframe_del.40-54KGIMEEDEACGRQYT/T JUP KGIMEEDEACGRQYT40-54T 1 STLKKTTTY ENST00000310706.9 False False 1 HLA-C*06:02 1 None 1 0 11824.360 4673.742 4.675 2.399 8.900 3.200 4.749 2.886 0.678 0.337 7.210 0.000 0.000 5.000 0.224 NoExpr Pending +chr7-39339738-39339739-G-C 343.POU6F2.ENST00000518318.7.missense.232Q/H POU6F2 Q232H 1 STNHHPQPA ENST00000518318.7 True True 1 HLA-C*06:02 4 None 1 0 6946.793 6989.125 11.078 7.905 14.000 8.800 3.798 2.897 7.028 6.297 0.273 0.000 0.000 0.000 0.299 NoExpr Pending +chr6-73363176-73363177-AG-A 321.KHDC3L.ENST00000370367.4.FS.84AG/A KHDC3L FS84 1 NGELRSWYL ENST00000370367.4 True True 1 HLA-C*06:02 NA None 1 0 9534.129 NA 7.400 NA 7.800 NA 3.887 NA 4.780 NA 0.000 0.000 0.000 0.000 0.085 NoExpr Pending +chr14-39247882-39247883-G-C 633.MIA2.ENST00000280082.4.missense.437D/H MIA2 D437H 1 KIIETEHQI ENST00000280082.4 False False 1 HLA-C*06:02 7 None 1 0 9959.264 17557.256 7.200 19.500 15.100 21.770 2.487 8.888 0.742 5.483 41.150 0.000 0.000 0.000 0.984 NoExpr Pending +chr3-58210851-58210852-G-C 199.DNASE1L3.ENST00000394549.7.missense.19L/V DNASE1L3 L19V 1 LSIHSAVAM ENST00000394549.7 True True 1 HLA-C*06:02 7 None 1 0 10596.275 7443.254 6.499 6.004 7.610 12.000 5.699 6.607 3.039 2.756 0.181 0.000 0.000 0.000 1.000 NoExpr Pending +chr3-44242057-44242058-G-A 194.TOPAZ1.ENST00000309765.4.missense.2R/Q TOPAZ1 R2Q 1 QRPPPLGPTTA ENST00000309765.4 True True 5 HLA-C*06:02 1 None 1 0 14924.325 9977.635 4.365 4.009 8.200 4.400 4.230 4.401 2.421 1.227 0.005 0.000 0.000 0.000 0.307 NoExpr Pending +chr13-37746421-37746422-C-T 612.TRPC4.ENST00000379705.8.missense.138E/K TRPC4 E138K 1 FSKFTPDI ENST00000379705.8 True True 1 HLA-C*06:02 3 None 1 0 8180.785 14554.197 12.524 17.000 12.097 17.000 40.830 52.827 12.129 20.790 0.053 0.000 0.000 0.000 0.507 NoExpr Pending +chr1-207623001-207623002-C-G 76.CR1.ENST00000367049.9.missense.2429S/C CR1 S2429C 1 TLCGTIFFI ENST00000367049.9 True True 5 HLA-C*06:02 3 3 1 0 12588.991 6571.843 6.949 4.463 7.267 7.800 0.330 0.135 7.166 2.942 0.135 0.000 0.000 0.000 0.285 NoExpr Pending +chr2-201835739-201835740-A-C 171.CDK15.ENST00000260967.6.missense.225E/D CDK15 E225D 1 ATDYSSEL ENST00000260967.6 False False 1 HLA-C*06:02 3 None 1 0 9438.418 16082.683 11.527 15.500 13.000 16.000 55.804 65.710 4.976 12.250 0.204 0.000 0.000 0.000 0.574 NoExpr Pending +chr8-138737576-138737577-C-A 443.COL22A1.ENST00000303045.11.missense.696G/W COL22A1 G696W 1 LRWKKGDMG ENST00000303045.11 True True 1 HLA-C*06:02 3 None 1 0 5695.865 12356.070 19.500 28.021 11.990 20.430 33.842 30.739 29.180 48.372 0.308 0.000 0.000 2.000 0.200 NoExpr Pending +chr16-25221522-25221523-G-C 715.AQP8.ENST00000219660.6.missense.109M/I AQP8 M109I 1 MLIGGLNLVI ENST00000219660.6 True True 1 HLA-C*06:02 10 None 1 0 13229.690 10058.093 8.179 7.550 8.800 9.000 2.953 3.191 14.279 11.165 0.000 0.000 0.000 0.000 0.247 NoExpr Pending +chr11-92982014-92982015-G-T 573.MTNR1B.ENST00000257068.3.missense.264W/C MTNR1B W264C 1 FAICCAPL ENST00000257068.3 True True 1 HLA-C*06:02 5 4,5 1 0 8990.586 10680.602 15.100 14.080 12.000 12.000 60.674 17.705 16.750 15.580 0.000 0.000 0.000 0.000 0.414 NoExpr Pending +chr1-203347717-203347718-G-C 68.FMOD.ENST00000354955.5.missense.185H/D FMOD H185D 1 LRELHLDDN ENST00000354955.5 True True 1 HLA-C*06:02 8 None 1 0 9606.940 19288.796 15.164 24.826 9.160 13.539 10.071 4.246 59.612 44.112 0.000 0.000 0.000 0.000 0.284 NoExpr Pending +chr9-81992222-81992223-C-G 462.SPATA31D1.ENST00000344803.3.missense.585Q/E SPATA31D1 Q585E 1 LAQPESPFRAL ENST00000344803.3 True True 2 HLA-C*06:02 5 None 1 0 14952.049 15827.303 8.450 7.450 9.900 8.500 5.359 5.791 4.153 4.315 0.000 1.000 0.000 2.000 0.693 NoExpr Pending +chr21-44330789-44330813-AGGCAGCCGCGGCCCCTAGCGGCCC-A 848.CFAP410.ENST00000397956.7.inframe_del.217-224GPLGAAAA/- CFAP410 GPLGAAAA217-224- 1 HRGRVSGSA ENST00000397956.7 False False 1 HLA-C*06:02 8, 9 None 1 0 10429.296 24458.046 14.639 35.872 15.000 35.000 18.623 36.744 11.289 34.680 6.570 0.000 0.000 18.000 0.376 NoExpr Pending +chr11-20638483-20638484-T-A 546.SLC6A5.ENST00000525748.6.missense.632V/E SLC6A5 V632E 1 YMFQLEDTYA ENST00000525748.6 True True 1 HLA-C*06:02 6 None 1 0 14068.607 12080.125 9.741 7.792 8.900 6.600 5.205 3.006 23.790 29.180 0.006 0.000 0.000 1.000 0.452 NoExpr Pending +chr11-56542446-56542447-T-C 550.OR5M11.ENST00000528616.5.missense.271K/E OR5M11 K271E 1 KTVEESEII ENST00000528616.5 True True NA HLA-C*06:02 7 None 1 0 14305.060 14033.360 9.150 5.500 16.000 14.000 4.602 1.637 5.763 2.941 0.000 0.000 0.000 0.000 0.291 NoExpr Pending +chr1-22576425-22576426-C-A 3.EPHA8.ENST00000166244.8.missense.123N/K EPHA8 N123K 1 ETFKLYYL ENST00000166244.8 True True 2 HLA-C*06:02 4 None 1 0 15039.103 11537.401 8.865 6.832 12.000 7.700 2.713 3.983 7.415 16.109 0.001 0.000 0.000 0.000 0.272 NoExpr Pending +chr1-204986102-204986103-C-G 74.NFASC.ENST00000513543.6.missense.923T/S NFASC T923S 1 FTSPEGVPSA ENST00000513543.6 False False 1 HLA-C*06:02 3 None 1 0 14120.293 17934.185 9.780 14.180 9.900 15.000 15.765 19.531 8.274 11.058 0.974 0.000 0.000 0.000 0.596 NoExpr Pending +chr14-26448937-26448938-G-C 627.NOVA1.ENST00000539517.7.missense.182T/R NOVA1 T182R 1 IVPNSRAGL ENST00000539517.7 True True 1 HLA-C*06:02 6 None 1 0 12822.233 13439.185 12.071 5.995 15.000 17.000 14.842 2.791 2.428 1.714 0.694 0.000 0.000 2.000 0.462 NoExpr Pending +chr11-46876561-46876562-C-T 549.LRP4.ENST00000378623.6.missense.1147R/Q LRP4 R1147Q 1 DTGTNQIEV ENST00000378623.6 True True 1 HLA-C*06:02 6 None 1 0 10325.624 8796.364 16.000 13.260 17.000 14.520 18.844 22.535 10.850 9.415 0.268 0.000 0.000 2.000 0.421 NoExpr Pending +chr14-94382907-94382908-C-G 653.SERPINA1.ENST00000404814.8.missense.110E/D SERPINA1 E110D 1 FNLTDIPEA ENST00000404814.8 False False 1 HLA-C*06:02 5 None 1 0 10482.491 11081.717 15.280 17.416 17.027 18.307 14.560 16.833 11.328 9.666 4.892 0.000 0.000 0.000 0.180 NoExpr Pending +chr7-122013415-122013416-A-G 382.PTPRZ1.ENST00000393386.7.missense.1457N/S PTPRZ1 N1457S 6 YRESQEKVMSD ENST00000393386.7 True True 1 HLA-C*06:02 10 None 2 0 8776.385 10966.975 20.911 19.840 12.000 8.647 33.754 23.680 31.322 35.680 0.909 0.000 0.000 0.000 0.241 NoExpr Pending +chr6-55351464-55351465-G-C 318.GFRAL.ENST00000340465.2.missense.195D/H GFRAL D195H 1 FCDCAQSHI ENST00000340465.2 True True 1 HLA-C*06:02 8 2,4 1 0 10258.547 10283.010 18.191 23.947 17.383 16.000 27.634 48.899 17.403 32.096 0.013 0.000 0.000 0.000 0.511 NoExpr Pending +chr21-30755335-30755336-C-T 844.KRTAP21-1.ENST00000335093.5.missense.15G/S KRTAP21-1 G15S 1 YGSSCGCGY ENST00000335093.5 True True NA HLA-C*06:02 4 5,7 1 0 9841.575 10273.664 19.111 14.606 20.000 15.212 34.378 30.453 7.831 6.066 0.000 0.000 0.000 0.000 0.470 NoExpr Pending +chr11-193734-193735-G-A 518.SCGB1C1.ENST00000342878.3.missense.27D/N SCGB1C1 D27N 1 ATGEDNNEF ENST00000342878.3 True True 1 HLA-C*06:02 7 None 1 0 12895.530 14667.457 14.450 23.427 21.000 24.000 8.451 23.854 6.501 14.078 0.000 0.000 0.000 4.000 0.213 NoExpr Pending +chr7-151181249-151181250-C-T 395.ASB10.ENST00000275838.5.missense.265D/N ASB10 D265N 3 ITNAEATTA ENST00000275838.5 False False 1 HLA-C*06:02 3 None 2 0 11080.185 16671.474 16.859 19.985 24.000 24.000 9.246 19.579 15.616 13.639 0.000 0.000 0.000 0.000 0.153 NoExpr Pending +chr4-5988666-5988667-T-A 233.C4orf50.ENST00000531445.3.missense.1127M/L C4orf50 M1127L 1 QGKAKLHAL ENST00000531445.3 False True 5 HLA-C*06:02 6 None 1 0 16857.934 19415.822 9.000 9.450 25.000 25.000 2.701 3.184 1.991 2.713 0.025 0.000 0.000 0.000 0.946 NoExpr Pending +chr15-69049033-69049034-G-C 699.NOX5.ENST00000388866.8.missense.659D/H NOX5 D659H 1 MHQAEEAQY ENST00000388866.8 True True 1 HLA-C*06:02 2 None 1 0 16561.520 39080.060 9.600 39.744 12.000 48.000 26.593 45.488 2.257 20.596 0.160 0.000 0.000 0.000 0.396 NoExpr Pending +chr1-66834005-66834006-C-G 36.DNAI4.ENST00000371026.8.missense.626G/R DNAI4 G626R 1 ISKWVIRKRL ENST00000371026.8 True True 1 HLA-C*06:02 9 None 2 0 11259.345 15623.991 18.454 29.278 8.500 31.045 28.408 27.510 25.812 21.480 7.011 0.000 0.000 0.000 0.605 NoExpr Pending +chr2-94874875-94874876-T-A 130.TEKT4.ENST00000295201.5.missense.272C/S TEKT4 C272S 1 NLRVLVDSI ENST00000295201.5 True True 1 HLA-C*06:02 8 None 1 0 14663.015 16041.251 13.500 16.698 20.030 17.240 2.276 4.271 7.696 16.903 0.614 0.000 0.000 0.000 0.446 NoExpr Pending +chr11-58190707-58190708-A-T 551.OR9Q2.ENST00000641291.1.missense.73Y/F OR9Q2 Y73F 1 FSSAIIPQMLA ENST00000641291.1 True True NA HLA-C*06:02 1 None 1 0 15845.409 16297.425 13.500 14.000 13.000 14.000 5.194 4.620 28.822 27.822 0.008 0.000 0.000 0.000 0.514 NoExpr Pending +chr14-23425383-23425384-T-G 624.MYH7.ENST00000355349.4.missense.774E/A MYH7 E774A 1 LAEMRDERL ENST00000355349.4 True True 1 HLA-C*06:02 2 None 1 0 11433.646 35598.330 19.965 39.669 22.930 40.000 46.118 65.543 7.764 21.616 0.005 0.000 0.000 0.000 0.192 NoExpr Pending +chr3-183179682-183179683-G-A 224.MCF2L2.ENST00000328913.8.missense.1039L/F MCF2L2 L1039F 1 SALSLAGFF ENST00000328913.8 True True 5 HLA-C*06:02 8 None 1 0 16935.111 11566.881 12.686 10.925 16.480 18.000 2.846 5.034 5.396 3.996 0.407 0.000 0.000 0.000 0.377 NoExpr Pending +chr10-115241629-115241630-G-A 494.ATRNL1.ENST00000355044.8.missense.531G/E ATRNL1 G531E 1 SAVLINEAM ENST00000355044.8 True True 1 HLA-C*06:02 7 None 1 0 18726.150 19300.030 10.538 17.528 18.000 27.000 7.075 10.980 2.584 4.769 0.262 0.000 0.000 0.000 0.443 NoExpr Pending +chr19-38802098-38802099-G-A 807.LGALS4.ENST00000307751.9.missense.240R/C LGALS4 R240C 1 HINPCMGNGTV ENST00000307751.9 True True 1 HLA-C*06:02 5 5 1 0 16999.260 16715.266 13.094 13.250 14.000 13.000 8.753 9.456 18.094 13.750 0.232 0.000 0.000 0.000 1.000 NoExpr Pending +chr2-195816717-195816718-T-G 170.DNAH7.ENST00000312428.11.missense.3224E/A DNAH7 E3224A 1 LANIAPMY ENST00000312428.11 True True 1 HLA-C*06:02 5 None 1 0 17898.955 18676.445 12.805 16.409 13.610 20.654 17.281 14.817 5.429 9.328 0.478 0.000 0.000 0.000 0.167 NoExpr Pending +chr1-22660990-22660991-G-A 5.C1QB.ENST00000509305.6.missense.121A/T 1 C1QB A121T 1 KITFSATRTI ENST00000509305.6 True True 1 HLA-C*06:02 3 None 2 1 16329.460 14929.720 16.344 12.674 17.689 14.000 9.844 6.985 25.362 17.422 0.000 0.000 0.000 0.000 0.984 NoExpr Pending +chr22-46257698-46257699-G-A 870.PKDREJ.ENST00000253255.7.missense.1875T/I PKDREJ T1875I 1 YSYGLLHIYG ENST00000253255.7 True True NA HLA-C*06:02 8 None 1 0 21091.654 19275.011 13.255 14.418 17.000 16.000 1.902 2.456 22.530 33.872 0.020 0.000 0.000 1.000 0.270 NoExpr Pending +chr1-16006133-16006134-G-T 1.SRARP.ENST00000329454.2.missense.100G/W SRARP G100W 1 TRVTPMGW ENST00000329454.2 True True 1 HLA-C*06:02 8 None 1 0 17820.885 28785.080 16.338 47.476 16.675 44.889 68.807 72.790 7.903 46.372 0.082 0.000 0.000 0.000 1.000 NoExpr Pending +chr6-30986467-30986468-T-C 302.MUC21.ENST00000376296.3.missense.98V/A MUC21 V98A 1 FSTASSGIS ENST00000376296.3 True True 1 HLA-C*06:02 4 None 1 0 15802.723 16122.961 21.110 26.500 20.220 23.000 18.689 19.514 50.372 53.872 0.123 0.000 0.000 0.000 0.662 NoExpr Pending +chr2-106830076-106830077-G-C 136.ST6GAL2.ENST00000409382.8.missense.436S/C ST6GAL2 S436C 1 PSCGFIGIL ENST00000409382.8 True True 1 HLA-C*06:02 3 3 1 0 17000.176 14773.614 19.000 13.500 20.000 16.000 1.693 0.958 19.153 13.579 0.080 0.000 0.000 1.000 0.694 NoExpr Pending +chrX-7843975-7843976-C-T 884.VCX.ENST00000688183.1.missense.194P/L VCX P194L 1 LSQESEMEE ENST00000688183.1 True True NA HLA-C*06:02 1 None 1 0 14629.747 27836.809 28.775 47.136 23.347 42.000 30.945 48.047 42.180 59.612 0.000 0.000 0.000 0.000 1.000 NoExpr Pending +chr5-136274698-136274699-C-T 272.TRPC7.ENST00000513104.6.missense.368A/T TRPC7 A368T 1 IGLPFLAITY ENST00000513104.6 True True 5 HLA-C*06:02 9 None 1 0 26041.936 29560.425 14.056 17.294 31.000 36.000 4.380 7.520 9.658 14.080 0.005 0.000 0.000 0.000 0.366 NoExpr Pending +chr1-160876800-160876801-C-T 59.ITLN1.ENST00000326245.4.missense.269G/R ITLN1 G269R 1 GRGYFPEA ENST00000326245.4 True True 1 HLA-C*06:02 2 None 1 0 20985.990 40329.778 17.033 55.000 23.000 69.000 16.634 37.445 9.860 46.822 0.000 0.000 0.000 0.000 0.250 NoExpr Pending +chr17-11784434-11784435-G-C 755.DNAH9.ENST00000262442.9.missense.2653D/H DNAH9 D2653H 2 QKSIPPLIHL ENST00000262442.9 True True 1 HLA-C*06:02 9 None 2 0 22522.551 27791.370 19.006 26.960 25.610 29.959 7.470 11.382 10.559 22.630 0.061 0.000 0.000 0.000 0.349 NoExpr Pending +chr17-10499040-10499041-G-A 754.MYH1.ENST00000226207.6.missense.1306S/L MYH1 S1306L 1 EKDTLVSQLL ENST00000226207.6 True True 5 HLA-C*06:02 10 None 1 0 23369.740 35646.835 19.500 57.581 21.000 61.800 3.519 14.299 26.680 55.872 0.009 0.000 0.000 0.000 0.988 NoExpr Pending +chr7-47833094-47833095-G-A 344.PKD1L1.ENST00000289672.7.missense.2111T/I PKD1L1 T2111I 1 HIQAPSSGL ENST00000289672.7 True True 1 HLA-C*06:02 2 None 1 0 19918.506 15932.228 25.509 18.572 28.671 21.143 27.019 21.447 5.315 4.225 0.696 0.000 0.000 0.000 0.322 NoExpr Pending +chr2-160107761-160107762-T-A 140.ITGB6.ENST00000283249.7.missense.729I/F ITGB6 I729F 1 FWKLLVSF ENST00000283249.7 True True 1 HLA-C*06:02 1 None 1 0 25711.090 31790.845 19.612 28.401 22.000 32.000 32.370 39.945 9.739 16.040 0.093 0.000 0.000 0.000 0.225 NoExpr Pending +chr5-141123692-141123693-G-C 273.PCDHB4.ENST00000194152.4.missense.565Q/H PCDHB4 Q565H 1 FVLYPLHNG ENST00000194152.4 True True NA HLA-C*06:02 7 None 1 0 19405.965 18943.580 30.835 30.500 31.000 28.000 19.157 16.901 33.680 48.872 1.436 0.000 0.000 20.000 0.307 NoExpr Pending +chr6-10801907-10801908-C-G 292.MAK.ENST00000354489.7.missense.272R/P MAK R272P 1 KPPTASQAL ENST00000354489.7 True True 5 HLA-C*06:02 2 None 1 0 30467.229 817.645 20.500 0.392 30.000 0.990 8.084 0.485 2.322 0.130 0.038 0.000 0.000 1.000 0.323 NoExpr Pending +chr14-24068642-24068643-G-A 625.CARMIL3.ENST00000342740.6.missense.1248E/K CARMIL3 E1248K 1 GKEEKEGTL ENST00000342740.6 True True 5 HLA-C*06:02 2 None 1 0 27126.836 38466.235 22.924 41.946 30.000 62.000 20.848 37.892 12.250 17.094 1.601 0.000 0.000 25.000 0.185 NoExpr Pending +chr1-119895935-119895936-C-T 41.ADAM30.ENST00000369400.2.missense.134R/Q ADAM30 R134Q 1 GGLQGVFNI ENST00000369400.2 True True NA HLA-C*06:02 4 None 1 0 26216.842 34815.060 26.000 35.000 40.000 54.000 5.986 11.573 10.135 13.815 0.019 0.000 0.000 0.000 0.203 NoExpr Pending +chr15-84036950-84036951-A-T 704.ADAMTSL3.ENST00000286744.10.missense.1645I/F ADAMTSL3 I1645F 1 VQKKKPFSW ENST00000286744.10 True True 1 HLA-C*06:02 7 None 1 0 29851.287 21162.929 29.350 24.456 41.000 40.000 19.700 12.912 1.510 1.066 2.043 0.000 0.000 0.000 0.366 NoExpr Pending +chr1-59858482-59858483-C-T 33.HOOK1.ENST00000371208.5.missense.433S/L HOOK1 S433L 2 LQVQQDHL ENST00000371208.5 True True 1 HLA-C*06:02 1 None 2 0 29459.154 27337.345 30.970 21.525 35.386 21.769 30.297 27.067 24.822 13.579 0.230 0.000 0.000 0.000 0.394 NoExpr Pending +chr22-37723212-37723213-GA-G 858.TRIOBP.ENST00000644935.1.FS.219GA/G TRIOBP FS219 1 GRSAGSTGQGS ENST00000644935.1 True True NA HLA-C*06:02 NA None 1 0 31325.730 NA 34.533 NA 38.000 NA 25.405 NA 34.139 NA 35.473 0.000 0.000 5.000 0.289 NoExpr Pending +chr1-196995755-196995756-A-G 67.CFHR5.ENST00000256785.5.missense.216N/S CFHR5 N216S 1 LSSGEVKEIR ENST00000256785.5 True True 1 HLA-C*06:02 3 None 1 0 37989.371 36760.350 39.958 31.917 46.000 39.000 29.960 22.956 24.225 22.449 0.000 0.000 0.000 0.000 0.287 NoExpr Pending +chr8-123220221-123220221-A-AGGGCTAC 423.C8orf76.ENST00000276704.6.FS.342A/AGGGCTAC C8orf76 FS342 1 VGSVARSPD ENST00000276704.6 True True 1 HLA-C*06:02 6, 7, 8, 9 None 1 0 35481.449 14198.550 61.037 10.500 64.000 22.380 56.655 2.960 66.112 3.463 45.915 0.000 0.000 344.000 0.724 NoExpr Pending +chr9-138120681-138120682-G-A 482.CACNA1B.ENST00000371372.6.missense.2097G/D CACNA1B G2097D 1 GLPPGEGPTD ENST00000371372.6 True True 5 HLA-C*06:02 10 None 1 0 45064.430 43503.110 53.090 48.665 57.000 57.000 11.966 18.770 52.309 39.094 0.154 0.000 0.000 0.000 0.276 NoExpr Pending +chr3-52517959-52517960-A-C 196.STAB1.ENST00000321725.10.missense.1573H/P STAB1 H1573P 1 TAPTVGDG ENST00000321725.10 True True 1 HLA-C*06:02 3 None 1 0 38791.734 37488.990 68.789 71.542 76.280 70.000 71.578 73.084 56.112 74.372 0.090 0.000 0.000 0.000 1.000 NoExpr Pending