From 7b4778b9223f334fc6ccb11b767b4c5b19c109ea Mon Sep 17 00:00:00 2001 From: Delphine-L Date: Thu, 30 Apr 2026 13:36:49 -0400 Subject: [PATCH 1/3] version 3.0 --- .../CHANGELOG.md | 24 + .../README.md | 51 +- ...map-for-assembly-manual-curation-tests.yml | 66 +- .../hi-c-map-for-assembly-manual-curation.ga | 8789 +++++++++++------ 4 files changed, 5869 insertions(+), 3061 deletions(-) diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md index f579988625..60d40f7142 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md @@ -1,5 +1,29 @@ # Changelog +## [3.0] - 2026-04-29 + +### Added +- Now use BWA-MEM for large genomes (>10Gb) instead of BWA-MEM2 like smaller genomes. New input `Estimated Genome Size` to drive the aligner selection. +- Now generate JBrowse2 instances with Mashmap alignments and tracks for both haplotypes, and optionaly with a collection of closely related species. + + +## [2.4] - 2026-04-29 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3` +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2` +- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2` +- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3` +- `toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2` +- `toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0` + +### Changed +- Fix error that removed duplicates even when the option was set to "Keep duplicates" + + ## [2.3] - 2026-03-30 ### Changed diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md index befcc1061e..54f00554f1 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md @@ -17,43 +17,49 @@ The Pretext files can be opened in PretextView for manual curation of genome ass 3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes) 4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data 5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads +6. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10G ### Assembly Annotation Parameters -6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues) -7. **Species Name** [text] - Species identifier for gene annotation -8. **Assembly Name** [text] - Assembly identifier (e.g., toLid) -9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10) -10. **Database for Compleasm** [text] - Compleasm database version (default: v5) +7. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues) +8. **Species Name** [text] - Species identifier for gene annotation +9. **Assembly Name** [text] - Assembly identifier (e.g., toLid) +10. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10) +11. **Database for Compleasm** [text] - Compleasm database version (default: v5) ### Scaffold Naming Options -11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information -12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1) -13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2) +12. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information +13. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1) +14. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2) ### Hi-C Processing Options -14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks "noisy") -15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup -16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads) +15. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks "noisy") +16. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup +17. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads) ### PacBio Processing Options -17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt +18. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt ### Telomere Detection -18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement) -19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA) +19. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement) +20. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA) ### Hi-C Map Resolution -20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources) +21. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources) ### Visualization Options -21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution) +22. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution) + +### JBrowse2 Related Species + +23. **Use related species** [boolean] - Include related-species assemblies as additional tracks/alignments in the JBrowse2 instance +24. **Related Species** [fasta.gz collection] - Collection of related-species assemblies (gzipped FASTA) to align against the assembled haplotypes for JBrowse2 visualization ## Outputs @@ -117,6 +123,19 @@ All Pretext outputs are generated in two versions: 28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered) 29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered) +### Haplotype Alignment Outputs + +30. **Alignments** [PAF] - Haplotype-vs-haplotype (and, if enabled, vs related-species) alignments produced by mashmap, used as JBrowse2 synteny tracks + +### JBrowse2 Outputs + +Generated depending on whether one or two haplotypes are provided and whether related species are included: + +31. **JBrowse2 Single Haplotype** [JBrowse2] - JBrowse2 instance for a single-haplotype assembly +32. **JBrowse2 Single Haplotype with related species** [JBrowse2] - Single-haplotype JBrowse2 instance with related-species alignment tracks +33. **JBrowse2 Hap1 vs Hap2 with no related species** [JBrowse2] - Diploid JBrowse2 instance with Hap1↔Hap2 alignments +34. **JBrowse2 Hap1 and hap2 with related species** [JBrowse2] - Diploid JBrowse2 instance including related-species alignments + ## Usage Notes ### When to trim Hi-C data diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml index 9db41b9e30..5932133142 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml @@ -63,8 +63,25 @@ Assembly Name: toLid Lineage for Compleasm: vertebrata_odb10 Database for Compleasm: v5 - Generate gene annotations: false + Generate gene annotations: True Generate high resolution Hi-C maps: false + Estimated Genome Size: + class: File + location: https://zenodo.org/records/19925237/files/real_size.txt + filetype: txt + Use related species: true + Related Species: + class: Collection + collection_type: list + elements: + - class: File + identifier: hap1 + location: https://zenodo.org/records/19925237/files/hap1.fasta.gz + filetype: fasta.gz + - class: File + identifier: hap2 + location: https://zenodo.org/records/19925237/files/hap2.fasta.gz + filetype: fasta.gz outputs: Assembly for curation: asserts: @@ -120,6 +137,10 @@ asserts: has_text: text: "EXCLUDED: 1042" + Compleasm Genes track: + asserts: + has_text: + text: "scaffold_1.H2\t106669\t106765" - doc: Test 2 - Multiple read sets with collections job: Haplotype 1: @@ -189,7 +210,7 @@ - hash_function: SHA-1 hash_value: f0408118bf8d116d0d560d2899fc4861c930c067 Do you want to add suffixes to the scaffold names?: true - Will you use a second haplotype?: true + Will you use a second haplotype?: false First Haplotype suffix: H1 Second Haplotype suffix: H2 Do you want to trim the Hi-C data?: false @@ -203,8 +224,25 @@ Assembly Name: toLid Lineage for Compleasm: vertebrata_odb10 Database for Compleasm: v5 - Generate gene annotations: true + Generate gene annotations: false Generate high resolution Hi-C maps: false + Estimated Genome Size: + class: File + location: https://zenodo.org/records/19925237/files/large_size.txt + filetype: txt + Use related species: true + Related Species: + class: Collection + collection_type: list + elements: + - class: File + identifier: hap1 + location: https://zenodo.org/records/19925237/files/hap1.fasta.gz + filetype: fasta.gz + - class: File + identifier: hap2 + location: https://zenodo.org/records/19925237/files/hap2.fasta.gz + filetype: fasta.gz outputs: Assembly for curation: asserts: @@ -225,12 +263,10 @@ BigWig Coverage: asserts: has_size: - value: 20000 - delta: 10000 + value: 7000 + delta: 2000 P telomeres bed: asserts: - has_text: - text: "scaffold_10.H2" has_text: text: "scaffold_1.H1" Merged Hi-C Alignments on Scaffolds: @@ -241,21 +277,17 @@ Pretext All tracks: asserts: has_size: - value: 2000000 - delta: 1000000 + value: 940000 + delta: 200000 Pretext All tracks - Multimapping: asserts: has_size: - value: 2000000 - delta: 1000000 - Compleasm Genes track: - asserts: - has_text: - text: "scaffold_1.H2\t106669\t106765" + value: 940000 + delta: 200000 "Hi-C duplication stats on Scaffolds: Raw": asserts: has_text: - text: "total_dups\t3941\t2623" + text: "total_dups\t1936\t1313" P telomeres bed: asserts: has_text: @@ -263,4 +295,4 @@ Hi-C duplication stats on Scaffolds: asserts: has_text: - text: "EXCLUDED: 1725" + text: "EXCLUDED: 48407" diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga index be27e54db6..bc2b85d210 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga @@ -4,8 +4,8 @@ "comments": [ { "child_steps": [ - 33, - 42 + 36, + 46 ], "color": "red", "data": { @@ -24,15 +24,15 @@ }, { "child_steps": [ - 32, - 40, - 41, - 47, - 48, + 58, + 35, + 59, + 44, + 45, + 52, 53, - 54, - 57, - 58 + 62, + 63 ], "color": "lime", "data": { @@ -51,51 +51,51 @@ }, { "child_steps": [ - 31 + 30, + 33, + 39, + 54 ], - "color": "yellow", + "color": "turquoise", "data": { - "title": "Trim and align Hi-C reads" + "title": "Egapx Annotations" }, - "id": 1, + "id": 2, "position": [ - 1355.2, - 1286.1 + 2146.7, + 186.9 ], "size": [ - 910, - 990 + 1878, + 674 ], "type": "frame" }, { "child_steps": [ - 27, - 30, - 35, - 49 + 34 ], - "color": "turquoise", + "color": "yellow", "data": { - "title": "Egapx Annotations" + "title": "Trim and align Hi-C reads" }, - "id": 2, + "id": 1, "position": [ - 2146.7, - 186.9 + 1355.2, + 1286.1 ], "size": [ - 1878, - 674 + 596, + 971 ], "type": "frame" }, { "child_steps": [ - 22, - 23, + 25, 26, - 29 + 29, + 32 ], "color": "blue", "data": { @@ -114,19 +114,48 @@ }, { "child_steps": [ - 37, 38, - 45, - 51, - 59, - 62, - 65, + 48, + 49, + 55, + 60, + 74, + 80, + 61, 68, 71, - 74, - 76, + 77 + ], + "color": "green", + "data": { + "title": "Coverage" + }, + "id": 5, + "position": [ + 2467.5, + 1844.4000000000005 + ], + "size": [ + 2060, + 530 + ], + "type": "frame" + }, + { + "child_steps": [ + 41, + 42, + 50, + 56, + 65, + 69, + 72, + 75, 78, - 80 + 81, + 83, + 85, + 87 ], "color": "none", "data": { @@ -145,19 +174,19 @@ }, { "child_steps": [ - 36, - 39, - 46, - 52, - 60, - 63, + 40, + 43, + 51, + 57, 66, - 69, - 72, - 75, - 77, + 70, + 73, + 76, 79, - 81 + 82, + 84, + 86, + 88 ], "color": "orange", "data": { @@ -173,35 +202,6 @@ 772 ], "type": "frame" - }, - { - "child_steps": [ - 43, - 44, - 34, - 50, - 55, - 67, - 73, - 56, - 61, - 64, - 70 - ], - "color": "green", - "data": { - "title": "Coverage" - }, - "id": 5, - "position": [ - 2467.5, - 1844.4000000000005 - ], - "size": [ - 2060, - 530 - ], - "type": "frame" } ], "creator": [ @@ -218,8 +218,9 @@ ], "format-version": "0.1", "license": "MIT", - "name": "PretextMap Generation from 1 or 2 haplotypes", - "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies\n3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes)\n4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data\n5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Both Haplotypes merged** [fasta] - Concatenated assembly file\n\n### Gene Annotation Outputs\n\n4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled)\n10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled)\n11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics\n12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots\n\n### PacBio Processing Outputs\n\n13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n15. **BigWig Coverage** [bigwig] - PacBio read coverage track\n16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n19. **terminal telomeres** [bedgraph] - All detected telomeric regions\n20. **P telomeres bed** [BED] - P-arm (5') telomeres only\n21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n22. **Gaps Bed** [BED] - Assembly gap coordinates\n23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Assembly Haplotype Outputs\n\n24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", + "release": "3.0", + "name": "PretextMap Generation from 1 or 2 haplotypes with Jbrowse", + "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies\n3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes)\n4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data\n5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads\n6. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10G\n\n### Assembly Annotation Parameters\n\n7. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n8. **Species Name** [text] - Species identifier for gene annotation\n9. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n10. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n11. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n12. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n13. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n14. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n15. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n16. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n17. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n18. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n19. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n20. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n21. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n22. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n### JBrowse2 Related Species\n\n23. **Use related species** [boolean] - Include related-species assemblies as additional tracks/alignments in the JBrowse2 instance\n24. **Related Species** [fasta.gz collection] - Collection of related-species assemblies (gzipped FASTA) to align against the assembled haplotypes for JBrowse2 visualization\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Both Haplotypes merged** [fasta] - Concatenated assembly file\n\n### Gene Annotation Outputs\n\n4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled)\n10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled)\n11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics\n12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots\n\n### PacBio Processing Outputs\n\n13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n15. **BigWig Coverage** [bigwig] - PacBio read coverage track\n16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n19. **terminal telomeres** [bedgraph] - All detected telomeric regions\n20. **P telomeres bed** [BED] - P-arm (5') telomeres only\n21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n22. **Gaps Bed** [BED] - Assembly gap coordinates\n23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Assembly Haplotype Outputs\n\n24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n### Haplotype Alignment Outputs\n\n30. **Alignments** [PAF] - Haplotype-vs-haplotype (and, if enabled, vs related-species) alignments produced by mashmap, used as JBrowse2 synteny tracks\n\n### JBrowse2 Outputs\n\nGenerated depending on whether one or two haplotypes are provided and whether related species are included:\n\n31. **JBrowse2 Single Haplotype** [JBrowse2] - JBrowse2 instance for a single-haplotype assembly\n32. **JBrowse2 Single Haplotype with related species** [JBrowse2] - Single-haplotype JBrowse2 instance with related-species alignment tracks\n33. **JBrowse2 Hap1 vs Hap2 with no related species** [JBrowse2] - Diploid JBrowse2 instance with Hap1\u2194Hap2 alignments\n34. **JBrowse2 Hap1 and hap2 with related species** [JBrowse2] - Diploid JBrowse2 instance including related-species alignments\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", "report": { "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nSamtools markdup deduplication stats (if applicable)\n\n\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats\")\n```\n\n\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n## Telomere report\n\n```galaxy\nhistory_dataset_embedded(output=\"Telomere Report\")\n```\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n" }, @@ -402,8 +403,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 178.90180376230734, - "top": 555.9866279499374 + "left": 177.91069036144182, + "top": 552.7194916173363 }, "tool_id": null, "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -522,11 +523,38 @@ "workflow_outputs": [] }, "11": { - "annotation": "Paired Collection containing the Hi-C reads. ", + "annotation": "", "content_id": null, "errors": null, "id": 11, "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome Size" + } + ], + "label": "Estimated Genome Size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 394.18328295615464, + "top": 1082.7822582650979 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "70cbd8a7-d28f-4541-a3e4-4c8e1a376c6e", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "Paired Collection containing the Hi-C reads. ", + "content_id": null, + "errors": null, + "id": 12, + "input_connections": {}, "inputs": [ { "description": "Paired Collection containing the Hi-C reads. ", @@ -537,8 +565,8 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 401.3999819565248, - "top": 1069.2213293639197 + "left": 420.90321793990574, + "top": 1218.4211647121583 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", @@ -548,11 +576,11 @@ "when": null, "workflow_outputs": [] }, - "12": { + "13": { "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", "content_id": null, "errors": null, - "id": 12, + "id": 13, "input_connections": {}, "inputs": [ { @@ -564,8 +592,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 440.690496895607, - "top": 1148.0491373675718 + "left": 471.00706862554944, + "top": 1292.513626474257 }, "tool_id": null, "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -575,11 +603,11 @@ "when": null, "workflow_outputs": [] }, - "13": { + "14": { "annotation": "", "content_id": null, "errors": null, - "id": 13, + "id": 14, "input_connections": {}, "inputs": [ { @@ -591,8 +619,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 496.7584331925734, - "top": 1275.7745521826732 + "left": 515.1475335665177, + "top": 1399.7517611349795 }, "tool_id": null, "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -602,92 +630,92 @@ "when": null, "workflow_outputs": [] }, - "14": { + "15": { "annotation": "", "content_id": null, "errors": null, - "id": 14, + "id": 15, "input_connections": {}, "inputs": [ { "description": "", - "name": "PacBio reads" + "name": "Generate high resolution Hi-C maps" } ], - "label": "PacBio reads", - "name": "Input dataset collection", + "label": "Generate high resolution Hi-C maps", + "name": "Input parameter", "outputs": [], "position": { - "left": 536.9964789986047, - "top": 1376.279758415852 + "left": 569.3159671711569, + "top": 1508.492779661561 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, - "type": "data_collection_input", - "uuid": "8bc4fc4e-1a1a-43e8-b4bc-5115fefb541d", + "type": "parameter_input", + "uuid": "d915227b-8f4a-40e1-aeab-d1f71adce6f6", "when": null, "workflow_outputs": [] }, - "15": { - "annotation": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", + "16": { + "annotation": "", "content_id": null, "errors": null, - "id": 15, + "id": 16, "input_connections": {}, "inputs": [ { - "description": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", - "name": "Remove adapters from HiFi reads? " + "description": "", + "name": "PacBio reads" } ], - "label": "Remove adapters from HiFi reads? ", - "name": "Input parameter", + "label": "PacBio reads", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 596.6993631163789, - "top": 1481.9030970403944 + "left": 617.3841281567144, + "top": 1637.47572935952 }, "tool_id": null, - "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "parameter_input", - "uuid": "1cfd4d32-2a28-4f0a-9310-6cd2b6736825", + "type": "data_collection_input", + "uuid": "8bc4fc4e-1a1a-43e8-b4bc-5115fefb541d", "when": null, "workflow_outputs": [] }, - "16": { - "annotation": "", + "17": { + "annotation": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", "content_id": null, "errors": null, - "id": 16, + "id": 17, "input_connections": {}, "inputs": [ { - "description": "", - "name": "Generate high resolution Hi-C maps" + "description": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", + "name": "Remove adapters from HiFi reads? " } ], - "label": "Generate high resolution Hi-C maps", + "label": "Remove adapters from HiFi reads? ", "name": "Input parameter", "outputs": [], "position": { - "left": 652.4490044390274, - "top": 1633.3557879406821 + "left": 680.7574861270211, + "top": 1727.813504185769 }, "tool_id": null, - "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "d915227b-8f4a-40e1-aeab-d1f71adce6f6", + "uuid": "1cfd4d32-2a28-4f0a-9310-6cd2b6736825", "when": null, "workflow_outputs": [] }, - "17": { + "18": { "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", "content_id": null, "errors": null, - "id": 17, + "id": 18, "input_connections": {}, "inputs": [ { @@ -699,8 +727,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 705.2873976664991, - "top": 1752.2175588776036 + "left": 725.2889578302385, + "top": 1878.340368072226 }, "tool_id": null, "tool_state": "{\"default\": 10, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", @@ -710,11 +738,11 @@ "when": null, "workflow_outputs": [] }, - "18": { + "19": { "annotation": "The default value is set for vertebrate genomes (TTAGGG).", "content_id": null, "errors": null, - "id": 18, + "id": 19, "input_connections": {}, "inputs": [ { @@ -726,8 +754,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 783.2708198518889, - "top": 1871.9944433534572 + "left": 804.0066731853753, + "top": 1998.3984749564324 }, "tool_id": null, "tool_state": "{\"default\": \"TTAGGG\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -737,11 +765,11 @@ "when": null, "workflow_outputs": [] }, - "19": { + "20": { "annotation": "The default value is set for vertebrate genomes (TTAGGG,CCCTAA).", "content_id": null, "errors": null, - "id": 19, + "id": 20, "input_connections": {}, "inputs": [ { @@ -753,8 +781,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 823.1174420179392, - "top": 1966.912481874346 + "left": 874.8796235729197, + "top": 2111.9812018516664 }, "tool_id": null, "tool_state": "{\"default\": \"TTAGGG,CCCTAA\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -764,11 +792,11 @@ "when": null, "workflow_outputs": [] }, - "20": { + "21": { "annotation": "", "content_id": null, "errors": null, - "id": 20, + "id": 21, "input_connections": {}, "inputs": [ { @@ -780,8 +808,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 864.3150368613834, - "top": 2077.5884781827904 + "left": 973.5695727424196, + "top": 2248.9311570455247 }, "tool_id": null, "tool_state": "{\"default\": 100, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", @@ -791,46 +819,100 @@ "when": null, "workflow_outputs": [] }, - "21": { + "22": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "content_id": null, "errors": null, - "id": 21, - "input_connections": { - "components_0|param_type|component_value": { - "id": 0, - "output_name": "output" - }, - "components_2|param_type|component_value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Compose text parameter value", - "outputs": [ + "id": 22, + "input_connections": {}, + "inputs": [ { - "name": "out1", - "type": "expression.json" + "description": "", + "name": "Use related species" } ], + "label": "Use related species", + "name": "Input parameter", + "outputs": [], "position": { - "left": 1295.2997264348753, - "top": 89.14996297430662 + "left": 1083.9181754454255, + "top": 2370.0425200786585 }, - "post_job_actions": { - "HideDatasetActionout1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out1" - }, - "RenameDatasetActionout1": { - "action_arguments": { - "newname": "Assembly Info" - }, - "action_type": "RenameDatasetAction", - "output_name": "out1" + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "f31dfe7a-73ec-4ff6-b790-f8e267bb9a31", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "Note: Duplicated sequence names between the species in the collection will cause inaccurate alignment visualization in JBrowse2. ", + "content_id": null, + "errors": null, + "id": 23, + "input_connections": {}, + "inputs": [ + { + "description": "Note: Duplicated sequence names between the species in the collection will cause inaccurate alignment visualization in JBrowse2. ", + "name": "Related Species" + } + ], + "label": "Related Species", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 1202.8593194591494, + "top": 2507.6726497901786 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"format\": [\"fasta.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "ccac50f2-56b3-41ff-9670-4ef7e59dcd1d", + "when": null, + "workflow_outputs": [] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 24, + "input_connections": { + "components_0|param_type|component_value": { + "id": 0, + "output_name": "output" + }, + "components_2|param_type|component_value": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 1295.2997264348753, + "top": 89.14996297430662 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Assembly Info" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" } }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", @@ -854,11 +936,11 @@ } ] }, - "22": { + "25": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 22, + "id": 25, "input_connections": { "input_param_type|input_param": { "id": 6, @@ -900,9 +982,9 @@ "when": null, "workflow_outputs": [] }, - "23": { + "26": { "annotation": "", - "id": 23, + "id": 26, "input_connections": { "Do you want to add suffixes to the scaffold names?": { "id": 8, @@ -1493,12 +1575,12 @@ } ] }, - "24": { + "27": { "annotation": "", - "id": 24, + "id": 27, "input_connections": { "0:Input dataset collection": { - "id": 14, + "id": 16, "input_subworkflow_step_id": 0, "output_name": "output" } @@ -1508,8 +1590,8 @@ "name": "Test if collection has only one item or is empty", "outputs": [], "position": { - "left": 1781.4570772941813, - "top": 2335.1273518859034 + "left": 2036.3281238676334, + "top": 2091.8124494257754 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -1875,18 +1957,18 @@ "when": null, "workflow_outputs": [] }, - "25": { + "28": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", "errors": null, - "id": 25, + "id": 28, "input_connections": { "library|input_1": { - "id": 14, + "id": 16, "output_name": "output" }, "when": { - "id": 15, + "id": 17, "output_name": "output" } }, @@ -1932,35 +2014,35 @@ "output_name": "report" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", "tool_shed_repository": { - "changeset_revision": "5d00fd7847eb", + "changeset_revision": "f6168dd17f82", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\", \"json_stats\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "5.2+galaxy1", + "tool_version": "5.2+galaxy2", "type": "tool", "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", "when": "$(inputs.when)", "workflow_outputs": [ - { - "label": "HiFi reads without adapters ", - "output_name": "out1", - "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" - }, { "label": "HiFi reads adapters trimming report", "output_name": "report", "uuid": "71d127d4-af3f-4fbe-a54b-e609fe2a9209" + }, + { + "label": "HiFi reads without adapters ", + "output_name": "out1", + "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" } ] }, - "26": { + "29": { "annotation": "", - "id": 26, + "id": 29, "input_connections": { "Do you want to add suffixes to the scaffold names?": { "id": 8, @@ -1978,7 +2060,7 @@ "output_name": "output" }, "when": { - "id": 22, + "id": 25, "output_name": "output_param_boolean" } }, @@ -2251,14 +2333,14 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "27": { + "30": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 27, + "id": 30, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 23, + "id": 26, "output_name": "Processed Hap2" }, "style_cond|type_cond|pick_from_1|value": { @@ -2316,18 +2398,18 @@ } ] }, - "28": { + "31": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 28, + "id": 31, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 25, + "id": 28, "output_name": "out1" }, "style_cond|type_cond|pick_from_1|value": { - "id": 14, + "id": 16, "output_name": "output" } }, @@ -2366,18 +2448,18 @@ "when": null, "workflow_outputs": [] }, - "29": { + "32": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 29, + "id": 32, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 23, + "id": 26, "output_name": "Merged Haplotypes" }, "style_cond|type_cond|pick_from_1|value": { - "id": 26, + "id": 29, "output_name": "Processed Hap1" } }, @@ -2431,18 +2513,18 @@ } ] }, - "30": { + "33": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 30, + "id": 33, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 23, + "id": 26, "output_name": "Processed Hap1" }, "style_cond|type_cond|pick_from_1|value": { - "id": 26, + "id": 29, "output_name": "Processed Hap1" } }, @@ -2496,28 +2578,33 @@ } ] }, - "31": { + "34": { "annotation": "", - "id": 31, + "id": 34, "input_connections": { "Do you want to trim the Hi-C data?": { - "id": 12, + "id": 13, "input_subworkflow_step_id": 2, "output_name": "output" }, - "Hi-C reads": { + "Estimated Genome Size": { "id": 11, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Hi-C reads": { + "id": 12, "input_subworkflow_step_id": 1, "output_name": "output" }, "Reference": { - "id": 29, + "id": 32, "input_subworkflow_step_id": 0, "output_name": "data_param" }, "Remove HiC duplicates ?": { - "id": 13, - "input_subworkflow_step_id": 3, + "id": 14, + "input_subworkflow_step_id": 4, "output_name": "output" } }, @@ -2526,8 +2613,8 @@ "name": "Trim, Align, deduplicate Hi-C - Precuration", "outputs": [], "position": { - "left": 1657.8359375, - "top": 1379.3046875 + "left": 1552.0680051124978, + "top": 1358.2567456089375 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -2622,8 +2709,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 111.02187825492916, - "top": 669.8566290013688 + "left": 87.29051288561523, + "top": 670.9221943657891 }, "tool_id": null, "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -2642,67 +2729,48 @@ "inputs": [ { "description": "", - "name": "Remove HiC duplicates ?" + "name": "Estimated Genome Size" } ], - "label": "Remove HiC duplicates ?", - "name": "Input parameter", + "label": "Estimated Genome Size", + "name": "Input dataset", "outputs": [], "position": { - "left": 168.00765258793868, - "top": 791.5589054364867 + "left": 127.04701718304551, + "top": 807.1174349926957 }, "tool_id": null, - "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"optional\": false, \"tag\": null}", "tool_version": null, - "type": "parameter_input", - "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", + "type": "data_input", + "uuid": "75d82c6b-19cd-4ca8-86e3-2806f9c01e2b", "when": null, "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "content_id": null, "errors": null, "id": 4, - "input_connections": { - "reference": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "BWA-MEM2 indexer", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "index", - "type": "bwa_mem2_index" + "description": "", + "name": "Remove HiC duplicates ?" } ], + "label": "Remove HiC duplicates ?", + "name": "Input parameter", + "outputs": [], "position": { - "left": 1101.6588788030788, - "top": 356.5526534419638 - }, - "post_job_actions": { - "HideDatasetActionindex": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "index" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "af91699b8d4c", - "name": "bwa_mem2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 152.62563696711496, + "top": 912.6429174544365 }, - "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.3+galaxy0", - "type": "tool", - "uuid": "5def9e34-fa09-4977-aa55-aa7fc4f4d46e", + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", "when": null, "workflow_outputs": [] }, @@ -3136,3300 +3204,5966 @@ }, "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "errors": null, "id": 7, "input_connections": { - "library|input_1": { + "Do you want to trim the Hi-C data?": { + "id": 2, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Estimated Genome size": { + "id": 3, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Hi-C reads": { "id": 1, + "input_subworkflow_step_id": 1, "output_name": "output" }, - "when": { - "id": 2, + "Reference": { + "id": 0, + "input_subworkflow_step_id": 0, "output_name": "output" } }, - "inputs": [], - "label": "Trim Hi-C reads 2", - "name": "Cutadapt", - "outputs": [ - { - "name": "out_pairs", - "type": "input" - }, + "inputs": [ { - "name": "report", - "type": "txt" + "description": "", + "name": "Size dependent alignment" } ], + "label": "Size dependent alignment", + "name": "optional alignement", + "outputs": [], "position": { - "left": 782.453125, - "top": 610.4124224449686 + "left": 1225.3311064782304, + "top": 414.04870986867905 }, - "post_job_actions": { - "HideDatasetActionout_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_pairs" - }, - "HideDatasetActionreport": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "report" - }, - "RenameDatasetActionout1": { - "action_arguments": { - "newname": "Trimmed Hi-C Forward Reads" + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" }, - "action_type": "RenameDatasetAction", - "output_name": "out1" + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "optional alignement", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, - "RenameDatasetActionout2": { - "action_arguments": { - "newname": "Trimmed Hi-C Reverse Reads" + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 117.4984149132323 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "out2" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "f6168dd17f82", - "name": "cutadapt", - "owner": "lparsons", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "5.2+galaxy2", - "type": "tool", - "uuid": "15c5cc40-ce0a-4e29-a891-87f55bf2bd6b", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "8": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 8, - "input_connections": { - "input_param_type|input_param": { - "id": 3, - "output_name": "output" - } - }, - "inputs": [], - "label": "False when removal is true", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 2964.7900692749863, - "top": 1420.0180180585944 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", - "when": null, - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 9, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 7, - "output_name": "out_pairs" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1070.6821138797554, - "top": 833.6550086108263 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Trimmed Hi-C data" + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 24.900863986875255, + "top": 213.3222732918979 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "hic_trimmed" + "2": { + "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "name": "Do you want to trim the Hi-C data?" + } + ], + "label": "Do you want to trim the Hi-C data?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 111.02187825492916, + "top": 314.3801214696325 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6d1391db-7fef-4b5c-a236-26016d6d0aab", + "when": null, + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "325884ac-c2c1-4a5c-b74f-c1c422662b78", - "when": null, - "workflow_outputs": [ - { - "label": "Trimmed Hi-C data", - "output_name": "data_param", - "uuid": "73027165-8c18-45a9-9df1-76e3cc2421fb" - } - ] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", - "errors": null, - "id": 10, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 9, - "output_name": "data_param" - }, - "reference_source|ref_file": { - "id": 4, - "output_name": "index" - } - }, - "inputs": [], - "label": null, - "name": "BWA-MEM2", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "left": 1437.1364350939361, - "top": 500.770155449531 - }, - "post_job_actions": { - "HideDatasetActionbam_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "bam_output" - }, - "RenameDatasetActionbam_output": { - "action_arguments": { - "newname": "Hi-C Alignments" + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome size" + } + ], + "label": "Estimated Genome size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 198.90903413710075, + "top": 449.1965436679154 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d4563544-4752-4a01-8658-9f143d4a282d", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "bam_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "af91699b8d4c", - "name": "bwa_mem2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.3+galaxy0", - "type": "tool", - "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", - "when": null, - "workflow_outputs": [] - }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", - "errors": null, - "id": 11, - "input_connections": { - "bamfile": { - "id": 10, - "output_name": "bam_output" - } - }, - "inputs": [], - "label": null, - "name": "Samtools fixmate", - "outputs": [ - { - "name": "output", - "type": "qname_sorted.bam" - } - ], - "position": { - "left": 1896.4875232723236, - "top": 490.91412456456 - }, - "post_job_actions": { - "ChangeDatatypeActionoutput": { - "action_arguments": { - "newtype": "qname_sorted.bam" + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 4, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 1096.1772811073727, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "10446b69-0dc2-4e05-84da-647b70d6bad9", + "when": null, + "workflow_outputs": [] }, - "action_type": "ChangeDatatypeAction", - "output_name": "output" - }, - "HideDatasetActionoutput": { + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "errors": null, + "id": 5, + "input_connections": { + "library|input_1": { + "id": 1, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Trim Hi-C reads 2", + "name": "Cutadapt", + "outputs": [ + { + "name": "out_pairs", + "type": "input" + }, + { + "name": "report", + "type": "txt" + } + ], + "position": { + "left": 782.453125, + "top": 254.9359149132323 + }, + "post_job_actions": { + "HideDatasetActionout_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_pairs" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Trimmed Hi-C Forward Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionout2": { + "action_arguments": { + "newname": "Trimmed Hi-C Reverse Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out2" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "15c5cc40-ce0a-4e29-a891-87f55bf2bd6b", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "errors": null, + "id": 6, + "input_connections": { + "infile": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "True if Genome size higher than 10Gb", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 507.38482635055703, + "top": 571.3482580122119 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{if ($1 >= 10000000000) print \\\"true\\\"; else print \\\"false\\\"} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "af759549-bbe3-4923-8e5a-a62952106de0", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 5, + "output_name": "out_pairs" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1070.6821138797554, + "top": 478.17850107909 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Trimmed Hi-C data" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "hic_trimmed" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "325884ac-c2c1-4a5c-b74f-c1c422662b78", + "when": null, + "workflow_outputs": [ + { + "label": "Trimmed Hi-C data", + "output_name": "data_param", + "uuid": "73027165-8c18-45a9-9df1-76e3cc2421fb" + } + ] + }, + "8": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 8, + "input_connections": { + "input1": { + "id": 6, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 752.2943156269191, + "top": 676.6099689052414 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e4ffd666-dc5a-4ded-bcd2-67e2a7ecb203", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 9, + "input_connections": { + "input_param_type|input_param": { + "id": 8, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome smaller than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1041.6498874098133, + "top": 833.0361537241724 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"false\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"true\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8d02989c-49bb-4b66-9b2a-418f1adc4d9e", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "input_param_type|input_param": { + "id": 8, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome bigger than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1046.3414281234843, + "top": 1089.522831743084 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"true\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"false\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9515d07b-297d-4261-8773-a71e4986a503", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 7, + "output_name": "data_param" + }, + "reference_source|ref_file": { + "id": 4, + "output_name": "index" + }, + "when": { + "id": 9, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 1530.655705341112, + "top": 285.849105522478 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "errors": null, + "id": 12, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 7, + "output_name": "data_param" + }, + "reference_source|ref_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 10, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Map with BWA-MEM", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 1535.7145267538042, + "top": 682.7199382680614 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "cebb83f8-86b3-4a6e-b377-9d49f414730c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 13, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 11, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 12, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1860.8286890244565, + "top": 547.8063933642267 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0279f93e-3825-41fd-a2aa-7c346ac39b37", + "when": null, + "workflow_outputs": [ + { + "label": "Alignments", + "output_name": "data_param", + "uuid": "dbe0fa6e-d89f-4c0b-a465-20543e4886d5" + } + ] + } + }, + "tags": [], + "uuid": "aadd5059-73ae-42f2-8056-d4e10af5653e" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "37ccbbb0-f709-48b1-b4a0-dabbc5ce599a", + "when": null, + "workflow_outputs": [ + { + "label": "Alignments", + "output_name": "Alignments", + "uuid": "5eb4cac7-2c43-4ba0-a4c7-303195680d31" + }, + { + "label": "Trimmed Hi-C data", + "output_name": "Trimmed Hi-C data", + "uuid": "41a35b53-a316-40b4-854d-b23e777ac04d" + } + ] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 8, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": "False when removal is true", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2964.7900692749863, + "top": 1420.0180180585944 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "errors": null, + "id": 9, + "input_connections": { + "bamfile": { + "id": 7, + "output_name": "Alignments" + } + }, + "inputs": [], + "label": null, + "name": "Samtools fixmate", + "outputs": [ + { + "name": "output", + "type": "qname_sorted.bam" + } + ], + "position": { + "left": 1896.4875232723236, + "top": 490.91412456456 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "qname_sorted.bam" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "84819580b8a5", + "name": "samtools_fixmate", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "1db82bd3-3108-4f39-a0f0-f9e5450e1f4f", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "errors": null, + "id": 10, + "input_connections": { + "input1": { + "id": 9, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools sort", + "outputs": [ + { + "name": "output1", + "type": "bam" + } + ], + "position": { + "left": 2289.4479412815194, + "top": 519.3556477175839 + }, + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "tool_shed_repository": { + "changeset_revision": "2ce517eb9af2", + "name": "samtools_sort", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "5033d744-4b6d-4486-b2ea-732697d51e45", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "errors": null, + "id": 11, + "input_connections": { + "chroms_path": { + "id": 5, + "output_name": "output" + }, + "sam_path": { + "id": 9, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pairtools parse", + "outputs": [ + { + "name": "output_parsed_pairs", + "type": "4dn_pairsam" + }, + { + "name": "parsed_pairs_stats", + "type": "tabular" + } + ], + "position": { + "left": 2927.5259623065385, + "top": 66.3908541727944 + }, + "post_job_actions": { + "HideDatasetActionoutput_parsed_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_parsed_pairs" + }, + "HideDatasetActionparsed_pairs_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "parsed_pairs_stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "a5876cca7b05", + "name": "pairtools_parse", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"assembly_name\": \"\", \"chroms_path\": {\"__class__\": \"ConnectedValue\"}, \"compress_output\": true, \"drop_readid\": false, \"drop_sam\": true, \"drop_seq\": true, \"max_inter_algn_gap\": \"20\", \"max_molecule_size\": \"2000\", \"min_mapq\": \"1\", \"output_stats\": true, \"sam_path\": {\"__class__\": \"ConnectedValue\"}, \"select_add_columns\": {\"add_columns_selection\": \"no\", \"__current_case__\": 1}, \"sort_output\": true, \"walks_policy\": \"mask\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.3+galaxy6", + "type": "tool", + "uuid": "9205b952-9164-4ba4-9c25-4456a206e12b", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 12, + "input_connections": { + "input": { + "id": 10, + "output_name": "output1" + }, + "when": { + "id": 6, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 2632.9323345231205, + "top": 483.13780589990847 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "22bcd1ca-c4f9-4802-b545-c20f2f7798f4", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "errors": null, + "id": 13, + "input_connections": { + "bamfiles": { + "id": 10, + "output_name": "output1" + }, + "when": { + "id": 6, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2622.2988641864786, + "top": 732.1479927873434 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "03cf4998-54d1-43b4-9005-828e8e1da14c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "errors": null, + "id": 14, + "input_connections": { + "pairs_path": { + "id": 11, + "output_name": "output_parsed_pairs" + } + }, + "inputs": [], + "label": null, + "name": "Pairtools dedup", + "outputs": [ + { + "name": "output_dedup_pairs", + "type": "input" + }, + { + "name": "dedup_pairs_stats", + "type": "tabular" + } + ], + "position": { + "left": 3269.7967904728735, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActiondedup_pairs_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "dedup_pairs_stats" + }, + "HideDatasetActionoutput_dedup_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_dedup_pairs" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "3d1d241ceff2", + "name": "pairtools_dedup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"compress_output\": true, \"mark_dups\": true, \"max_mismatch\": \"0\", \"output_bytile_stats\": false, \"output_dups\": false, \"output_stats\": true, \"pairs_path\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.3+galaxy6", + "type": "tool", + "uuid": "222ad224-925a-495f-ab74-44c2fb2af4a4", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 15, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 13, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 12, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3030.7036252124967, + "top": 771.7493692529479 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged Hi-C Alignments on Scaffolds" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e9571afc-84e8-44b7-a213-8d484124a0bc", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "data_param", + "uuid": "73c1bd3b-29d8-4b4c-b62c-eb105c50c455" + } + ] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "errors": null, + "id": 16, + "input_connections": { + "input_tabular": { + "id": 14, + "output_name": "dedup_pairs_stats" + } + }, + "inputs": [], + "label": null, + "name": "Column join", + "outputs": [ + { + "name": "tabular_output", + "type": "tabular" + } + ], + "position": { + "left": 3643.390891223076, + "top": 513.4889769208286 + }, + "post_job_actions": { + "RenameDatasetActiontabular_output": { + "action_arguments": { + "newname": "Hi-C duplication stats on Scaffolds: Raw" + }, + "action_type": "RenameDatasetAction", + "output_name": "tabular_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "tool_shed_repository": { + "changeset_revision": "3ddd99c7efee", + "name": "collection_column_join", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fill_char\": \".\", \"has_header\": \"0\", \"identifier_column\": \"1\", \"include_outputs\": null, \"input_tabular\": {\"__class__\": \"ConnectedValue\"}, \"old_col_in_header\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.3", + "type": "tool", + "uuid": "9b13d478-eb6a-410d-9fb0-aa13a4543d0e", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Scaffolds: Raw", + "output_name": "tabular_output", + "uuid": "d8a7cd1e-0599-4689-a043-9abbd78ba998" + } + ] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", + "errors": null, + "id": 17, + "input_connections": { + "results_0|software_cond|input": { + "id": 14, + "output_name": "dedup_pairs_stats" + } + }, + "inputs": [], + "label": "Pairtools Multiqc", + "name": "MultiQC", + "outputs": [ + { + "name": "plots", + "type": "input" + }, + { + "name": "png_plot", + "type": "input" + }, + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 3989.2982637108043, + "top": 301.5986199229453 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "tsv" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "HideDatasetActionplots": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "plots" + }, + "RenameDatasetActionhtml_report": { + "action_arguments": { + "newname": "Hi-C duplication stats on Scaffolds: MultiQc" + }, + "action_type": "RenameDatasetAction", + "output_name": "html_report" + }, + "RenameDatasetActionpng_plot": { + "action_arguments": { + "newname": "Pairtools MultiQc on Scaffolds: Plots" + }, + "action_type": "RenameDatasetAction", + "output_name": "png_plot" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Pairtools Multiqc Stats on Scaffolds" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionhtml_report": { + "action_arguments": { + "tags": "hic_dup_multiqc_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "html_report" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "hic_dup_raw_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", + "tool_shed_repository": { + "changeset_revision": "862943c10425", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 40, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.33+galaxy3", + "type": "tool", + "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", + "when": null, + "workflow_outputs": [ + { + "label": "Pairtools Multiqc Stats on Scaffolds", + "output_name": "stats", + "uuid": "4a116025-b7d6-48b1-adb9-f0023cd84582" + }, + { + "label": "Hi-C duplication stats on Scaffolds: MultiQc", + "output_name": "html_report", + "uuid": "97ad859e-9e00-493b-bc24-c953af6ba495" + }, + { + "label": "Pairtools MultiQc on Scaffolds: Plots", + "output_name": "png_plot", + "uuid": "7992a75f-dca5-41fe-84e0-ae612a7c5ac6" + } + ] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 18, + "input_connections": { + "bamfile": { + "id": 15, + "output_name": "data_param" + }, + "when": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": "Remove duplicates", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 3513.4500625546125, + "top": 904.7579298870468 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionstats_output": { "action_arguments": {}, "action_type": "HideDatasetAction", + "output_name": "stats_output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "name:no_duplicates" + }, + "action_type": "TagDatasetAction", "output_name": "output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", "tool_shed_repository": { - "changeset_revision": "84819580b8a5", - "name": "samtools_fixmate", + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "294a749f-e96a-45d7-9e2b-fd71d0afe5b2", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 19, + "input_connections": { + "bamfile": { + "id": 15, + "output_name": "data_param" + }, + "when": { + "id": 8, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Keep duplicated", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 3505.1000217766386, + "top": 1184.7675817632073 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionstats_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "stats_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": false, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "9172e934-6ce0-4bc6-a526-e3d3fe539e58", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 20, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 18, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 19, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3895.0499323909808, + "top": 959.7107727965537 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Precuration Hi-C alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "precur_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", + "when": null, + "workflow_outputs": [ + { + "label": "Precuration Hi-C alignments", + "output_name": "data_param", + "uuid": "7a45c47e-138b-4a85-8df7-82fc71fd587a" + } + ] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 21, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 18, + "output_name": "stats_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 19, + "output_name": "stats_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3894.1790786103747, + "top": 1189.1824762726665 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Hi-C duplication stats on Scaffolds" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "hic_dup_stats_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "1db82bd3-3108-4f39-a0f0-f9e5450e1f4f", - "when": null, - "workflow_outputs": [] + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e1be9200-6f90-4b6f-a920-416e730a4721", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "data_param", + "uuid": "474d51ef-99fd-4718-a403-497eab1db380" + } + ] + } + }, + "tags": [], + "uuid": "fbaaa11a-d22f-4eaf-83df-6356de4e95ea" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "cbc36287-42a8-4989-b9f0-71f32229c140", + "when": null, + "workflow_outputs": [ + { + "label": "Pairtools Multiqc Stats on Scaffolds", + "output_name": "Pairtools Multiqc Stats on Scaffolds", + "uuid": "f6e65a23-e1e9-4d7a-9002-7cb6290f3c17" + }, + { + "label": "Pairtools MultiQc on Scaffolds: Plots", + "output_name": "Pairtools MultiQc on Scaffolds: Plots", + "uuid": "1eeda1e7-9e92-4391-bc75-68f454a5e45f" + }, + { + "label": "Alignments", + "output_name": "Alignments", + "uuid": "438502d4-1283-4e9b-bf4c-8ceafe365ddf" + }, + { + "label": "Precuration Hi-C alignments", + "output_name": "Precuration Hi-C alignments", + "uuid": "6b3631b2-9f33-4697-8294-cc0091a26988" + }, + { + "label": "Trimmed Hi-C data", + "output_name": "Trimmed Hi-C data", + "uuid": "dcfda183-0f3d-4230-8df5-c5cdf57ce8ed" + }, + { + "label": "Hi-C duplication stats on Scaffolds: Raw", + "output_name": "Hi-C duplication stats on Scaffolds: Raw", + "uuid": "9029ce2c-a017-40d8-a2fa-fb5a1f5e633b" + }, + { + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "Merged Hi-C Alignments on Scaffolds", + "uuid": "5e57b67b-0d56-4bde-8fd2-3d974e378137" + }, + { + "label": "Hi-C duplication stats on Scaffolds: MultiQc", + "output_name": "Hi-C duplication stats on Scaffolds: MultiQc", + "uuid": "08d9dbc2-45e9-4f9b-ac5d-bfa3ae3e6212" + }, + { + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "Hi-C duplication stats on Scaffolds", + "uuid": "04e4799b-2eaf-4ea1-875b-33a4b8948a35" + } + ] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "errors": null, + "id": 35, + "input_connections": { + "canonical": { + "id": 19, + "output_name": "output" + }, + "input_sequence": { + "id": 32, + "output_name": "data_param" + }, + "patterns": { + "id": 20, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Teloscope", + "outputs": [ + { + "name": "terminal_telomeres", + "type": "bed" + }, + { + "name": "telo_report", + "type": "tabular" + } + ], + "position": { + "left": 2387.6812133789062, + "top": 1382.1624755859375 + }, + "post_job_actions": { + "RenameDatasetActiontelo_report": { + "action_arguments": { + "newname": "Telomere Report" + }, + "action_type": "RenameDatasetAction", + "output_name": "telo_report" + }, + "RenameDatasetActionterminal_telomeres": { + "action_arguments": { + "newname": "terminal telomeres" + }, + "action_type": "RenameDatasetAction", + "output_name": "terminal_telomeres" + }, + "TagDatasetActiontelo_report": { + "action_arguments": { + "tags": "telomere_report" + }, + "action_type": "TagDatasetAction", + "output_name": "telo_report" + }, + "TagDatasetActionterminal_telomeres": { + "action_arguments": { + "tags": "terminal_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "terminal_telomeres" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "321ceb58023e", + "name": "teloscope", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"canonical\": {\"__class__\": \"ConnectedValue\"}, \"edit_distance\": \"0\", \"input_sequence\": {\"__class__\": \"ConnectedValue\"}, \"max_block_distance\": \"200\", \"max_match_distance\": \"50\", \"min_block_density\": \"0.5\", \"min_block_length\": \"500\", \"out_entropy\": false, \"out_gc\": false, \"out_its\": false, \"out_matches\": false, \"out_win_repeats\": false, \"patterns\": {\"__class__\": \"ConnectedValue\"}, \"step\": \"500\", \"terminal_limit\": \"50000\", \"ultra_fast\": true, \"verbose\": false, \"window\": \"1000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.3+galaxy1", + "type": "tool", + "uuid": "437d8023-f3b8-47d0-a34e-56b0471de43f", + "when": null, + "workflow_outputs": [ + { + "label": "terminal telomeres", + "output_name": "terminal_telomeres", + "uuid": "edf9292a-fd55-4391-80ca-d8e0eef89960" + }, + { + "label": "Telomere Report", + "output_name": "telo_report", + "uuid": "83cf865b-a124-4a84-9cf7-8bb6d966ad7c" + } + ] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 36, + "input_connections": { + "input_file": { + "id": 32, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2806.71773975613, + "top": 998.8499106927812 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "bed" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Gaps Bed" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "Gaps_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps Bed", + "output_name": "stats", + "uuid": "4a7f2ef2-c635-4ddb-b23b-8546f9290ef9" + } + ] + }, + "37": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 37, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 23, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 32, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1754.538310590754, + "top": 2590.4403003291627 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "3a32edd4-d4e1-4837-a3d2-3d5a26c4f330", + "when": null, + "workflow_outputs": [] + }, + "38": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", + "errors": null, + "id": 38, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 31, + "output_name": "data_param" + }, + "reference_source|ref_file": { + "id": 32, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 2481.356559673871, + "top": 1969.797536524506 + }, + "post_job_actions": { + "HideDatasetActionalignment_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3faf9a2bf58d", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"b\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"end_bonus\": \"0\", \"score_N\": \"1\", \"no_end_flt\": true, \"jump_min_match\": \"3\", \"end_seed_pen\": \"6\", \"cap_sw_mem\": \"100m\", \"cap_kalloc\": \"500m\"}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false, \"copy_comments\": false, \"ds_tag\": false, \"secondary_seq\": false, \"two_io_threads\": false, \"seed\": null}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null, \"rmq_inner\": \"1000\", \"no_hash_name\": false, \"pairing\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.30+galaxy0", + "type": "tool", + "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "id": 39, + "input_connections": { + "Database for Compleasm": { + "id": 4, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Haplotype 1": { + "id": 33, + "input_subworkflow_step_id": 2, + "output_name": "data_param" + }, + "Haplotype 2": { + "id": 30, + "input_subworkflow_step_id": 4, + "output_name": "data_param" + }, + "Lineage for Compleasm": { + "id": 3, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Will you use a second haplotype?": { + "id": 6, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Gene Tracks for PretextMap", + "outputs": [], + "position": { + "left": 2859.614458148943, + "top": 240.65437722692624 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [ + { + "child_steps": [ + 5, + 6, + 7, + 8, + 9, + 10, + 11, + 12 + ], + "color": "turquoise", + "data": { + "title": "Gene Annotations" + }, + "id": 0, + "position": [ + 533.1600054474995, + 0 + ], + "size": [ + 1878, + 674 + ], + "type": "frame" + } + ], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" }, - "12": { + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Gene Tracks for PretextMap", + "report": { + "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nMarkduplicate deduplication stats (if applicable)\n\n```galaxy\nhistory_dataset_embedded(output=\"Markduplicates Summary\")\n```\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n\n\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "content_id": null, "errors": null, - "id": 12, - "input_connections": { - "input1": { - "id": 11, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Samtools sort", - "outputs": [ + "id": 0, + "input_connections": {}, + "inputs": [ { - "name": "output1", - "type": "bam" + "description": "", + "name": "Lineage for Compleasm" } ], + "label": "Lineage for Compleasm", + "name": "Input parameter", + "outputs": [], "position": { - "left": 2289.4479412815194, - "top": 519.3556477175839 - }, - "post_job_actions": { - "HideDatasetActionoutput1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", - "tool_shed_repository": { - "changeset_revision": "69dca890852c", - "name": "samtools_sort", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 0, + "top": 85.32391557497368 }, - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.0.8", - "type": "tool", - "uuid": "5033d744-4b6d-4486-b2ea-732697d51e45", + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c5aa113e-5a56-4b29-8d56-6c1eb8a3fd25", "when": null, "workflow_outputs": [] }, - "13": { + "1": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "content_id": null, "errors": null, - "id": 13, - "input_connections": { - "chroms_path": { - "id": 5, - "output_name": "output" - }, - "sam_path": { - "id": 11, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pairtools parse", - "outputs": [ - { - "name": "output_parsed_pairs", - "type": "4dn_pairsam" - }, + "id": 1, + "input_connections": {}, + "inputs": [ { - "name": "parsed_pairs_stats", - "type": "tabular" + "description": "", + "name": "Database for Compleasm" } ], + "label": "Database for Compleasm", + "name": "Input parameter", + "outputs": [], "position": { - "left": 2927.5259623065385, - "top": 66.3908541727944 - }, - "post_job_actions": { - "HideDatasetActionoutput_parsed_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_parsed_pairs" - }, - "HideDatasetActionparsed_pairs_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "parsed_pairs_stats" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", - "tool_shed_repository": { - "changeset_revision": "a5876cca7b05", - "name": "pairtools_parse", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 41.75634461605, + "top": 182.8222030363895 }, - "tool_state": "{\"assembly_name\": \"\", \"chroms_path\": {\"__class__\": \"ConnectedValue\"}, \"compress_output\": true, \"drop_readid\": false, \"drop_sam\": true, \"drop_seq\": true, \"max_inter_algn_gap\": \"20\", \"max_molecule_size\": \"2000\", \"min_mapq\": \"1\", \"output_stats\": true, \"sam_path\": {\"__class__\": \"ConnectedValue\"}, \"select_add_columns\": {\"add_columns_selection\": \"no\", \"__current_case__\": 1}, \"sort_output\": true, \"walks_policy\": \"mask\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.3+galaxy6", - "type": "tool", - "uuid": "9205b952-9164-4ba4-9c25-4456a206e12b", + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c5675865-8136-4234-b434-c3c9c1f64d63", "when": null, "workflow_outputs": [] }, - "14": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", + "2": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, "errors": null, - "id": 14, - "input_connections": { - "input": { - "id": 12, - "output_name": "output1" - }, - "when": { - "id": 6, - "output_name": "Has a single sample" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ + "id": 2, + "input_connections": {}, + "inputs": [ { - "name": "output", - "type": "data" + "description": "Assembly for Haplotype 1.", + "name": "Haplotype 1" } ], + "label": "Haplotype 1", + "name": "Input dataset", + "outputs": [], "position": { - "left": 2632.9323345231205, - "top": 483.13780589990847 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } + "left": 61.29385043769571, + "top": 275.80325102051034 }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "22bcd1ca-c4f9-4802-b545-c20f2f7798f4", - "when": "$(inputs.when)", + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, "workflow_outputs": [] }, - "15": { + "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "content_id": null, "errors": null, - "id": 15, - "input_connections": { - "bamfiles": { - "id": 12, - "output_name": "output1" - }, - "when": { - "id": 6, - "output_name": "Has multiple samples" - } - }, - "inputs": [], - "label": null, - "name": "Samtools merge", - "outputs": [ + "id": 3, + "input_connections": {}, + "inputs": [ { - "name": "output", - "type": "bam" + "description": "", + "name": "Will you use a second haplotype?" } ], + "label": "Will you use a second haplotype?", + "name": "Input parameter", + "outputs": [], "position": { - "left": 2653.2593349539566, - "top": 775.3922577847298 + "left": 99.30947543769571, + "top": 372.6782510205104 }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "697b66dc-1c0f-40d7-9d03-51318db580f1", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", + "name": "Haplotype 2" } + ], + "label": "Haplotype 2", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 146.6219754376957, + "top": 485.6470010205102 }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", - "tool_shed_repository": { - "changeset_revision": "c8bc9d08b0e3", - "name": "samtools_merge", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy1", - "type": "tool", - "uuid": "03cf4998-54d1-43b4-9005-828e8e1da14c", - "when": "$(inputs.when)", + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", + "when": null, "workflow_outputs": [] }, - "16": { + "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", "errors": null, - "id": 16, + "id": 5, "input_connections": { - "pairs_path": { - "id": 13, - "output_name": "output_parsed_pairs" + "busco_database": { + "id": 1, + "output_name": "output" + }, + "input": { + "id": 2, + "output_name": "output" + }, + "lineage_dataset": { + "id": 0, + "output_name": "output" } }, "inputs": [], "label": null, - "name": "Pairtools dedup", + "name": "compleasm", "outputs": [ { - "name": "output_dedup_pairs", - "type": "input" + "name": "full_table_busco", + "type": "tsv" }, { - "name": "dedup_pairs_stats", - "type": "tabular" + "name": "miniprot", + "type": "gff3" } ], "position": { - "left": 3269.7967904728735, - "top": 0 + "left": 905.7228651529651, + "top": 37.836439137037075 }, "post_job_actions": { - "HideDatasetActiondedup_pairs_stats": { + "HideDatasetActionfull_table_busco": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "dedup_pairs_stats" + "output_name": "full_table_busco" }, - "HideDatasetActionoutput_dedup_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_dedup_pairs" + "RenameDatasetActionfull_table_busco": { + "action_arguments": { + "newname": "Compleasm hap1 - Busco" + }, + "action_type": "RenameDatasetAction", + "output_name": "full_table_busco" + }, + "RenameDatasetActionminiprot": { + "action_arguments": { + "newname": "Compleasm hap1 - Miniprot" + }, + "action_type": "RenameDatasetAction", + "output_name": "miniprot" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", "tool_shed_repository": { - "changeset_revision": "3d1d241ceff2", - "name": "pairtools_dedup", + "changeset_revision": "fc7334661489", + "name": "compleasm", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"compress_output\": true, \"mark_dups\": true, \"max_mismatch\": \"0\", \"output_bytile_stats\": false, \"output_dups\": false, \"output_stats\": true, \"pairs_path\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.1.3+galaxy6", + "tool_version": "0.2.6+galaxy3", "type": "tool", - "uuid": "222ad224-925a-495f-ab74-44c2fb2af4a4", + "uuid": "e4ca5b86-c0b2-464a-b382-a4f4e97c40a0", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Compleasm hap1 - Miniprot", + "output_name": "miniprot", + "uuid": "336d5918-9421-4d36-b2e0-e89209c0d6bb" + }, + { + "label": "Compleasm hap1 - Busco", + "output_name": "full_table_busco", + "uuid": "9433e53e-de87-4279-8401-84d955a35da0" + } + ] }, - "17": { + "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", "errors": null, - "id": 17, + "id": 6, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 15, + "busco_database": { + "id": 1, "output_name": "output" }, - "style_cond|type_cond|pick_from_1|value": { - "id": 14, + "input": { + "id": 4, + "output_name": "output" + }, + "lineage_dataset": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 3, "output_name": "output" } }, "inputs": [], "label": null, - "name": "Pick parameter value", + "name": "compleasm", "outputs": [ { - "name": "data_param", - "type": "input" + "name": "full_table_busco", + "type": "tsv" + }, + { + "name": "miniprot", + "type": "gff3" } ], "position": { - "left": 3030.7036252124967, - "top": 771.7493692529479 + "left": 904.6898830986931, + "top": 334.1815908697498 }, "post_job_actions": { - "RenameDatasetActiondata_param": { + "HideDatasetActionfull_table_busco": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "full_table_busco" + }, + "RenameDatasetActionfull_table_busco": { "action_arguments": { - "newname": "Merged Hi-C Alignments on Scaffolds" + "newname": "Compleasm hap2 - Busco" }, "action_type": "RenameDatasetAction", - "output_name": "data_param" + "output_name": "full_table_busco" }, - "TagDatasetActiondata_param": { + "RenameDatasetActionminiprot": { "action_arguments": { - "tags": "merged_alignments_scaffolds" + "newname": "Compleasm hap2 - Miniprot" }, - "action_type": "TagDatasetAction", - "output_name": "data_param" + "action_type": "RenameDatasetAction", + "output_name": "miniprot" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", + "changeset_revision": "fc7334661489", + "name": "compleasm", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.2.6+galaxy3", "type": "tool", - "uuid": "e9571afc-84e8-44b7-a213-8d484124a0bc", - "when": null, + "uuid": "f1c6f5a9-c3a6-42b3-ae7c-8a10068550b3", + "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "Merged Hi-C Alignments on Scaffolds", - "output_name": "data_param", - "uuid": "73c1bd3b-29d8-4b4c-b62c-eb105c50c455" + "label": "Compleasm hap2 - Miniprot", + "output_name": "miniprot", + "uuid": "d85e1256-c930-44d3-a7a5-632e74d0f3db" + }, + { + "label": "Compleasm hap2 - Busco", + "output_name": "full_table_busco", + "uuid": "e96ed079-858f-4610-ad93-844fd95f77c2" } ] }, - "18": { + "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", "errors": null, - "id": 18, + "id": 7, "input_connections": { - "input_tabular": { - "id": 16, - "output_name": "dedup_pairs_stats" - } + "inputs": [ + { + "id": 5, + "output_name": "miniprot" + }, + { + "id": 6, + "output_name": "miniprot" + } + ] }, "inputs": [], "label": null, - "name": "Column join", + "name": "Concatenate datasets", "outputs": [ { - "name": "tabular_output", - "type": "tabular" + "name": "out_file1", + "type": "input" } ], "position": { - "left": 3643.390891223076, - "top": 513.4889769208286 + "left": 1153.9599688264059, + "top": 242.00007324218757 }, "post_job_actions": { - "RenameDatasetActiontabular_output": { + "RenameDatasetActionout_file1": { "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds: Raw" + "newname": "Merged Compleasm Gffs" }, "action_type": "RenameDatasetAction", - "output_name": "tabular_output" + "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", "tool_shed_repository": { - "changeset_revision": "3ddd99c7efee", - "name": "collection_column_join", - "owner": "iuc", + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"fill_char\": \".\", \"has_header\": \"0\", \"identifier_column\": \"1\", \"include_outputs\": null, \"input_tabular\": {\"__class__\": \"ConnectedValue\"}, \"old_col_in_header\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.0.3", + "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "9b13d478-eb6a-410d-9fb0-aa13a4543d0e", + "uuid": "1185817d-9a3a-4949-912a-3d0738f6f112", "when": null, "workflow_outputs": [ { - "label": "Hi-C duplication stats on Scaffolds: Raw", - "output_name": "tabular_output", - "uuid": "d8a7cd1e-0599-4689-a043-9abbd78ba998" + "label": "Merged Compleasm Gffs", + "output_name": "out_file1", + "uuid": "5e40c8c2-7163-45e3-9e1c-98765e2486ee" } ] }, - "19": { + "8": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "content_id": "gff2bed1", "errors": null, - "id": 19, + "id": 8, "input_connections": { - "results_0|software_cond|input": { - "id": 16, - "output_name": "dedup_pairs_stats" + "input": { + "id": 7, + "output_name": "out_file1" } }, "inputs": [], - "label": "Pairtools Multiqc", - "name": "MultiQC", + "label": null, + "name": "GFF-to-BED", "outputs": [ { - "name": "plots", - "type": "input" - }, - { - "name": "png_plot", - "type": "input" - }, - { - "name": "html_report", - "type": "html" - }, - { - "name": "stats", - "type": "tabular" + "name": "out_file1", + "type": "bed" } ], "position": { - "left": 3989.2982637108043, - "top": 301.5986199229453 + "left": 1332.1163408967184, + "top": 460.55012207031257 }, "post_job_actions": { - "ChangeDatatypeActionstats": { - "action_arguments": { - "newtype": "tsv" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "stats" - }, - "HideDatasetActionplots": { + "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "plots" - }, - "RenameDatasetActionhtml_report": { - "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds: MultiQc" - }, - "action_type": "RenameDatasetAction", - "output_name": "html_report" - }, - "RenameDatasetActionpng_plot": { - "action_arguments": { - "newname": "Pairtools MultiQc on Scaffolds: Plots" - }, - "action_type": "RenameDatasetAction", - "output_name": "png_plot" - }, - "RenameDatasetActionstats": { - "action_arguments": { - "newname": "Pairtools Multiqc Stats on Scaffolds" - }, - "action_type": "RenameDatasetAction", - "output_name": "stats" - }, - "TagDatasetActionhtml_report": { - "action_arguments": { - "tags": "hic_dup_multiqc_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "html_report" - }, - "TagDatasetActionstats": { - "action_arguments": { - "tags": "hic_dup_raw_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "stats" + "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", - "tool_shed_repository": { - "changeset_revision": "26ee5e11ecbe", - "name": "multiqc", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 39, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "gff2bed1", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.33+galaxy0", + "tool_version": "1.0.1", "type": "tool", - "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", + "uuid": "8b3c70e3-68f4-4af1-a91d-3d4a2aebee15", "when": null, - "workflow_outputs": [ - { - "label": "Hi-C duplication stats on Scaffolds: MultiQc", - "output_name": "html_report", - "uuid": "97ad859e-9e00-493b-bc24-c953af6ba495" - }, - { - "label": "Pairtools MultiQc on Scaffolds: Plots", - "output_name": "png_plot", - "uuid": "7992a75f-dca5-41fe-84e0-ae612a7c5ac6" - }, - { - "label": "Pairtools Multiqc Stats on Scaffolds", - "output_name": "stats", - "uuid": "4a116025-b7d6-48b1-adb9-f0023cd84582" - } - ] + "workflow_outputs": [] }, - "20": { + "9": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "content_id": "Filter1", "errors": null, - "id": 20, + "id": 9, "input_connections": { - "bamfile": { - "id": 17, - "output_name": "data_param" - }, - "when": { - "id": 3, - "output_name": "output" + "input": { + "id": 8, + "output_name": "out_file1" } }, "inputs": [], - "label": "Remove duplicates", - "name": "Samtools markdup", + "label": "Keep CDS", + "name": "Filter", "outputs": [ { - "name": "output", - "type": "bam" - }, - { - "name": "stats_output", - "type": "txt" + "name": "out_file1", + "type": "input" } ], "position": { - "left": 3513.4500625546125, - "top": 904.7579298870468 + "left": 1443.2725908967184, + "top": 119.82502441406257 }, "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - }, - "HideDatasetActionstats_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "stats_output" - }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "name:no_duplicates" - }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "ef678e1f70a2", - "name": "samtools_markdup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } }, - "tool_state": "{\"bamfile\": {\"__class__\": \"RuntimeValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c4=='CDS'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.22+galaxy2", + "tool_version": "1.1.1", "type": "tool", - "uuid": "294a749f-e96a-45d7-9e2b-fd71d0afe5b2", - "when": "$(inputs.when)", + "uuid": "61b1c6f2-cb71-470b-973a-5065c32b4275", + "when": null, "workflow_outputs": [] }, - "21": { + "10": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", "errors": null, - "id": 21, + "id": 10, "input_connections": { - "bamfile": { - "id": 17, - "output_name": "data_param" - }, - "when": { - "id": 8, - "output_name": "output_param_boolean" + "infile": { + "id": 9, + "output_name": "out_file1" } }, "inputs": [], - "label": "Keep duplicated", - "name": "Samtools markdup", + "label": null, + "name": "Unique lines", "outputs": [ { - "name": "output", - "type": "bam" - }, - { - "name": "stats_output", - "type": "txt" + "name": "outfile", + "type": "input" } ], "position": { - "left": 3505.1000217766386, - "top": 1184.7675817632073 + "left": 1675.5415117951559, + "top": 273.86872558593757 }, "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - }, - "HideDatasetActionstats_output": { + "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "stats_output" + "output_name": "outfile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", "tool_shed_repository": { - "changeset_revision": "ef678e1f70a2", - "name": "samtools_markdup", - "owner": "iuc", + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"grouping\": {\"grouping_select\": \"no\", \"__current_case__\": 0, \"count\": false, \"repeated\": false, \"uniqueonly\": true}, \"ignorecase\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"skipfields\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.22+galaxy2", + "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "9172e934-6ce0-4bc6-a526-e3d3fe539e58", - "when": "$(inputs.when)", + "uuid": "96bd05b5-633e-4b34-8cef-fd09cf615cac", + "when": null, "workflow_outputs": [] }, - "22": { + "11": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "Cut1", "errors": null, - "id": 22, + "id": 11, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 20, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 21, - "output_name": "output" + "input": { + "id": 10, + "output_name": "outfile" } }, "inputs": [], "label": null, - "name": "Pick parameter value", + "name": "Cut", "outputs": [ { - "name": "data_param", - "type": "input" + "name": "out_file1", + "type": "tabular" } ], "position": { - "left": 3895.0499323909808, - "top": 959.7107727965537 + "left": 1873.7536699982809, + "top": 436.83759765625007 }, "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Precuration Hi-C alignments" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "precur_hic_alignments" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "1.0.2", "type": "tool", - "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", + "uuid": "3c457431-0357-4287-bb3d-16dfca800c6a", "when": null, - "workflow_outputs": [ - { - "label": "Precuration Hi-C alignments", - "output_name": "data_param", - "uuid": "7a45c47e-138b-4a85-8df7-82fc71fd587a" - } - ] + "workflow_outputs": [] }, - "23": { + "12": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, - "id": 23, + "id": 12, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 20, - "output_name": "stats_output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 21, - "output_name": "stats_output" + "input": { + "id": 11, + "output_name": "out_file1" } }, "inputs": [], "label": null, - "name": "Pick parameter value", + "name": "Add column", "outputs": [ { - "name": "data_param", + "name": "out_file1", "type": "input" } ], "position": { - "left": 3894.1790786103747, - "top": 1189.1824762726665 + "left": 2105.841072342031, + "top": 490.40009765625007 }, "post_job_actions": { - "RenameDatasetActiondata_param": { + "ChangeDatatypeActionout_file1": { "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds" + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Compleasm Genes track" }, "action_type": "RenameDatasetAction", - "output_name": "data_param" + "output_name": "out_file1" }, - "TagDatasetActiondata_param": { + "TagDatasetActionout_file1": { "action_arguments": { - "tags": "hic_dup_stats_scaffolds" + "tags": "gene_bedgraph" }, "action_type": "TagDatasetAction", - "output_name": "data_param" + "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "1.0.1", "type": "tool", - "uuid": "e1be9200-6f90-4b6f-a920-416e730a4721", + "uuid": "09fd742a-1113-4ded-a5f1-0ee1200d30a0", "when": null, "workflow_outputs": [ { - "label": "Hi-C duplication stats on Scaffolds", - "output_name": "data_param", - "uuid": "474d51ef-99fd-4718-a403-497eab1db380" + "label": "Compleasm Genes track", + "output_name": "out_file1", + "uuid": "94f1d13d-0964-4469-bb33-416a6012dcd0" } ] } }, "tags": [], - "uuid": "c7542d02-e14a-48e5-b968-12782e345189" + "uuid": "7fc536e9-da91-49ef-b42c-32ae1d0ac00c" }, "tool_id": null, "type": "subworkflow", - "uuid": "cbc36287-42a8-4989-b9f0-71f32229c140", - "when": null, + "uuid": "d0a10285-7606-4302-ba3b-5c43b42e2602", + "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "Pairtools MultiQc on Scaffolds: Plots", - "output_name": "Pairtools MultiQc on Scaffolds: Plots", - "uuid": "1eeda1e7-9e92-4391-bc75-68f454a5e45f" - }, - { - "label": "Hi-C duplication stats on Scaffolds: Raw", - "output_name": "Hi-C duplication stats on Scaffolds: Raw", - "uuid": "9029ce2c-a017-40d8-a2fa-fb5a1f5e633b" - }, - { - "label": "Trimmed Hi-C data", - "output_name": "Trimmed Hi-C data", - "uuid": "dcfda183-0f3d-4230-8df5-c5cdf57ce8ed" - }, - { - "label": "Merged Hi-C Alignments on Scaffolds", - "output_name": "Merged Hi-C Alignments on Scaffolds", - "uuid": "5e57b67b-0d56-4bde-8fd2-3d974e378137" - }, - { - "label": "Hi-C duplication stats on Scaffolds", - "output_name": "Hi-C duplication stats on Scaffolds", - "uuid": "04e4799b-2eaf-4ea1-875b-33a4b8948a35" + "label": "Compleasm Genes track", + "output_name": "Compleasm Genes track", + "uuid": "f8399762-1903-4af7-ba37-4c75350cef30" + } + ] + }, + "40": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "errors": null, + "id": 40, + "input_connections": { + "highRes": { + "id": 15, + "output_name": "output" }, - { - "label": "Precuration Hi-C alignments", - "output_name": "Precuration Hi-C alignments", - "uuid": "6b3631b2-9f33-4697-8294-cc0091a26988" + "input": { + "id": 34, + "output_name": "Precuration Hi-C alignments" }, + "map_qual": { + "id": 18, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "PretextMap", + "outputs": [ { - "label": "Pairtools Multiqc Stats on Scaffolds", - "output_name": "Pairtools Multiqc Stats on Scaffolds", - "uuid": "f6e65a23-e1e9-4d7a-9002-7cb6290f3c17" + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 3973.4164481149905, + "top": 1136.237612582866 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" }, - { - "label": "Hi-C duplication stats on Scaffolds: MultiQc", - "output_name": "Hi-C duplication stats on Scaffolds: MultiQc", - "uuid": "08d9dbc2-45e9-4f9b-ac5d-bfa3ae3e6212" + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" } - ] + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.4+galaxy0", + "type": "tool", + "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", + "when": null, + "workflow_outputs": [] }, - "32": { + "41": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "errors": null, - "id": 32, + "id": 41, "input_connections": { - "canonical": { - "id": 18, + "highRes": { + "id": 15, "output_name": "output" }, - "input_sequence": { - "id": 29, - "output_name": "data_param" - }, - "patterns": { - "id": 19, - "output_name": "output" + "input": { + "id": 34, + "output_name": "Precuration Hi-C alignments" } }, "inputs": [], - "label": null, - "name": "Teloscope", + "label": "PretextMap - Multimapping", + "name": "PretextMap", "outputs": [ { - "name": "terminal_telomeres", - "type": "bed" - }, - { - "name": "telo_report", - "type": "tabular" + "name": "pretext_map_out", + "type": "pretext" } ], "position": { - "left": 2387.6812133789062, - "top": 1382.1624755859375 + "left": 4136.625251693286, + "top": 346.86115561767815 }, "post_job_actions": { - "RenameDatasetActiontelo_report": { - "action_arguments": { - "newname": "Telomere Report" - }, - "action_type": "RenameDatasetAction", - "output_name": "telo_report" - }, - "RenameDatasetActionterminal_telomeres": { - "action_arguments": { - "newname": "terminal telomeres" - }, - "action_type": "RenameDatasetAction", - "output_name": "terminal_telomeres" - }, - "TagDatasetActiontelo_report": { - "action_arguments": { - "tags": "telomere_report" - }, - "action_type": "TagDatasetAction", - "output_name": "telo_report" + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" }, - "TagDatasetActionterminal_telomeres": { + "TagDatasetActionpretext_map_out": { "action_arguments": { - "tags": "terminal_telomeres" + "tags": "haps_pretext" }, "action_type": "TagDatasetAction", - "output_name": "terminal_telomeres" + "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "321ceb58023e", - "name": "teloscope", + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"canonical\": {\"__class__\": \"ConnectedValue\"}, \"edit_distance\": \"0\", \"input_sequence\": {\"__class__\": \"ConnectedValue\"}, \"max_block_distance\": \"200\", \"max_match_distance\": \"50\", \"min_block_density\": \"0.5\", \"min_block_length\": \"500\", \"out_entropy\": false, \"out_gc\": false, \"out_its\": false, \"out_matches\": false, \"out_win_repeats\": false, \"patterns\": {\"__class__\": \"ConnectedValue\"}, \"step\": \"500\", \"terminal_limit\": \"50000\", \"ultra_fast\": true, \"verbose\": false, \"window\": \"1000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.3+galaxy1", + "tool_version": "0.2.4+galaxy0", "type": "tool", - "uuid": "437d8023-f3b8-47d0-a34e-56b0471de43f", + "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", "when": null, - "workflow_outputs": [ - { - "label": "terminal telomeres", - "output_name": "terminal_telomeres", - "uuid": "edf9292a-fd55-4391-80ca-d8e0eef89960" - }, + "workflow_outputs": [] + }, + "42": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "errors": null, + "id": 42, + "input_connections": { + "input": { + "id": 34, + "output_name": "Precuration Hi-C alignments" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping low res", + "name": "PretextMap", + "outputs": [ { - "label": "Telomere Report", - "output_name": "telo_report", - "uuid": "83cf865b-a124-4a84-9cf7-8bb6d966ad7c" + "name": "pretext_map_out", + "type": "pretext" } - ] + ], + "position": { + "left": 5765.761554435896, + "top": 777.3727930905267 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.4+galaxy0", + "type": "tool", + "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", + "when": null, + "workflow_outputs": [] }, - "33": { + "43": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "errors": null, - "id": 33, + "id": 43, "input_connections": { - "input_file": { - "id": 29, - "output_name": "data_param" + "input": { + "id": 34, + "output_name": "Precuration Hi-C alignments" + }, + "map_qual": { + "id": 18, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "gfastats", + "label": "PretextMap low res", + "name": "PretextMap", "outputs": [ { - "name": "stats", - "type": "tabular" + "name": "pretext_map_out", + "type": "pretext" } ], "position": { - "left": 2806.71773975613, - "top": 998.8499106927812 + "left": 5673.928332926333, + "top": 1567.174596178742 }, "post_job_actions": { - "ChangeDatatypeActionstats": { - "action_arguments": { - "newtype": "bed" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "stats" - }, - "RenameDatasetActionstats": { - "action_arguments": { - "newname": "Gaps Bed" - }, - "action_type": "RenameDatasetAction", - "output_name": "stats" - }, - "TagDatasetActionstats": { - "action_arguments": { - "tags": "Gaps_bed" - }, - "action_type": "TagDatasetAction", - "output_name": "stats" + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "0fe699ced54f", - "name": "gfastats", - "owner": "bgruening", + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.3.11+galaxy1", + "tool_version": "0.2.4+galaxy0", "type": "tool", - "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", + "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", "when": null, - "workflow_outputs": [ + "workflow_outputs": [] + }, + "44": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 44, + "input_connections": { + "input": { + "id": 35, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select Q telomeres", + "name": "Filter", + "outputs": [ { - "label": "Gaps Bed", - "output_name": "stats", - "uuid": "4a7f2ef2-c635-4ddb-b23b-8546f9290ef9" + "name": "out_file1", + "type": "input" } - ] + ], + "position": { + "left": 2626.2625122070312, + "top": 1262.8624877929688 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:q" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='q'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "a73922af-2560-4a97-853a-ca8a5498686f", + "when": null, + "workflow_outputs": [] }, - "34": { + "45": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "content_id": "Filter1", "errors": null, - "id": 34, + "id": 45, "input_connections": { - "fastq_input|fastq_input1": { - "id": 28, - "output_name": "data_param" - }, - "reference_source|ref_file": { - "id": 29, - "output_name": "data_param" + "input": { + "id": 35, + "output_name": "terminal_telomeres" } }, "inputs": [], - "label": null, - "name": "Map with minimap2", + "label": "Select P telomeres", + "name": "Filter", "outputs": [ { - "name": "alignment_output", - "type": "bam" + "name": "out_file1", + "type": "input" } ], "position": { - "left": 2481.356559673871, - "top": 1969.797536524506 + "left": 2665.8374633789062, + "top": 1619.3125 }, "post_job_actions": { - "HideDatasetActionalignment_output": { + "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "alignment_output" + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:p" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", - "tool_shed_repository": { - "changeset_revision": "539de907fd99", - "name": "minimap2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='p'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.28+galaxy2", + "tool_version": "1.1.1", "type": "tool", - "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", + "uuid": "37467b63-9fb8-4488-85cb-0c748f625b55", "when": null, "workflow_outputs": [] }, - "35": { + "46": { "annotation": "", - "id": 35, + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", + "errors": null, + "id": 46, "input_connections": { - "Database for Compleasm": { - "id": 4, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Haplotype 1": { - "id": 30, - "input_subworkflow_step_id": 2, - "output_name": "data_param" - }, - "Haplotype 2": { - "id": 27, - "input_subworkflow_step_id": 4, - "output_name": "data_param" - }, - "Lineage for Compleasm": { - "id": 3, - "input_subworkflow_step_id": 0, - "output_name": "output" - }, - "Will you use a second haplotype?": { - "id": 6, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Gene Tracks for PretextMap", - "outputs": [], - "position": { - "left": 2859.614458148943, - "top": 240.65437722692624 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [ - { - "child_steps": [ - 5, - 6, - 7, - 8, - 9, - 10, - 11, - 12 - ], - "color": "turquoise", - "data": { - "title": "Gene Annotations" - }, - "id": 0, - "position": [ - 533.1600054474995, - 0 - ], - "size": [ - 1878, - 674 - ], - "type": "frame" - } - ], - "creator": [ - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6228-2785", - "name": "Patrik Smeds" - }, - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6421-3484", - "name": "Delphine Lariviere" - } - ], - "format-version": "0.1", - "license": "MIT", - "name": "Gene Tracks for PretextMap", - "report": { - "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nMarkduplicate deduplication stats (if applicable)\n\n```galaxy\nhistory_dataset_embedded(output=\"Markduplicates Summary\")\n```\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n\n\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Lineage for Compleasm" - } - ], - "label": "Lineage for Compleasm", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 0, - "top": 85.32391557497368 - }, - "tool_id": null, - "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "c5aa113e-5a56-4b29-8d56-6c1eb8a3fd25", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Database for Compleasm" - } - ], - "label": "Database for Compleasm", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 41.75634461605, - "top": 182.8222030363895 - }, - "tool_id": null, - "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "c5675865-8136-4234-b434-c3c9c1f64d63", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "Assembly for Haplotype 1.", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 1.", - "name": "Haplotype 1" - } - ], - "label": "Haplotype 1", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 61.29385043769571, - "top": 275.80325102051034 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Will you use a second haplotype?" - } - ], - "label": "Will you use a second haplotype?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 99.30947543769571, - "top": 372.6782510205104 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "697b66dc-1c0f-40d7-9d03-51318db580f1", - "when": null, - "workflow_outputs": [] + "input": { + "id": 36, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3034.7278944620984, + "top": 999.5879286334185 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" }, - "4": { - "annotation": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "content_id": null, - "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "name": "Haplotype 2" - } - ], - "label": "Haplotype 2", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 146.6219754376957, - "top": 485.6470010205102 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", - "when": null, - "workflow_outputs": [] + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Gaps Bedgraph" }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "errors": null, - "id": 5, - "input_connections": { - "busco_database": { - "id": 1, - "output_name": "output" - }, - "input": { - "id": 2, - "output_name": "output" - }, - "lineage_dataset": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "compleasm", - "outputs": [ - { - "name": "full_table_busco", - "type": "tsv" - }, - { - "name": "miniprot", - "type": "gff3" - } - ], - "position": { - "left": 905.7228651529651, - "top": 37.836439137037075 - }, - "post_job_actions": { - "HideDatasetActionfull_table_busco": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionfull_table_busco": { - "action_arguments": { - "newname": "Compleasm hap1 - Busco" - }, - "action_type": "RenameDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionminiprot": { - "action_arguments": { - "newname": "Compleasm hap1 - Miniprot" - }, - "action_type": "RenameDatasetAction", - "output_name": "miniprot" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "tool_shed_repository": { - "changeset_revision": "fc7334661489", - "name": "compleasm", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.6+galaxy3", - "type": "tool", - "uuid": "e4ca5b86-c0b2-464a-b382-a4f4e97c40a0", - "when": null, - "workflow_outputs": [ - { - "label": "Compleasm hap1 - Miniprot", - "output_name": "miniprot", - "uuid": "336d5918-9421-4d36-b2e0-e89209c0d6bb" - }, - { - "label": "Compleasm hap1 - Busco", - "output_name": "full_table_busco", - "uuid": "9433e53e-de87-4279-8401-84d955a35da0" - } - ] + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "Gaps" }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "errors": null, - "id": 6, - "input_connections": { - "busco_database": { - "id": 1, - "output_name": "output" - }, - "input": { - "id": 4, - "output_name": "output" - }, - "lineage_dataset": { - "id": 0, - "output_name": "output" - }, - "when": { - "id": 3, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "compleasm", - "outputs": [ - { - "name": "full_table_busco", - "type": "tsv" - }, - { - "name": "miniprot", - "type": "gff3" - } - ], - "position": { - "left": 904.6898830986931, - "top": 334.1815908697498 - }, - "post_job_actions": { - "HideDatasetActionfull_table_busco": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionfull_table_busco": { - "action_arguments": { - "newname": "Compleasm hap2 - Busco" - }, - "action_type": "RenameDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionminiprot": { - "action_arguments": { - "newname": "Compleasm hap2 - Miniprot" - }, - "action_type": "RenameDatasetAction", - "output_name": "miniprot" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "tool_shed_repository": { - "changeset_revision": "fc7334661489", - "name": "compleasm", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.6+galaxy3", - "type": "tool", - "uuid": "f1c6f5a9-c3a6-42b3-ae7c-8a10068550b3", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "Compleasm hap2 - Miniprot", - "output_name": "miniprot", - "uuid": "d85e1256-c930-44d3-a7a5-632e74d0f3db" - }, - { - "label": "Compleasm hap2 - Busco", - "output_name": "full_table_busco", - "uuid": "e96ed079-858f-4610-ad93-844fd95f77c2" - } - ] + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "61f9ddbc63ca", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.1+galaxy0", + "type": "tool", + "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps Bedgraph", + "output_name": "out_file1", + "uuid": "9fa64361-b645-4ca3-91cd-4a0d13f13a41" + } + ] + }, + "47": { + "annotation": "", + "content_id": "CONVERTER_gz_to_uncompressed", + "errors": null, + "id": 47, + "input_connections": { + "input1": { + "id": 37, + "output_name": "data_param" + }, + "when": { + "id": 22, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Convert gz compressed file to uncompressed.", + "outputs": [ + { + "name": "output1", + "type": "auto" + } + ], + "position": { + "left": 2360.837093879186, + "top": 2649.969030395428 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput1": { + "action_arguments": { + "newtype": "fasta" }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "errors": null, - "id": 7, - "input_connections": { - "inputs": [ - { - "id": 5, - "output_name": "miniprot" - }, - { - "id": 6, - "output_name": "miniprot" - } - ] - }, - "inputs": [], - "label": null, - "name": "Concatenate datasets", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 1153.9599688264059, - "top": 242.00007324218757 - }, - "post_job_actions": { - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Merged Compleasm Gffs" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "1185817d-9a3a-4949-912a-3d0738f6f112", - "when": null, - "workflow_outputs": [ - { - "label": "Merged Compleasm Gffs", - "output_name": "out_file1", - "uuid": "5e40c8c2-7163-45e3-9e1c-98765e2486ee" - } - ] + "action_type": "ChangeDatatypeAction", + "output_name": "output1" + } + }, + "tool_id": "CONVERTER_gz_to_uncompressed", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "3573f560-1fd1-4748-94f5-530c89717387", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "48": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "errors": null, + "id": 48, + "input_connections": { + "bamfiles": { + "id": 38, + "output_name": "alignment_output" + }, + "when": { + "id": 27, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2737.3809424386664, + "top": 1876.5829215416961 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "48c3b202-85ca-447b-8f91-fbc440e33366", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "49": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 49, + "input_connections": { + "input": { + "id": 38, + "output_name": "alignment_output" + }, + "when": { + "id": 27, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 2737.1827748438227, + "top": 2185.366944111388 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "72de31ed-6ef4-4f67-9150-459573b7e7e5", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "50": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "errors": null, + "id": 50, + "input_connections": { + "input": { + "id": 42, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6099.3355097740405, + "top": 778.0990311701319 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "tool_shed_repository": { + "changeset_revision": "c4fb391275a0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.7+galaxy0", + "type": "tool", + "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", + "when": null, + "workflow_outputs": [] + }, + "51": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "errors": null, + "id": 51, + "input_connections": { + "input": { + "id": 43, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6019.383156159895, + "top": 1473.3425883338787 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "tool_shed_repository": { + "changeset_revision": "c4fb391275a0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.7+galaxy0", + "type": "tool", + "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", + "when": null, + "workflow_outputs": [] + }, + "52": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 52, + "input_connections": { + "input": { + "id": 44, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Q telomere bed", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2896.8187866210938, + "top": 1319.72509765625 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" }, - "8": { - "annotation": "", - "content_id": "gff2bed1", - "errors": null, - "id": 8, - "input_connections": { - "input": { - "id": 7, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "GFF-to-BED", - "outputs": [ - { - "name": "out_file1", - "type": "bed" - } - ], - "position": { - "left": 1332.1163408967184, - "top": 460.55012207031257 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "gff2bed1", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.1", - "type": "tool", - "uuid": "8b3c70e3-68f4-4af1-a91d-3d4a2aebee15", - "when": null, - "workflow_outputs": [] + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Q telomeres Bed" }, - "9": { - "annotation": "", - "content_id": "Filter1", - "errors": null, - "id": 9, - "input_connections": { - "input": { - "id": 8, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Keep CDS", - "name": "Filter", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 1443.2725908967184, - "top": 119.82502441406257 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Filter1", - "tool_state": "{\"cond\": \"c4=='CDS'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.1", - "type": "tool", - "uuid": "61b1c6f2-cb71-470b-973a-5065c32b4275", - "when": null, - "workflow_outputs": [] + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "q_telomeres" }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", - "errors": null, - "id": 10, - "input_connections": { - "infile": { - "id": 9, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Unique lines", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 1675.5415117951559, - "top": 273.86872558593757 - }, - "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"grouping\": {\"grouping_select\": \"no\", \"__current_case__\": 0, \"count\": false, \"repeated\": false, \"uniqueonly\": true}, \"ignorecase\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"skipfields\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "96bd05b5-633e-4b34-8cef-fd09cf615cac", - "when": null, - "workflow_outputs": [] + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "676086b9-9a0a-40b2-8d7b-466ead68cf2b", + "when": null, + "workflow_outputs": [ + { + "label": "Q telomeres Bed", + "output_name": "out_file1", + "uuid": "b9b7d743-5f41-49f3-a640-5a68ee3a63a4" + } + ] + }, + "53": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 53, + "input_connections": { + "input": { + "id": 45, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "P telomere bed ", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2899.6375122070312, + "top": 1543.53125 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" }, - "11": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 11, - "input_connections": { - "input": { - "id": 10, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 1873.7536699982809, - "top": 436.83759765625007 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "3c457431-0357-4287-bb3d-16dfca800c6a", - "when": null, - "workflow_outputs": [] + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "P telomeres bed" }, - "12": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", - "errors": null, - "id": 12, - "input_connections": { - "input": { - "id": 11, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Add column", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 2105.841072342031, - "top": 490.40009765625007 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Compleasm Genes track" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "gene_bedgraph" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", - "tool_shed_repository": { - "changeset_revision": "023f0a3760b3", - "name": "add_value", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.1", - "type": "tool", - "uuid": "09fd742a-1113-4ded-a5f1-0ee1200d30a0", - "when": null, - "workflow_outputs": [ - { - "label": "Compleasm Genes track", - "output_name": "out_file1", - "uuid": "94f1d13d-0964-4469-bb33-416a6012dcd0" - } - ] - } + "action_type": "RenameDatasetAction", + "output_name": "out_file1" }, - "tags": [], - "uuid": "7fc536e9-da91-49ef-b42c-32ae1d0ac00c" + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "p_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } }, - "tool_id": null, - "type": "subworkflow", - "uuid": "d0a10285-7606-4302-ba3b-5c43b42e2602", - "when": "$(inputs.when)", + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "512bfacb-51f6-4820-a16e-61ec7b484be4", + "when": null, "workflow_outputs": [ { - "label": "Compleasm Genes track", - "output_name": "Compleasm Genes track", - "uuid": "f8399762-1903-4af7-ba37-4c75350cef30" + "label": "P telomeres bed", + "output_name": "out_file1", + "uuid": "4b23fce7-a313-42ef-b365-783ee0bd24e6" + } + ] + }, + "54": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 54, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 39, + "output_name": "Compleasm Genes track" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 46, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3663.9331595238805, + "top": 440.8730581971614 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "3158715d-0e51-4f0d-a427-d4c20744a9cb", + "when": null, + "workflow_outputs": [] + }, + "55": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 55, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 48, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 49, + "output_name": "output" + } + }, + "inputs": [], + "label": "Hifi Alignments", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3009.3609015626676, + "top": 2051.606896331395 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged HiFi Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_hifi_align_precur" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2afb1f1a-4687-4c63-9496-d66c63c23a01", + "when": null, + "workflow_outputs": [ + { + "label": "Merged HiFi Alignments", + "output_name": "data_param", + "uuid": "b0149c13-2ddf-4fb1-9939-5d38c8a98312" + } + ] + }, + "56": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 56, + "input_connections": { + "input": { + "id": 50, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 6385.092527631594, + "top": 742.7570387373108 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Pretext Snapshot With tracks - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_multimapping" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "7815d57b-da36-42a2-b25c-4cf3dbf89c69", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot With tracks - Multimapping", + "output_name": "output", + "uuid": "70a9b730-a184-47e3-ad69-de0034bf35ed" } ] }, - "36": { + "57": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "__EXTRACT_DATASET__", "errors": null, - "id": 36, + "id": 57, "input_connections": { - "highRes": { - "id": 16, - "output_name": "output" - }, "input": { - "id": 31, - "output_name": "Precuration Hi-C alignments" - }, - "map_qual": { - "id": 17, - "output_name": "output" + "id": 51, + "output_name": "pretext_snap_out" } }, "inputs": [], "label": null, - "name": "PretextMap", + "name": "Extract dataset", "outputs": [ { - "name": "pretext_map_out", - "type": "pretext" + "name": "output", + "type": "data" } ], "position": { - "left": 3973.4164481149905, - "top": 1136.237612582866 + "left": 6387.01295886191, + "top": 1600.5355317281906 }, "post_job_actions": { - "HideDatasetActionpretext_map_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Pretext Snapshot With tracks" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" }, - "TagDatasetActionpretext_map_out": { + "TagDatasetActionoutput": { "action_arguments": { - "tags": "haps_pretext" + "tags": "pretext_img_coverage" }, "action_type": "TagDatasetAction", - "output_name": "pretext_map_out" + "output_name": "output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "056f86469460", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "1.0.2", "type": "tool", - "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", + "uuid": "1a9ded49-abf8-425f-b4a2-abcbcb537aa0", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Pretext Snapshot With tracks", + "output_name": "output", + "uuid": "892bc21e-a9b2-4524-8b1e-02f2a139ab25" + } + ] }, - "37": { + "58": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "param_value_from_file", "errors": null, - "id": 37, + "id": 58, "input_connections": { - "highRes": { - "id": 16, - "output_name": "output" - }, - "input": { - "id": 31, - "output_name": "Precuration Hi-C alignments" + "input1": { + "id": 52, + "output_name": "out_file1" } }, "inputs": [], - "label": "PretextMap - Multimapping", - "name": "PretextMap", + "label": "Test if Q telomere track is empty", + "name": "Parse parameter value", "outputs": [ { - "name": "pretext_map_out", - "type": "pretext" + "name": "text_param", + "type": "expression.json" } ], "position": { - "left": 4136.625251693286, - "top": 346.86115561767815 + "left": 3158.901898076252, + "top": 1266.582592170533 }, "post_job_actions": { - "HideDatasetActionpretext_map_out": { + "HideDatasetActiontext_param": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" - }, - "TagDatasetActionpretext_map_out": { - "action_arguments": { - "tags": "haps_pretext" - }, - "action_type": "TagDatasetAction", - "output_name": "pretext_map_out" + "output_name": "text_param" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "056f86469460", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "0.1.0", "type": "tool", - "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", + "uuid": "7617ecee-71c5-40fc-b7a0-46ec5e6d09c6", "when": null, "workflow_outputs": [] }, - "38": { + "59": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "param_value_from_file", "errors": null, - "id": 38, + "id": 59, "input_connections": { - "input": { - "id": 31, - "output_name": "Precuration Hi-C alignments" + "input1": { + "id": 53, + "output_name": "out_file1" } }, "inputs": [], - "label": "PretextMap - Multimapping low res", - "name": "PretextMap", + "label": "Test if P telomere track is empty", + "name": "Parse parameter value", "outputs": [ { - "name": "pretext_map_out", - "type": "pretext" + "name": "text_param", + "type": "expression.json" } ], "position": { - "left": 5765.761554435896, - "top": 777.3727930905267 + "left": 3174.0897711185717, + "top": 1637.7439948451865 }, "post_job_actions": { - "HideDatasetActionpretext_map_out": { + "HideDatasetActiontext_param": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" + "output_name": "text_param" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "056f86469460", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "0.1.0", "type": "tool", - "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", + "uuid": "eaf0278b-fb8e-4001-9def-bc26d8846694", "when": null, "workflow_outputs": [] }, - "39": { + "60": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", "errors": null, - "id": 39, + "id": 60, "input_connections": { - "input": { - "id": 31, - "output_name": "Precuration Hi-C alignments" + "bamInput": { + "id": 55, + "output_name": "data_param" }, - "map_qual": { - "id": 17, + "binSize": { + "id": 21, "output_name": "output" } }, "inputs": [], - "label": "PretextMap low res", - "name": "PretextMap", + "label": null, + "name": "bamCoverage", "outputs": [ { - "name": "pretext_map_out", - "type": "pretext" + "name": "outFileName", + "type": "bigwig" } ], "position": { - "left": 5673.928332926333, - "top": 1567.174596178742 + "left": 3268.6408118386503, + "top": 1932.8127046094655 }, "post_job_actions": { - "HideDatasetActionpretext_map_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "BigWig Coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "056f86469460", - "name": "pretext_map", + "changeset_revision": "0e49b109abc2", + "name": "deeptools_bam_coverage", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bamInput\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"type\": \"no\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "43e863a6-80b4-4c02-a249-ca7a6469ac01", + "when": null, + "workflow_outputs": [ + { + "label": "BigWig Coverage", + "output_name": "outFileName", + "uuid": "99e50ff7-22ae-4afc-af83-e81b69c73931" + } + ] + }, + "61": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "errors": null, + "id": 61, + "input_connections": { + "input_bams": { + "id": 55, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools depth", + "outputs": [ + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 3270.6159423253503, + "top": 2206.55560224621 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "fb6d5ffc365f", + "name": "samtools_depth", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__input_ext\": \"input\", \"additional_options\": {\"required_flags\": null, \"skipped_flags\": [\"4\", \"256\", \"512\", \"1024\"], \"deletions\": false, \"single_read\": false}, \"all\": \"-a\", \"basequality\": null, \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"mapquality\": null, \"maxdepth\": null, \"minlength\": null, \"output_options\": {\"header\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "1.22+galaxy1", "type": "tool", - "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", + "uuid": "75e128e1-596f-4804-9d3d-2788ee7bf5b3", "when": null, "workflow_outputs": [] }, - "40": { + "62": { "annotation": "", - "content_id": "Filter1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 40, + "id": 62, "input_connections": { - "input": { - "id": 32, - "output_name": "terminal_telomeres" + "input_param_type|input_param": { + "id": 58, + "output_name": "text_param" } }, "inputs": [], - "label": "Select Q telomeres", - "name": "Filter", + "label": "False if Q telomere track is empty", + "name": "Map parameter value", "outputs": [ { - "name": "out_file1", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 2626.2625122070312, - "top": 1262.8624877929688 + "left": 3459.9078024663245, + "top": 1351.4977300677754 }, "post_job_actions": { - "HideDatasetActionout_file1": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "name:q" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" + "output_name": "output_param_boolean" } }, - "tool_id": "Filter1", - "tool_state": "{\"cond\": \"c5=='q'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.1.1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "a73922af-2560-4a97-853a-ca8a5498686f", + "uuid": "3de1eefb-971f-4e56-9dd4-da995d9facc8", "when": null, "workflow_outputs": [] }, - "41": { + "63": { "annotation": "", - "content_id": "Filter1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 41, + "id": 63, "input_connections": { - "input": { - "id": 32, - "output_name": "terminal_telomeres" + "input_param_type|input_param": { + "id": 59, + "output_name": "text_param" } }, "inputs": [], - "label": "Select P telomeres", - "name": "Filter", + "label": "False if P telomere track is empty", + "name": "Map parameter value", "outputs": [ { - "name": "out_file1", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 2665.8374633789062, - "top": 1619.3125 + "left": 3464.3675577025474, + "top": 1561.2479958064835 }, "post_job_actions": { - "HideDatasetActionout_file1": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "name:p" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" + "output_name": "output_param_boolean" } }, - "tool_id": "Filter1", - "tool_state": "{\"cond\": \"c5=='p'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.1.1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "37467b63-9fb8-4488-85cb-0c748f625b55", + "uuid": "2ddee770-02bd-4e81-bb00-491a92b06dc1", "when": null, "workflow_outputs": [] }, - "42": { + "64": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", - "errors": null, - "id": 42, + "id": 64, "input_connections": { - "input": { - "id": 33, + "Coverage": { + "id": 60, + "input_subworkflow_step_id": 6, + "output_name": "outFileName" + }, + "Gaps": { + "id": 36, + "input_subworkflow_step_id": 5, "output_name": "stats" + }, + "Hap1 fasta": { + "id": 33, + "input_subworkflow_step_id": 0, + "output_name": "data_param" + }, + "Related Species": { + "id": 47, + "input_subworkflow_step_id": 2, + "output_name": "output1" + }, + "Telomeres P": { + "id": 53, + "input_subworkflow_step_id": 4, + "output_name": "out_file1" + }, + "Telomeres Q": { + "id": 52, + "input_subworkflow_step_id": 3, + "output_name": "out_file1" + }, + "Use related species": { + "id": 22, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "when": { + "id": 25, + "output_name": "output_param_boolean" } }, "inputs": [], "label": null, - "name": "Compute", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], + "name": "Jbrowse for pre-curation single haplotype - 1 related Species ", + "outputs": [], "position": { - "left": 3034.7278944620984, - "top": 999.5879286334185 + "left": 3398.4932677353545, + "top": 2665.6965483971267 }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Jbrowse for pre-curation single haplotype - 1 related Species ", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1 fasta" + } + ], + "label": "Hap1 fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 686.8914778117049 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Use related species" + } + ], + "label": "Use related species", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 97.33530571454516, + "top": 833.1606579195632 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "71dda500-06c4-4a48-a224-7fde74d2748c", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Related Species" + } + ], + "label": "Related Species", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 202.5747418320626, + "top": 962.9951825363166 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "771229b7-cdcc-462a-a1e5-314204a3fca1", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres Q" + } + ], + "label": "Telomeres Q", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 287.6245497455406, + "top": 1093.6253398337244 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres P" + } + ], + "label": "Telomeres P", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 360.4670294190771, + "top": 1217.260852908304 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Gaps" + } + ], + "label": "Gaps", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 428.24001452834693, + "top": 1339.6729807500467 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", + "when": null, + "workflow_outputs": [] }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Gaps Bedgraph" + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Coverage" + } + ], + "label": "Coverage", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 525.7135234989578, + "top": 1459.6992362130693 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "738f43fc-5f88-4117-bcc3-4a9c1b01c0a1", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "Gaps" + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 2, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 619.5075673031254, + "top": 971.9101001267942 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Haplotype 2" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "cad00f23-5894-47db-82ed-268f774ccaea", + "when": null, + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", - "tool_shed_repository": { - "changeset_revision": "aff5135563c6", - "name": "column_maker", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.1", - "type": "tool", - "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", - "when": null, - "workflow_outputs": [ - { - "label": "Gaps Bedgraph", - "output_name": "out_file1", - "uuid": "9fa64361-b645-4ca3-91cd-4a0d13f13a41" - } - ] - }, - "43": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", - "errors": null, - "id": 43, - "input_connections": { - "bamfiles": { - "id": 34, - "output_name": "alignment_output" - }, - "when": { - "id": 24, - "output_name": "Has multiple samples" - } - }, - "inputs": [], - "label": null, - "name": "Samtools merge", - "outputs": [ - { - "name": "output", - "type": "bam" - } - ], - "position": { - "left": 2737.3809424386664, - "top": 1876.5829215416961 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", - "tool_shed_repository": { - "changeset_revision": "c8bc9d08b0e3", - "name": "samtools_merge", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy1", - "type": "tool", - "uuid": "48c3b202-85ca-447b-8f91-fbc440e33366", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "44": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 44, - "input_connections": { - "input": { - "id": 34, - "output_name": "alignment_output" + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "assemblies_0|reference_genome|genome": { + "id": 0, + "output_name": "output" + }, + "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 3, + "output_name": "output" + }, + "assemblies_0|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 4, + "output_name": "output" + }, + "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 5, + "output_name": "output" + }, + "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": "JBrowse2 Hap1 vs Hap2 with no related species", + "name": "JBrowse2", + "outputs": [ + { + "name": "output", + "type": "html" + } + ], + "position": { + "left": 1798.734334125839, + "top": 0 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "JBrowse2 Single Haplotype" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd903fbbc26e", + "name": "jbrowse2", + "owner": "fubar", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Telomeres\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_off\"}}]}, {\"__index__\": 1, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.7.0+galaxy0", + "type": "tool", + "uuid": "252b3e45-ec8a-4989-bfe2-7c1e3285310b", + "when": null, + "workflow_outputs": [ + { + "label": "JBrowse2 Single Haplotype", + "output_name": "output", + "uuid": "20eb67af-6a5e-44f1-a9eb-4cd7c7cf627a" + } + ] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "errors": null, + "id": 9, + "input_connections": { + "query": { + "id": 0, + "output_name": "output" + }, + "reflist": { + "id": 7, + "output_name": "data_param" + }, + "when": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "hap1 vs species", + "name": "mashmap", + "outputs": [ + { + "name": "mashout", + "type": "paf" + } + ], + "position": { + "left": 955.5494790136057, + "top": 786.0873120373774 + }, + "post_job_actions": { + "HideDatasetActionmashout": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "mashout" + }, + "RenameDatasetActionmashout": { + "action_arguments": { + "newname": "hap1 vs species" + }, + "action_type": "RenameDatasetAction", + "output_name": "mashout" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a3a6b0b31f2d", + "name": "mashmap", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"85.0\", \"query\": {\"__class__\": \"ConnectedValue\"}, \"reflist\": {\"__class__\": \"ConnectedValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.3+galaxy0", + "type": "tool", + "uuid": "b1a857dd-1140-4641-943b-cb141b6a6f81", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 9, + "output_name": "mashout" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1224.2937845515573, + "top": 1116.8354674745467 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Haplotype 2" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "904004ca-fd2e-4feb-8e60-6ae1479a7cc0", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "id": 11, + "input_connections": { + "Coverage": { + "id": 6, + "input_subworkflow_step_id": 6, + "output_name": "output" + }, + "Gaps": { + "id": 5, + "input_subworkflow_step_id": 5, + "output_name": "output" + }, + "Hap1 fasta": { + "id": 0, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Hap1 vs Species": { + "id": 10, + "input_subworkflow_step_id": 2, + "output_name": "data_param" + }, + "Related Fasta": { + "id": 7, + "input_subworkflow_step_id": 1, + "output_name": "data_param" + }, + "Telomeres P": { + "id": 4, + "input_subworkflow_step_id": 4, + "output_name": "output" + }, + "Telomeres Q": { + "id": 3, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "when": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Jbrowse2 for 1 related species - single haplotype", + "outputs": [], + "position": { + "left": 1647.5351247457652, + "top": 1085.328180259472 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Jbrowse2 for 1 related species - single haplotype", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1 fasta" + } + ], + "label": "Hap1 fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 209.77609965576414 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Related Fasta" + } + ], + "label": "Related Fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 64.19044612855507, + "top": 340.1894548398588 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "385825a9-198e-425f-9fb3-55af892d20dc", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1 vs Species" + } + ], + "label": "Hap1 vs Species", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 113.31939864522589, + "top": 479.71782494540537 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"paf\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "c18b3a25-89e8-4853-81fe-affb519a9ae0", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres Q" + } + ], + "label": "Telomeres Q", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 173.91872965677103, + "top": 641.211210134653 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres P" + } + ], + "label": "Telomeres P", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 262.08020244071406, + "top": 800.007485299661 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Gaps" + } + ], + "label": "Gaps", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 334.3294215467986, + "top": 926.8224375339558 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Coverage" + } + ], + "label": "Coverage", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 431.83941564925703, + "top": 1079.271676485952 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "2131fd1e-4f34-4662-be5c-382101fcbc76", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "errors": null, + "id": 7, + "input_connections": { + "assemblies_0|reference_genome|genome": { + "id": 0, + "output_name": "output" + }, + "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 2, + "output_name": "output" + }, + "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 3, + "output_name": "output" + }, + "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 4, + "output_name": "output" + }, + "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 5, + "output_name": "output" + }, + "assemblies_0|track_groups_3|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 6, + "output_name": "output" + }, + "assemblies_1|reference_genome|genome": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "JBrowse2 Hap1 and hap2 with 1st related species", + "name": "JBrowse2", + "outputs": [ + { + "name": "output", + "type": "html" + } + ], + "position": { + "left": 1931.9531457553405, + "top": 0 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "JBrowse2 Single Haplotype with related species" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd903fbbc26e", + "name": "jbrowse2", + "owner": "fubar", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Telomeres Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 3, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": []}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.7.0+galaxy0", + "type": "tool", + "uuid": "0dba1c5e-903c-46f3-a58c-2b9341b92a15", + "when": null, + "workflow_outputs": [ + { + "label": "JBrowse2 Single Haplotype with related species", + "output_name": "output", + "uuid": "448fe2be-896a-49d7-b5c3-dfc4ceae0352" + } + ] + } + }, + "tags": [], + "uuid": "cbf1ff46-2fda-482b-aa3d-33cef23120e5" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "6ad9fa44-c0d3-49e8-af09-e1a93e66eb8a", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "JBrowse2 Single Haplotype with related species", + "output_name": "JBrowse2 Single Haplotype with related species", + "uuid": "3c519fbb-453d-418c-8af3-e4532cf23c28" + } + ] + } }, - "when": { - "id": 24, - "output_name": "Has a single sample" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 2737.1827748438227, - "top": 2185.366944111388 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } + "tags": [], + "uuid": "95a5ecaa-5b9f-48ee-935d-0d0bfcf5369b" }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "72de31ed-6ef4-4f67-9150-459573b7e7e5", + "tool_id": null, + "type": "subworkflow", + "uuid": "7fa40e11-ee9e-4492-852e-fa55278c26fe", "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "45": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", - "errors": null, - "id": 45, - "input_connections": { - "input": { - "id": 38, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": null, - "name": "Pretext Snapshot", - "outputs": [ + "workflow_outputs": [ { - "name": "pretext_snap_out", - "type": "input" - } - ], - "position": { - "left": 6099.3355097740405, - "top": 778.0990311701319 - }, - "post_job_actions": { - "HideDatasetActionpretext_snap_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_snap_out" + "label": "JBrowse2 Single Haplotype with related species", + "output_name": "JBrowse2 Single Haplotype with related species", + "uuid": "3a5bf4bd-0e11-4289-b09a-3126d1da9594" + }, + { + "label": "JBrowse2 Single Haplotype", + "output_name": "JBrowse2 Single Haplotype", + "uuid": "ea2c03ae-4fde-4f58-8efc-5eb54043a083" } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", - "tool_shed_repository": { - "changeset_revision": "ff02cf8f66f0", - "name": "pretext_snapshot", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.5+galaxy1", - "type": "tool", - "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", - "when": null, - "workflow_outputs": [] + ] }, - "46": { + "65": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 46, + "id": 65, "input_connections": { "input": { - "id": 39, + "id": 60, + "output_name": "outFileName" + }, + "pretext": { + "id": 41, "output_name": "pretext_map_out" } }, "inputs": [], - "label": null, - "name": "Pretext Snapshot", + "label": "Add Coverage Track - Multimapping", + "name": "Pretextgraph", "outputs": [ { - "name": "pretext_snap_out", - "type": "input" + "name": "graph_out", + "type": "pretext" } ], "position": { - "left": 6019.383156159895, - "top": 1473.3425883338787 + "left": 4314.893682463086, + "top": 618.766281070267 }, "post_job_actions": { - "HideDatasetActionpretext_snap_out": { + "HideDatasetActiongraph_out": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "pretext_snap_out" + "output_name": "graph_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "tool_shed_repository": { - "changeset_revision": "ff02cf8f66f0", - "name": "pretext_snapshot", + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.5+galaxy1", - "type": "tool", - "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", - "when": null, - "workflow_outputs": [] - }, - "47": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 47, - "input_connections": { - "input": { - "id": 40, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Q telomere bed", - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 2896.8187866210938, - "top": 1319.72509765625 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Q telomeres Bed" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "q_telomeres" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "676086b9-9a0a-40b2-8d7b-466ead68cf2b", - "when": null, - "workflow_outputs": [ - { - "label": "Q telomeres Bed", - "output_name": "out_file1", - "uuid": "b9b7d743-5f41-49f3-a640-5a68ee3a63a4" - } - ] - }, - "48": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 48, - "input_connections": { - "input": { - "id": 41, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "P telomere bed ", - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 2899.6375122070312, - "top": 1543.53125 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "P telomeres bed" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "p_telomeres" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.0.2", + "tool_version": "0.0.9+galaxy0", "type": "tool", - "uuid": "512bfacb-51f6-4820-a16e-61ec7b484be4", + "uuid": "fd4f30e5-128b-4a4d-b9f6-2239323f99da", "when": null, - "workflow_outputs": [ - { - "label": "P telomeres bed", - "output_name": "out_file1", - "uuid": "4b23fce7-a313-42ef-b365-783ee0bd24e6" - } - ] + "workflow_outputs": [] }, - "49": { + "66": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 49, + "id": 66, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 35, - "output_name": "Compleasm Genes track" + "input": { + "id": 60, + "output_name": "outFileName" }, - "style_cond|type_cond|pick_from_1|value": { - "id": 42, - "output_name": "out_file1" + "pretext": { + "id": 40, + "output_name": "pretext_map_out" } }, "inputs": [], - "label": null, - "name": "Pick parameter value", + "label": "Add Coverage Track", + "name": "Pretextgraph", "outputs": [ { - "name": "data_param", - "type": "input" + "name": "graph_out", + "type": "pretext" } ], "position": { - "left": 3663.9331595238805, - "top": 440.8730581971614 + "left": 4200.272826576246, + "top": 1518.2005106436195 }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.0.9+galaxy0", "type": "tool", - "uuid": "3158715d-0e51-4f0d-a427-d4c20744a9cb", + "uuid": "68583f52-0bd8-41b4-8f10-0bd0ed274177", "when": null, "workflow_outputs": [] }, - "50": { + "67": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 50, + "id": 67, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 43, + "Coverage": { + "id": 60, + "input_subworkflow_step_id": 7, + "output_name": "outFileName" + }, + "Gaps": { + "id": 36, + "input_subworkflow_step_id": 6, + "output_name": "stats" + }, + "Hap1 fasta": { + "id": 33, + "input_subworkflow_step_id": 0, + "output_name": "data_param" + }, + "Hap2 fasta": { + "id": 30, + "input_subworkflow_step_id": 1, + "output_name": "data_param" + }, + "Related Species": { + "id": 47, + "input_subworkflow_step_id": 3, + "output_name": "output1" + }, + "Telomeres P": { + "id": 53, + "input_subworkflow_step_id": 5, + "output_name": "out_file1" + }, + "Telomeres Q": { + "id": 52, + "input_subworkflow_step_id": 4, + "output_name": "out_file1" + }, + "Use related species": { + "id": 22, + "input_subworkflow_step_id": 2, "output_name": "output" }, - "style_cond|type_cond|pick_from_1|value": { - "id": 44, + "when": { + "id": 6, "output_name": "output" } }, "inputs": [], - "label": "Hifi Alignments", - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], + "label": null, + "name": "Jbrowse for pre-curation", + "outputs": [], "position": { - "left": 3009.3609015626676, - "top": 2051.606896331395 + "left": 3903.743940776823, + "top": 2427.333635312456 }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Merged HiFi Alignments" + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Jbrowse for pre-curation", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1 fasta" + } + ], + "label": "Hap1 fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 742.8897015690675 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap2 fasta" + } + ], + "label": "Hap2 fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 51.81545453466647, + "top": 862.3884271960488 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "177f6825-e58e-45e9-a3fc-8c7623187e02", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Use related species" + } + ], + "label": "Use related species", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 139.93115566784982, + "top": 988.3634184555182 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "71dda500-06c4-4a48-a224-7fde74d2748c", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Related Species" + } + ], + "label": "Related Species", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 297.860981218189, + "top": 1267.0769707757688 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"format\": [\"fasta\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "20f7abfb-20b8-49bb-b522-cd911fd1ec4c", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres Q" + } + ], + "label": "Telomeres Q", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 347.4491076529599, + "top": 1423.3470983747302 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres P" + } + ], + "label": "Telomeres P", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 455.5329585464028, + "top": 1527.4447919828074 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Gaps" + } + ], + "label": "Gaps", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 524.1536909971493, + "top": 1620.8115508618534 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "merged_hifi_align_precur" + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Coverage" + } + ], + "label": "Coverage", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 581.1909253334677, + "top": 1707.9310177752473 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "738f43fc-5f88-4117-bcc3-4a9c1b01c0a1", + "when": null, + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "2afb1f1a-4687-4c63-9496-d66c63c23a01", - "when": null, - "workflow_outputs": [ - { - "label": "Merged HiFi Alignments", - "output_name": "data_param", - "uuid": "b0149c13-2ddf-4fb1-9939-5d38c8a98312" - } - ] - }, - "51": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 51, - "input_connections": { - "input": { - "id": 45, - "output_name": "pretext_snap_out" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 6385.092527631594, - "top": 742.7570387373108 - }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "Pretext Snapshot With tracks - Multimapping" + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "query": { + "id": 0, + "output_name": "output" + }, + "reflist": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "Align Haplotypes Hap1 is query", + "name": "mashmap", + "outputs": [ + { + "name": "mashout", + "type": "paf" + } + ], + "position": { + "left": 1778.2294988244635, + "top": 198.21919351320366 + }, + "post_job_actions": { + "HideDatasetActionmashout": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "mashout" + }, + "RenameDatasetActionmashout": { + "action_arguments": { + "newname": "Alignment Hap1 vs Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "mashout" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a3a6b0b31f2d", + "name": "mashmap", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dense\": false, \"filter_mode\": \"map\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"90.0\", \"query\": {\"__class__\": \"ConnectedValue\"}, \"reflist\": {\"__class__\": \"ConnectedValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.3+galaxy0", + "type": "tool", + "uuid": "d60c6cf5-bdb8-450f-b910-603613c28949", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "output" - }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "pretext_img_multimapping" + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 9, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 3, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 780.0001300734693, + "top": 1172.4278015865104 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Haplotype 2" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "4c0237a8-60c2-4eb0-9fc6-bcd985a50402", + "when": null, + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "7815d57b-da36-42a2-b25c-4cf3dbf89c69", - "when": null, - "workflow_outputs": [ - { - "label": "Pretext Snapshot With tracks - Multimapping", - "output_name": "output", - "uuid": "70a9b730-a184-47e3-ad69-de0034bf35ed" - } - ] - }, - "52": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 52, - "input_connections": { - "input": { - "id": 46, - "output_name": "pretext_snap_out" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 6387.01295886191, - "top": 1600.5355317281906 - }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "Pretext Snapshot With tracks" + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "assemblies_0|reference_genome|genome": { + "id": 0, + "output_name": "output" + }, + "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 8, + "output_name": "mashout" + }, + "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 4, + "output_name": "output" + }, + "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 5, + "output_name": "output" + }, + "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 6, + "output_name": "output" + }, + "assemblies_0|track_groups_3|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 7, + "output_name": "output" + }, + "assemblies_1|reference_genome|genome": { + "id": 1, + "output_name": "output" + }, + "assemblies_1|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 4, + "output_name": "output" + }, + "assemblies_1|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 5, + "output_name": "output" + }, + "assemblies_1|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 6, + "output_name": "output" + }, + "assemblies_1|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": "JBrowse2 Hap1 vs Hap2 with no related species", + "name": "JBrowse2", + "outputs": [ + { + "name": "output", + "type": "html" + } + ], + "position": { + "left": 2889.4791473624273, + "top": 0 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "JBrowse2 Hap1 vs Hap2 with no related species" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd903fbbc26e", + "name": "jbrowse2", + "owner": "fubar", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Alignments\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Telomeres Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_off\"}}]}, {\"__index__\": 2, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 3, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Telomeres\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.7.0+galaxy0", + "type": "tool", + "uuid": "252b3e45-ec8a-4989-bfe2-7c1e3285310b", + "when": null, + "workflow_outputs": [ + { + "label": "JBrowse2 Hap1 vs Hap2 with no related species", + "output_name": "output", + "uuid": "8827e928-aee0-4cfe-ac92-93fa5972035a" + } + ] }, - "action_type": "RenameDatasetAction", - "output_name": "output" - }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "pretext_img_coverage" + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "query": { + "id": 0, + "output_name": "output" + }, + "reflist": { + "id": 9, + "output_name": "data_param" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Hap1 vs Species", + "name": "mashmap", + "outputs": [ + { + "name": "mashout", + "type": "paf" + } + ], + "position": { + "left": 1211.2240968936799, + "top": 657.3499600528801 + }, + "post_job_actions": { + "HideDatasetActionmashout": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "mashout" + }, + "RenameDatasetActionmashout": { + "action_arguments": { + "newname": "Species to Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "mashout" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a3a6b0b31f2d", + "name": "mashmap", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"85.0\", \"query\": {\"__class__\": \"RuntimeValue\"}, \"reflist\": {\"__class__\": \"RuntimeValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.3+galaxy0", + "type": "tool", + "uuid": "ba8fe065-a989-4cff-bcda-2e6883b1f6cd", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "1a9ded49-abf8-425f-b4a2-abcbcb537aa0", - "when": null, - "workflow_outputs": [ - { - "label": "Pretext Snapshot With tracks", - "output_name": "output", - "uuid": "892bc21e-a9b2-4524-8b1e-02f2a139ab25" - } - ] - }, - "53": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 53, - "input_connections": { - "input1": { - "id": 47, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Test if Q telomere track is empty", - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 3158.901898076252, - "top": 1266.582592170533 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "7617ecee-71c5-40fc-b7a0-46ec5e6d09c6", - "when": null, - "workflow_outputs": [] - }, - "54": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 54, - "input_connections": { - "input1": { - "id": 48, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Test if P telomere track is empty", - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 3174.0897711185717, - "top": 1637.7439948451865 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "eaf0278b-fb8e-4001-9def-bc26d8846694", - "when": null, - "workflow_outputs": [] - }, - "55": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", - "errors": null, - "id": 55, - "input_connections": { - "bamInput": { - "id": 50, - "output_name": "data_param" - }, - "binSize": { - "id": 20, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "bamCoverage", - "outputs": [ - { - "name": "outFileName", - "type": "bigwig" - } - ], - "position": { - "left": 3268.6408118386503, - "top": 1932.8127046094655 - }, - "post_job_actions": { - "RenameDatasetActionoutFileName": { - "action_arguments": { - "newname": "BigWig Coverage" + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "errors": null, + "id": 12, + "input_connections": { + "query": { + "id": 9, + "output_name": "data_param" + }, + "reflist": { + "id": 1, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Species vs Hap2", + "name": "mashmap", + "outputs": [ + { + "name": "mashout", + "type": "paf" + } + ], + "position": { + "left": 1224.8019253851462, + "top": 1023.194677480063 + }, + "post_job_actions": { + "HideDatasetActionmashout": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "mashout" + }, + "RenameDatasetActionmashout": { + "action_arguments": { + "newname": "Species to Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "mashout" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a3a6b0b31f2d", + "name": "mashmap", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"85.0\", \"query\": {\"__class__\": \"RuntimeValue\"}, \"reflist\": {\"__class__\": \"RuntimeValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.3+galaxy0", + "type": "tool", + "uuid": "cf1e95b5-3bd6-41c1-a2d4-93ac6c1b1b1a", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "outFileName" - }, - "TagDatasetActionoutFileName": { - "action_arguments": { - "tags": "coverage" + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 13, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 11, + "output_name": "mashout" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 8, + "output_name": "mashout" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1718.6272050699724, + "top": 1176.1114408896244 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Haplotype 2" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "da65eec3-0c6c-4d37-81ba-4661abc5f076", + "when": null, + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "outFileName" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", - "tool_shed_repository": { - "changeset_revision": "0e49b109abc2", - "name": "deeptools_bam_coverage", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bamInput\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"type\": \"no\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.5.4+galaxy0", - "type": "tool", - "uuid": "43e863a6-80b4-4c02-a249-ca7a6469ac01", - "when": null, - "workflow_outputs": [ - { - "label": "BigWig Coverage", - "output_name": "outFileName", - "uuid": "99e50ff7-22ae-4afc-af83-e81b69c73931" - } - ] - }, - "56": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", - "errors": null, - "id": 56, - "input_connections": { - "input_bams": { - "id": 50, - "output_name": "data_param" - } - }, - "inputs": [], - "label": null, - "name": "Samtools depth", - "outputs": [ - { - "name": "output", - "type": "tabular" - } - ], - "position": { - "left": 3270.6159423253503, - "top": 2206.55560224621 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", - "tool_shed_repository": { - "changeset_revision": "fb6d5ffc365f", - "name": "samtools_depth", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"additional_options\": {\"required_flags\": null, \"skipped_flags\": [\"4\", \"256\", \"512\", \"1024\"], \"deletions\": false, \"single_read\": false}, \"all\": \"-a\", \"basequality\": null, \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"mapquality\": null, \"maxdepth\": null, \"minlength\": null, \"output_options\": {\"header\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy1", - "type": "tool", - "uuid": "75e128e1-596f-4804-9d3d-2788ee7bf5b3", - "when": null, - "workflow_outputs": [] - }, - "57": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 57, - "input_connections": { - "input_param_type|input_param": { - "id": 53, - "output_name": "text_param" - } - }, - "inputs": [], - "label": "False if Q telomere track is empty", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 3459.9078024663245, - "top": 1351.4977300677754 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "3de1eefb-971f-4e56-9dd4-da995d9facc8", - "when": null, - "workflow_outputs": [] - }, - "58": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 58, - "input_connections": { - "input_param_type|input_param": { - "id": 54, - "output_name": "text_param" - } - }, - "inputs": [], - "label": "False if P telomere track is empty", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 3464.3675577025474, - "top": 1561.2479958064835 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "2ddee770-02bd-4e81-bb00-491a92b06dc1", - "when": null, - "workflow_outputs": [] - }, - "59": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "errors": null, - "id": 59, - "input_connections": { - "input": { - "id": 55, - "output_name": "outFileName" + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 14, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 12, + "output_name": "mashout" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 8, + "output_name": "mashout" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1705.5894014018074, + "top": 917.0710444155519 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Haplotype 2" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "b5f42764-7e45-47df-9e96-cd6e05861527", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "id": 15, + "input_connections": { + "Coverage": { + "id": 7, + "input_subworkflow_step_id": 8, + "output_name": "output" + }, + "Gaps": { + "id": 6, + "input_subworkflow_step_id": 7, + "output_name": "output" + }, + "Hap1 fasta": { + "id": 0, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Hap1 vs Species": { + "id": 13, + "input_subworkflow_step_id": 4, + "output_name": "data_param" + }, + "Hap2 fasta": { + "id": 1, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Related Species": { + "id": 9, + "input_subworkflow_step_id": 2, + "output_name": "data_param" + }, + "Species vs Hap2": { + "id": 14, + "input_subworkflow_step_id": 3, + "output_name": "data_param" + }, + "Telomeres P": { + "id": 5, + "input_subworkflow_step_id": 6, + "output_name": "output" + }, + "Telomeres Q": { + "id": 4, + "input_subworkflow_step_id": 5, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Jbrowse2 for 1 related species", + "outputs": [], + "position": { + "left": 2292.870790775461, + "top": 1001.1439041017042 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Jbrowse2 for 1 related species", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1 fasta" + } + ], + "label": "Hap1 fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 271.13908772215916 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap2 fasta" + } + ], + "label": "Hap2 fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 53.14881800970572, + "top": 420.7641795440555 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "177f6825-e58e-45e9-a3fc-8c7623187e02", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Related Species" + } + ], + "label": "Related Species", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 98.91709918730632, + "top": 553.1054764799819 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "604a6bec-8c1f-47e3-8884-c32f63246589", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Species vs Hap2" + } + ], + "label": "Species vs Hap2", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 147.9198303415696, + "top": 670.2931389328182 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"paf\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ebdc47b3-16f5-48e9-a101-c82b2370181a", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1 vs Species" + } + ], + "label": "Hap1 vs Species", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 175.64670268098203, + "top": 777.2105888619357 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"paf\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "385825a9-198e-425f-9fb3-55af892d20dc", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres Q" + } + ], + "label": "Telomeres Q", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 206.21568172170709, + "top": 895.0983900914266 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomeres P" + } + ], + "label": "Telomeres P", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 274.77222990165984, + "top": 1069.4502766623036 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Gaps" + } + ], + "label": "Gaps", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 353.8919295731858, + "top": 1244.9653893778952 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Coverage" + } + ], + "label": "Coverage", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 391.49614814580605, + "top": 1410.3962329181184 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "2131fd1e-4f34-4662-be5c-382101fcbc76", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "errors": null, + "id": 9, + "input_connections": { + "assemblies_0|reference_genome|genome": { + "id": 0, + "output_name": "output" + }, + "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 4, + "output_name": "output" + }, + "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 5, + "output_name": "output" + }, + "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 6, + "output_name": "output" + }, + "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 7, + "output_name": "output" + }, + "assemblies_0|track_groups_3|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 8, + "output_name": "output" + }, + "assemblies_1|reference_genome|genome": { + "id": 2, + "output_name": "output" + }, + "assemblies_1|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 3, + "output_name": "output" + }, + "assemblies_2|reference_genome|genome": { + "id": 1, + "output_name": "output" + }, + "assemblies_2|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 5, + "output_name": "output" + }, + "assemblies_2|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 6, + "output_name": "output" + }, + "assemblies_2|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 7, + "output_name": "output" + }, + "assemblies_2|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": "JBrowse2 Hap1 and hap2 with 1st related species", + "name": "JBrowse2", + "outputs": [ + { + "name": "output", + "type": "html" + } + ], + "position": { + "left": 1960.7191746063156, + "top": 0 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "JBrowse2 Hap1 and hap2 with related species" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd903fbbc26e", + "name": "jbrowse2", + "owner": "fubar", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Telomeres Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 3, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny Hap2\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 2, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Telomeres Haplotype 2\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.7.0+galaxy0", + "type": "tool", + "uuid": "0dba1c5e-903c-46f3-a58c-2b9341b92a15", + "when": null, + "workflow_outputs": [ + { + "label": "JBrowse2 Hap1 and hap2 with related species", + "output_name": "output", + "uuid": "ce6026de-ad8b-4dec-8926-fccc97f25df6" + } + ] + } + }, + "tags": [], + "uuid": "33815832-0a6d-4939-a521-99df7c0ecc72" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "e134915a-f5b7-4b32-a511-921e0b363bff", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "JBrowse2 Hap1 and hap2 with related species", + "output_name": "JBrowse2 Hap1 and hap2 with related species", + "uuid": "7562c81f-4b86-4932-8056-52f4dc17d2a9" + } + ] + } }, - "pretext": { - "id": 37, - "output_name": "pretext_map_out" - } + "tags": [], + "uuid": "6eaa2fd3-4247-45c6-8858-492b7b5929d4" }, - "inputs": [], - "label": "Add Coverage Track - Multimapping", - "name": "Pretextgraph", - "outputs": [ + "tool_id": null, + "type": "subworkflow", + "uuid": "af188630-081d-489b-b46f-eae324b3df01", + "when": "$(inputs.when)", + "workflow_outputs": [ { - "name": "graph_out", - "type": "pretext" - } - ], - "position": { - "left": 4314.893682463086, - "top": 618.766281070267 - }, - "post_job_actions": { - "HideDatasetActiongraph_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "graph_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "tool_shed_repository": { - "changeset_revision": "8e422c873d02", - "name": "pretext_graph", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.9+galaxy0", - "type": "tool", - "uuid": "fd4f30e5-128b-4a4d-b9f6-2239323f99da", - "when": null, - "workflow_outputs": [] - }, - "60": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "errors": null, - "id": 60, - "input_connections": { - "input": { - "id": 55, - "output_name": "outFileName" + "label": "JBrowse2 Hap1 vs Hap2 with no related species", + "output_name": "JBrowse2 Hap1 vs Hap2 with no related species", + "uuid": "e237f77b-a125-413e-b442-ecaa029c07dc" }, - "pretext": { - "id": 36, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": "Add Coverage Track", - "name": "Pretextgraph", - "outputs": [ { - "name": "graph_out", - "type": "pretext" - } - ], - "position": { - "left": 4200.272826576246, - "top": 1518.2005106436195 - }, - "post_job_actions": { - "HideDatasetActiongraph_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "graph_out" + "label": "JBrowse2 Hap1 and hap2 with related species", + "output_name": "JBrowse2 Hap1 and hap2 with related species", + "uuid": "6861e850-7a02-47cf-aab2-4093019878e9" } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "tool_shed_repository": { - "changeset_revision": "8e422c873d02", - "name": "pretext_graph", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.9+galaxy0", - "type": "tool", - "uuid": "68583f52-0bd8-41b4-8f10-0bd0ed274177", - "when": null, - "workflow_outputs": [] + ] }, - "61": { + "68": { "annotation": "", "content_id": "Filter1", "errors": null, - "id": 61, + "id": 68, "input_connections": { "input": { - "id": 56, + "id": 61, "output_name": "output" } }, @@ -6443,8 +9177,8 @@ } ], "position": { - "left": 3507.5000610351562, - "top": 2187.0499267578125 + "left": 3501.703996641955, + "top": 2151.1234876899525 }, "post_job_actions": {}, "tool_id": "Filter1", @@ -6456,22 +9190,22 @@ "when": null, "workflow_outputs": [] }, - "62": { + "69": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 62, + "id": 69, "input_connections": { "input": { - "id": 48, + "id": 53, "output_name": "out_file1" }, "pretext": { - "id": 59, + "id": 65, "output_name": "graph_out" }, "when": { - "id": 58, + "id": 63, "output_name": "output_param_boolean" } }, @@ -6510,22 +9244,22 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "63": { + "70": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 63, + "id": 70, "input_connections": { "input": { - "id": 48, + "id": 53, "output_name": "out_file1" }, "pretext": { - "id": 60, + "id": 66, "output_name": "graph_out" }, "when": { - "id": 58, + "id": 63, "output_name": "output_param_boolean" } }, @@ -6564,14 +9298,14 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "64": { + "71": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "errors": null, - "id": 64, + "id": 71, "input_connections": { "input": { - "id": 61, + "id": 68, "output_name": "out_file1" } }, @@ -6589,33 +9323,33 @@ "top": 1950 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "tool_shed_repository": { - "changeset_revision": "aff5135563c6", + "changeset_revision": "61f9ddbc63ca", "name": "column_maker", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"c2-1\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.1", + "tool_version": "2.1+galaxy0", "type": "tool", "uuid": "28ba3827-13c9-431f-b02c-01904a6f0577", "when": null, "workflow_outputs": [] }, - "65": { + "72": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 65, + "id": 72, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 62, + "id": 69, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 59, + "id": 65, "output_name": "graph_out" } }, @@ -6654,18 +9388,18 @@ "when": null, "workflow_outputs": [] }, - "66": { + "73": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 66, + "id": 73, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 63, + "id": 70, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 60, + "id": 66, "output_name": "graph_out" } }, @@ -6704,14 +9438,14 @@ "when": null, "workflow_outputs": [] }, - "67": { + "74": { "annotation": "", "content_id": "Cut1", "errors": null, - "id": 67, + "id": 74, "input_connections": { "input": { - "id": 64, + "id": 71, "output_name": "out_file1" } }, @@ -6746,22 +9480,22 @@ "when": null, "workflow_outputs": [] }, - "68": { + "75": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 68, + "id": 75, "input_connections": { "input": { - "id": 47, + "id": 52, "output_name": "out_file1" }, "pretext": { - "id": 65, + "id": 72, "output_name": "data_param" }, "when": { - "id": 57, + "id": 62, "output_name": "output_param_boolean" } }, @@ -6800,22 +9534,22 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "69": { + "76": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 69, + "id": 76, "input_connections": { "input": { - "id": 47, + "id": 52, "output_name": "out_file1" }, "pretext": { - "id": 66, + "id": 73, "output_name": "data_param" }, "when": { - "id": 57, + "id": 62, "output_name": "output_param_boolean" } }, @@ -6854,14 +9588,14 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "70": { + "77": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", "errors": null, - "id": 70, + "id": 77, "input_connections": { "input": { - "id": 67, + "id": 74, "output_name": "out_file1" } }, @@ -6894,18 +9628,18 @@ "when": null, "workflow_outputs": [] }, - "71": { + "78": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 71, + "id": 78, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 68, + "id": 75, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 65, + "id": 72, "output_name": "data_param" } }, @@ -6944,18 +9678,18 @@ "when": null, "workflow_outputs": [] }, - "72": { + "79": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 72, + "id": 79, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 69, + "id": 76, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 66, + "id": 73, "output_name": "data_param" } }, @@ -6994,14 +9728,14 @@ "when": null, "workflow_outputs": [] }, - "73": { + "80": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, - "id": 73, + "id": 80, "input_connections": { "input": { - "id": 70, + "id": 77, "output_name": "output" } }, @@ -7062,18 +9796,18 @@ } ] }, - "74": { + "81": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 74, + "id": 81, "input_connections": { "input": { - "id": 42, + "id": 46, "output_name": "out_file1" }, "pretext": { - "id": 71, + "id": 78, "output_name": "data_param" } }, @@ -7112,18 +9846,18 @@ "when": null, "workflow_outputs": [] }, - "75": { + "82": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 75, + "id": 82, "input_connections": { "input": { - "id": 42, + "id": 46, "output_name": "out_file1" }, "pretext": { - "id": 72, + "id": 79, "output_name": "data_param" } }, @@ -7162,18 +9896,18 @@ "when": null, "workflow_outputs": [] }, - "76": { + "83": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 76, + "id": 83, "input_connections": { "input": { - "id": 73, + "id": 80, "output_name": "out_file1" }, "pretext": { - "id": 74, + "id": 81, "output_name": "graph_out" } }, @@ -7212,18 +9946,18 @@ "when": null, "workflow_outputs": [] }, - "77": { + "84": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 77, + "id": 84, "input_connections": { "input": { - "id": 73, + "id": 80, "output_name": "out_file1" }, "pretext": { - "id": 75, + "id": 82, "output_name": "graph_out" } }, @@ -7269,18 +10003,18 @@ "when": null, "workflow_outputs": [] }, - "78": { + "85": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 78, + "id": 85, "input_connections": { "input": { - "id": 49, + "id": 54, "output_name": "data_param" }, "pretext": { - "id": 76, + "id": 83, "output_name": "graph_out" }, "when": { @@ -7323,18 +10057,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "79": { + "86": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 79, + "id": 86, "input_connections": { "input": { - "id": 49, + "id": 54, "output_name": "data_param" }, "pretext": { - "id": 77, + "id": 84, "output_name": "graph_out" }, "when": { @@ -7377,18 +10111,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "80": { + "87": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 80, + "id": 87, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 78, + "id": 85, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 76, + "id": 83, "output_name": "graph_out" } }, @@ -7442,18 +10176,18 @@ } ] }, - "81": { + "88": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 81, + "id": 88, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 79, + "id": 86, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 77, + "id": 84, "output_name": "graph_out" } }, @@ -7509,7 +10243,6 @@ } }, "tags": [], - "uuid": "51640fb0-0e97-4a6b-baf6-234fc13400ba", - "version": 2, - "release": "2.3" + "uuid": "fad73f97-70b3-4dc8-8d70-e03cd132f6c5", + "version": 12 } From f9e8e7500fa926881076d3e21202f337b03d01bf Mon Sep 17 00:00:00 2001 From: Delphine-L Date: Mon, 18 May 2026 11:26:14 -0400 Subject: [PATCH 2/3] remove jbrowse and pairtool stats --- .../CHANGELOG.md | 15 +- .../README.md | 111 +- ...map-for-assembly-manual-curation-tests.yml | 69 +- .../hi-c-map-for-assembly-manual-curation.ga | 14053 +++++++--------- 4 files changed, 6568 insertions(+), 7680 deletions(-) diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md index 60d40f7142..6d40add349 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md @@ -1,10 +1,19 @@ # Changelog -## [3.0] - 2026-04-29 +## [2.5] - 2026-05-14 ### Added -- Now use BWA-MEM for large genomes (>10Gb) instead of BWA-MEM2 like smaller genomes. New input `Estimated Genome Size` to drive the aligner selection. -- Now generate JBrowse2 instances with Mashmap alignments and tracks for both haplotypes, and optionaly with a collection of closely related species. +- BWA-MEM is now used for large genomes (>10 Gb) instead of BWA-MEM2 used for smaller genomes. +- New input `Estimated Genome Size` (single-value file with the estimated genome size in bp) drives the BWA-MEM vs BWA-MEM2 aligner selection. + +### Removed +- Input `Will you use a second haplotype?` — the workflow now infers single- vs two-haplotype mode from whether `Haplotype 2` is provided. +- Output `Both Haplotypes merged` (no longer surfaced; merge happens internally). +- Outputs `Hi-C duplication stats on Scaffolds: MultiQc` and `Hi-C duplication stats on Scaffolds: Raw` (MultiQC step removed; the plain `Hi-C duplication stats on Scaffolds` output is retained). +- Outputs `Pairtools Multiqc Stats on Scaffolds` and `Pairtools MultiQc on Scaffolds: Plots`. + +### Note +- RefSeq-based related-species detection and JBrowse2 visualization have been moved to a separate workflow. ## [2.4] - 2026-04-29 diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md index 54f00554f1..5e4d840b42 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md @@ -13,53 +13,47 @@ The Pretext files can be opened in PretextView for manual curation of genome ass ### Required Inputs 1. **Haplotype 1** [fasta] - Primary haplotype assembly -2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies -3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes) -4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data -5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads -6. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10G +2. **Haplotype 2** [fasta] - Secondary haplotype assembly (leave unset for single-haplotype mode) +3. **Hi-C reads** [list:paired collection, fastq] - Paired collection containing Hi-C data +4. **PacBio reads** [list collection, fastq.gz] - Collection of PacBio HiFi reads +5. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10 Gb ### Assembly Annotation Parameters -7. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues) -8. **Species Name** [text] - Species identifier for gene annotation -9. **Assembly Name** [text] - Assembly identifier (e.g., toLid) -10. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10) -11. **Database for Compleasm** [text] - Compleasm database version (default: v5) +6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues) +7. **Species Name** [text] - Species identifier for gene annotation +8. **Assembly Name** [text] - Assembly identifier (e.g., toLid) +9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10) +10. **Database for Compleasm** [text] - Compleasm database version (default: v5) ### Scaffold Naming Options -12. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information -13. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1) -14. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2) +11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information +12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1) +13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2) ### Hi-C Processing Options -15. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks "noisy") -16. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup -17. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads) +14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks "noisy") +15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup +16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads) ### PacBio Processing Options -18. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt +17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt ### Telomere Detection -19. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement) -20. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA) +18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement) +19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA) ### Hi-C Map Resolution -21. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources) +20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources) ### Visualization Options -22. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution) - -### JBrowse2 Related Species - -23. **Use related species** [boolean] - Include related-species assemblies as additional tracks/alignments in the JBrowse2 instance -24. **Related Species** [fasta.gz collection] - Collection of related-species assemblies (gzipped FASTA) to align against the assembled haplotypes for JBrowse2 visualization +21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution) ## Outputs @@ -67,50 +61,42 @@ The Pretext files can be opened in PretextView for manual curation of genome ass 1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix 2. **Assembly Info** [tabular] - Summary statistics from gfastats -3. **Both Haplotypes merged** [fasta] - Concatenated assembly file +3. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied +4. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied ### Gene Annotation Outputs -4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled) +5. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled) ### Hi-C Alignment Outputs -5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments -6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering -7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled) -8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled) -9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled) -10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled) -11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics -12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots +6. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments +7. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering +8. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled) +9. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled) ### PacBio Processing Outputs -13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled) -14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled) +10. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled) +11. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled) ### PacBio Coverage Outputs -15. **BigWig Coverage** [bigwig] - PacBio read coverage track -16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage -17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments +12. **BigWig Coverage** [bigwig] - PacBio read coverage track +13. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage +14. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments ### Telomere Outputs -18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope -19. **terminal telomeres** [bedgraph] - All detected telomeric regions -20. **P telomeres bed** [BED] - P-arm (5') telomeres only -21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only +15. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope +16. **terminal telomeres** [bedgraph] - All detected telomeric regions +17. **P telomeres bed** [BED] - P-arm (5') telomeres only +18. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only ### Gap Outputs -22. **Gaps Bed** [BED] - Assembly gap coordinates -23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext - -### Assembly Haplotype Outputs - -24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied -25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied +19. **Gaps Bed** [BED] - Assembly gap coordinates +20. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext ### Pretext Map Outputs @@ -118,23 +104,10 @@ All Pretext outputs are generated in two versions: - **With MAPQ filtering** (default MAPQ ≥ 10): Cleaner maps with high-confidence contacts - **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments -26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered) -27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered) -28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered) -29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered) - -### Haplotype Alignment Outputs - -30. **Alignments** [PAF] - Haplotype-vs-haplotype (and, if enabled, vs related-species) alignments produced by mashmap, used as JBrowse2 synteny tracks - -### JBrowse2 Outputs - -Generated depending on whether one or two haplotypes are provided and whether related species are included: - -31. **JBrowse2 Single Haplotype** [JBrowse2] - JBrowse2 instance for a single-haplotype assembly -32. **JBrowse2 Single Haplotype with related species** [JBrowse2] - Single-haplotype JBrowse2 instance with related-species alignment tracks -33. **JBrowse2 Hap1 vs Hap2 with no related species** [JBrowse2] - Diploid JBrowse2 instance with Hap1↔Hap2 alignments -34. **JBrowse2 Hap1 and hap2 with related species** [JBrowse2] - Diploid JBrowse2 instance including related-species alignments +21. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered) +22. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered) +23. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered) +24. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered) ## Usage Notes diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml index 272e413556..5d30cba696 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml @@ -1,8 +1,8 @@ # Planemo test configuration for Hi-C contact map workflow -# Test 1: Single read set per technology (no collections) -# Test 2: Multiple read sets with collections +# Test 1: Diploid (two haplotypes), single read set per technology +# Test 2: Single haplotype, multiple read sets with collections -- doc: Test 1 - Single read set per technology +- doc: Test 1 - Diploid, single read set per technology job: Haplotype 1: class: File @@ -49,7 +49,6 @@ - hash_function: SHA-1 hash_value: 84fe8fad10155f9edd1365ba13bb5f30f0d1d881 Do you want to add suffixes to the scaffold names?: true - Will you use a second haplotype?: true First Haplotype suffix: H1 Second Haplotype suffix: H2 Do you want to trim the Hi-C data?: false @@ -62,26 +61,13 @@ Species Name: Test_species Assembly Name: toLid Lineage for Compleasm: vertebrata_odb10 - Database for Compleasm: v5 - Generate gene annotations: True + Database for Compleasm: v5 + Generate gene annotations: true Generate high resolution Hi-C maps: false Estimated Genome Size: class: File location: https://zenodo.org/records/19925237/files/real_size.txt filetype: txt - Use related species: true - Related Species: - class: Collection - collection_type: list - elements: - - class: File - identifier: hap1 - location: https://zenodo.org/records/19925237/files/hap1.fasta.gz - filetype: fasta.gz - - class: File - identifier: hap2 - location: https://zenodo.org/records/19925237/files/hap2.fasta.gz - filetype: fasta.gz outputs: Assembly for curation: asserts: @@ -120,10 +106,6 @@ has_size: value: 800000 delta: 400000 - "Hi-C duplication stats on Scaffolds: Raw": - asserts: - has_text: - text: "total_dups\t3941" Precuration Hi-C alignments: asserts: has_size: @@ -137,7 +119,7 @@ asserts: has_text: text: "scaffold_1.H2\t106669\t106765" -- doc: Test 2 - Multiple read sets with collections +- doc: Test 2 - Single haplotype, multiple read sets with collections job: Haplotype 1: class: File @@ -146,13 +128,6 @@ hashes: - hash_function: SHA-1 hash_value: a0ee25fd9f7cf223ca40ff530e1201589fade212 - Haplotype 2: - class: File - location: https://zenodo.org/records/18664706/files/Haplotype_2.fasta - filetype: fasta - hashes: - - hash_function: SHA-1 - hash_value: 166cb118625113e39593bedb10aaea028c20f77d Hi-C reads: class: Collection collection_type: list:paired @@ -206,7 +181,6 @@ - hash_function: SHA-1 hash_value: f0408118bf8d116d0d560d2899fc4861c930c067 Do you want to add suffixes to the scaffold names?: true - Will you use a second haplotype?: false First Haplotype suffix: H1 Second Haplotype suffix: H2 Do you want to trim the Hi-C data?: false @@ -226,19 +200,6 @@ class: File location: https://zenodo.org/records/19925237/files/large_size.txt filetype: txt - Use related species: true - Related Species: - class: Collection - collection_type: list - elements: - - class: File - identifier: hap1 - location: https://zenodo.org/records/19925237/files/hap1.fasta.gz - filetype: fasta.gz - - class: File - identifier: hap2 - location: https://zenodo.org/records/19925237/files/hap2.fasta.gz - filetype: fasta.gz outputs: Assembly for curation: asserts: @@ -261,15 +222,11 @@ has_size: value: 7000 delta: 2000 - P telomeres bed: - asserts: - has_text: - text: "scaffold_1.H1" - Merged Hi-C Alignments on Scaffolds: + Precuration Hi-C alignments: asserts: has_size: - value: 15000000 - delta: 6000000 + value: 12805288 + delta: 2000000 Pretext All tracks: asserts: has_size: @@ -280,15 +237,7 @@ has_size: value: 940000 delta: 200000 - "Hi-C duplication stats on Scaffolds: Raw": - asserts: - has_text: - text: "total_dups\t1936\t1313" P telomeres bed: asserts: has_text: text: "scaffold_1.H1\t488600\t500600\t12000" - Hi-C duplication stats on Scaffolds: - asserts: - has_text: - text: "EXCLUDED: 48407" diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga index 625b8ef002..35f589f71b 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga @@ -4,98 +4,38 @@ "comments": [ { "child_steps": [ - 36, - 46 - ], - "color": "yellow", - "data": { - "title": "Trim and align Hi-C reads" - }, - "id": 1, - "position": [ - 1355.2, - 1286.1 - ], - "size": [ - 910, - 990 - ], - "type": "frame" - }, - { - "child_steps": [ - 27, - 30, - 35, - 49 - ], - "color": "turquoise", - "data": { - "title": "Egapx Annotations" - }, - "id": 2, - "position": [ - 2146.7, - 186.9 - ], - "size": [ - 1878, - 674 - ], - "type": "frame" - }, - { - "child_steps": [ - 58, - 35, - 59, - 44, + 37, + 38, 45, - 52, - 53, + 51, + 59, 62, - 63 - ], - "color": "lime", - "data": { - "title": "Telomeres" - }, - "id": 3, - "position": [ - 2351.5, - 1205.8 - ], - "size": [ - 1479, - 607 - ], - "type": "frame" - }, - { - "child_steps": [ - 30, - 33, - 39, - 54 + 65, + 68, + 71, + 74, + 76, + 78, + 80 ], - "color": "turquoise", + "color": "none", "data": { - "title": "Egapx Annotations" + "title": "Generate Pretext Maps and Tracks - Multimapping" }, - "id": 2, + "id": 7, "position": [ - 2146.7, - 186.9 + 4041, + 202.3 ], "size": [ - 1878, - 674 + 2729, + 780 ], "type": "frame" }, { "child_steps": [ - 34 + 31 ], "color": "yellow", "data": { @@ -114,10 +54,19 @@ }, { "child_steps": [ - 25, - 26, - 29, - 32 + 36, + 39, + 46, + 52, + 60, + 63, + 66, + 69, + 72, + 75, + 77, + 79, + 81 ], "color": "orange", "data": { @@ -136,17 +85,17 @@ }, { "child_steps": [ - 38, - 48, - 49, + 34, + 43, + 44, + 50, 55, - 60, - 74, - 80, + 56, 61, - 68, - 71, - 77 + 64, + 67, + 70, + 73 ], "color": "green", "data": { @@ -165,63 +114,91 @@ }, { "child_steps": [ - 41, - 42, - 50, - 56, - 65, - 69, - 72, - 75, - 78, - 81, - 83, - 85, - 87 + 25, + 26, + 28, + 29 ], - "color": "none", + "color": "blue", "data": { - "title": "Generate Pretext Maps and Tracks - Multimapping" + "title": "Merge Haplotypes" }, - "id": 7, + "id": 0, "position": [ - 4041, - 202.3 + 614.0963016672636, + 455.7465102395287 ], "size": [ - 2729, - 780 + 1283, + 769 + ], + "type": "frame" + }, + { + "child_steps": [ + 33, + 42 + ], + "color": "red", + "data": { + "title": "Gaps" + }, + "id": 4, + "position": [ + 2767.1, + 944.3 + ], + "size": [ + 542, + 213 ], "type": "frame" }, { "child_steps": [ + 32, 40, - 43, - 51, + 41, + 47, + 48, + 53, + 54, 57, - 66, - 70, - 73, - 76, - 79, - 82, - 84, - 86, - 88 + 58 ], - "color": "orange", + "color": "lime", "data": { - "title": "Add tracks to the Hi-C map - MAPQ filtering" + "title": "Telomeres" }, - "id": 6, + "id": 3, "position": [ - 3899.8, - 1046.6 + 2351.5, + 1205.8 ], "size": [ - 2787, - 772 + 1479, + 607 + ], + "type": "frame" + }, + { + "child_steps": [ + 30, + 35, + 49 + ], + "color": "turquoise", + "data": { + "title": "Egapx Annotations" + }, + "id": 2, + "position": [ + 2146.7, + 186.9 + ], + "size": [ + 1878, + 674 ], "type": "frame" } @@ -240,9 +217,9 @@ ], "format-version": "0.1", "license": "MIT", - "release": "3.0", - "name": "PretextMap Generation from 1 or 2 haplotypes with Jbrowse", - "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies\n3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes)\n4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data\n5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads\n6. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10G\n\n### Assembly Annotation Parameters\n\n7. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n8. **Species Name** [text] - Species identifier for gene annotation\n9. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n10. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n11. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n12. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n13. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n14. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n15. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n16. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n17. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n18. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n19. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n20. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n21. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n22. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n### JBrowse2 Related Species\n\n23. **Use related species** [boolean] - Include related-species assemblies as additional tracks/alignments in the JBrowse2 instance\n24. **Related Species** [fasta.gz collection] - Collection of related-species assemblies (gzipped FASTA) to align against the assembled haplotypes for JBrowse2 visualization\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Both Haplotypes merged** [fasta] - Concatenated assembly file\n\n### Gene Annotation Outputs\n\n4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled)\n10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled)\n11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics\n12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots\n\n### PacBio Processing Outputs\n\n13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n15. **BigWig Coverage** [bigwig] - PacBio read coverage track\n16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n19. **terminal telomeres** [bedgraph] - All detected telomeric regions\n20. **P telomeres bed** [BED] - P-arm (5') telomeres only\n21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n22. **Gaps Bed** [BED] - Assembly gap coordinates\n23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Assembly Haplotype Outputs\n\n24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n### Haplotype Alignment Outputs\n\n30. **Alignments** [PAF] - Haplotype-vs-haplotype (and, if enabled, vs related-species) alignments produced by mashmap, used as JBrowse2 synteny tracks\n\n### JBrowse2 Outputs\n\nGenerated depending on whether one or two haplotypes are provided and whether related species are included:\n\n31. **JBrowse2 Single Haplotype** [JBrowse2] - JBrowse2 instance for a single-haplotype assembly\n32. **JBrowse2 Single Haplotype with related species** [JBrowse2] - Single-haplotype JBrowse2 instance with related-species alignment tracks\n33. **JBrowse2 Hap1 vs Hap2 with no related species** [JBrowse2] - Diploid JBrowse2 instance with Hap1\u2194Hap2 alignments\n34. **JBrowse2 Hap1 and hap2 with related species** [JBrowse2] - Diploid JBrowse2 instance including related-species alignments\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", + "release": "2.5", + "name": "PretextMap Generation from 1 or 2 haplotypes", + "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Haplotype 2** [fasta] - Secondary haplotype assembly (leave unset for single-haplotype mode)\n3. **Hi-C reads** [list:paired collection, fastq] - Paired collection containing Hi-C data\n4. **PacBio reads** [list collection, fastq.gz] - Collection of PacBio HiFi reads\n5. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10 Gb\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n4. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Gene Annotation Outputs\n\n5. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n6. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n7. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n8. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n9. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n\n### PacBio Processing Outputs\n\n10. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n11. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n12. **BigWig Coverage** [bigwig] - PacBio read coverage track\n13. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n14. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n15. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n16. **terminal telomeres** [bedgraph] - All detected telomeric regions\n17. **P telomeres bed** [BED] - P-arm (5') telomeres only\n18. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n19. **Gaps Bed** [BED] - Assembly gap coordinates\n20. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n21. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n22. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n23. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n24. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", "report": { "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nSamtools markdup deduplication stats (if applicable)\n\n\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats\")\n```\n\n\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n## Telomere report\n\n```galaxy\nhistory_dataset_embedded(output=\"Telomere Report\")\n```\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n" }, @@ -410,41 +387,14 @@ "workflow_outputs": [] }, "6": { - "annotation": "", + "annotation": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", "content_id": null, "errors": null, "id": 6, "input_connections": {}, "inputs": [ { - "description": "", - "name": "Will you use a second haplotype?" - } - ], - "label": "Will you use a second haplotype?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 177.91069036144182, - "top": 552.7194916173363 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "697b66dc-1c0f-40d7-9d03-51318db580f1", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "content_id": null, - "errors": null, - "id": 7, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", + "description": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", "name": "Haplotype 2" } ], @@ -452,26 +402,26 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 211.05802737880668, - "top": 645.1671481947981 + "left": 179.61743677279702, + "top": 607.2173235305654 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_state": "{\"optional\": true, \"format\": [\"fasta\"], \"tag\": null}", "tool_version": null, "type": "data_input", "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", "when": null, "workflow_outputs": [] }, - "8": { - "annotation": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names. ", + "7": { + "annotation": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names.", "content_id": null, "errors": null, - "id": 8, + "id": 7, "input_connections": {}, "inputs": [ { - "description": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names. ", + "description": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names.", "name": "Do you want to add suffixes to the scaffold names?" } ], @@ -490,11 +440,11 @@ "when": null, "workflow_outputs": [] }, - "9": { + "8": { "annotation": "Suffix added to scaffolds belonging to haplotype 1.", "content_id": null, "errors": null, - "id": 9, + "id": 8, "input_connections": {}, "inputs": [ { @@ -517,11 +467,11 @@ "when": null, "workflow_outputs": [] }, - "10": { + "9": { "annotation": "Suffix added to contigs belonging to haplotype 2.", "content_id": null, "errors": null, - "id": 10, + "id": 9, "input_connections": {}, "inputs": [ { @@ -544,11 +494,11 @@ "when": null, "workflow_outputs": [] }, - "11": { + "10": { "annotation": "", "content_id": null, "errors": null, - "id": 11, + "id": 10, "input_connections": {}, "inputs": [ { @@ -571,15 +521,15 @@ "when": null, "workflow_outputs": [] }, - "12": { - "annotation": "Paired Collection containing the Hi-C reads. ", + "11": { + "annotation": "Paired Collection containing the Hi-C reads.", "content_id": null, "errors": null, - "id": 12, + "id": 11, "input_connections": {}, "inputs": [ { - "description": "Paired Collection containing the Hi-C reads. ", + "description": "Paired Collection containing the Hi-C reads.", "name": "Hi-C reads" } ], @@ -598,11 +548,11 @@ "when": null, "workflow_outputs": [] }, - "13": { + "12": { "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", "content_id": null, "errors": null, - "id": 13, + "id": 12, "input_connections": {}, "inputs": [ { @@ -625,11 +575,11 @@ "when": null, "workflow_outputs": [] }, - "14": { + "13": { "annotation": "", "content_id": null, "errors": null, - "id": 14, + "id": 13, "input_connections": {}, "inputs": [ { @@ -652,11 +602,11 @@ "when": null, "workflow_outputs": [] }, - "15": { + "14": { "annotation": "", "content_id": null, "errors": null, - "id": 15, + "id": 14, "input_connections": {}, "inputs": [ { @@ -679,11 +629,11 @@ "when": null, "workflow_outputs": [] }, - "16": { + "15": { "annotation": "", "content_id": null, "errors": null, - "id": 16, + "id": 15, "input_connections": {}, "inputs": [ { @@ -695,8 +645,8 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 617.3841281567144, - "top": 1637.47572935952 + "left": 645.7789702864719, + "top": 1626.4606184667707 }, "tool_id": null, "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", @@ -706,24 +656,24 @@ "when": null, "workflow_outputs": [] }, - "17": { - "annotation": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", + "16": { + "annotation": "Select no if you are using the HiFi reads trimmed in the contigging workflow.", "content_id": null, "errors": null, - "id": 17, + "id": 16, "input_connections": {}, "inputs": [ { - "description": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", - "name": "Remove adapters from HiFi reads? " + "description": "Select no if you are using the HiFi reads trimmed in the contigging workflow.", + "name": "Remove adapters from HiFi reads?" } ], - "label": "Remove adapters from HiFi reads? ", + "label": "Remove adapters from HiFi reads?", "name": "Input parameter", "outputs": [], "position": { - "left": 680.7574861270211, - "top": 1727.813504185769 + "left": 730.7283945923052, + "top": 1732.6631706036512 }, "tool_id": null, "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -733,15 +683,15 @@ "when": null, "workflow_outputs": [] }, - "18": { - "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", + "17": { + "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10", "content_id": null, "errors": null, - "id": 18, + "id": 17, "input_connections": {}, "inputs": [ { - "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", + "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10", "name": "Minimum Mapping Quality" } ], @@ -749,8 +699,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 725.2889578302385, - "top": 1878.340368072226 + "left": 805.7082339380294, + "top": 1849.862987150992 }, "tool_id": null, "tool_state": "{\"default\": 10, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", @@ -760,11 +710,11 @@ "when": null, "workflow_outputs": [] }, - "19": { + "18": { "annotation": "The default value is set for vertebrate genomes (TTAGGG).", "content_id": null, "errors": null, - "id": 19, + "id": 18, "input_connections": {}, "inputs": [ { @@ -776,8 +726,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 804.0066731853753, - "top": 1998.3984749564324 + "left": 878.5328327241879, + "top": 1973.0183944928635 }, "tool_id": null, "tool_state": "{\"default\": \"TTAGGG\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -787,11 +737,11 @@ "when": null, "workflow_outputs": [] }, - "20": { + "19": { "annotation": "The default value is set for vertebrate genomes (TTAGGG,CCCTAA).", "content_id": null, "errors": null, - "id": 20, + "id": 19, "input_connections": {}, "inputs": [ { @@ -803,8 +753,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 874.8796235729197, - "top": 2111.9812018516664 + "left": 931.936764907464, + "top": 2086.681078353303 }, "tool_id": null, "tool_state": "{\"default\": \"TTAGGG,CCCTAA\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -814,11 +764,11 @@ "when": null, "workflow_outputs": [] }, - "21": { + "20": { "annotation": "", "content_id": null, "errors": null, - "id": 21, + "id": 20, "input_connections": {}, "inputs": [ { @@ -830,8 +780,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 973.5695727424196, - "top": 2248.9311570455247 + "left": 1033.872166938985, + "top": 2218.2288951963906 }, "tool_id": null, "tool_state": "{\"default\": 100, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", @@ -841,65 +791,11 @@ "when": null, "workflow_outputs": [] }, - "22": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 22, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Use related species" - } - ], - "label": "Use related species", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 1083.9181754454255, - "top": 2370.0425200786585 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "f31dfe7a-73ec-4ff6-b790-f8e267bb9a31", - "when": null, - "workflow_outputs": [] - }, - "23": { - "annotation": "Note: Duplicated sequence names between the species in the collection will cause inaccurate alignment visualization in JBrowse2. ", - "content_id": null, - "errors": null, - "id": 23, - "input_connections": {}, - "inputs": [ - { - "description": "Note: Duplicated sequence names between the species in the collection will cause inaccurate alignment visualization in JBrowse2. ", - "name": "Related Species" - } - ], - "label": "Related Species", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 1202.8593194591494, - "top": 2507.6726497901786 - }, - "tool_id": null, - "tool_state": "{\"optional\": true, \"format\": [\"fasta.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "ccac50f2-56b3-41ff-9670-4ef7e59dcd1d", - "when": null, - "workflow_outputs": [] - }, - "24": { + "21": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, - "id": 24, + "id": 21, "input_connections": { "components_0|param_type|component_value": { "id": 0, @@ -958,11 +854,11 @@ } ] }, - "25": { + "22": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 25, + "id": 22, "input_connections": { "input_param_type|input_param": { "id": 6, @@ -970,7 +866,7 @@ } }, "inputs": [], - "label": "Hap2 not provided", + "label": "Hap provided", "name": "Map parameter value", "outputs": [ { @@ -979,8 +875,8 @@ } ], "position": { - "left": 785.0946591345934, - "top": 1045.2696554701588 + "left": 591.5039592737479, + "top": 480.5093184679958 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -996,62 +892,38 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"true\"}, {\"__index__\": 1, \"from\": true, \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"data\", \"__current_case__\": 4, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": []}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "08114aa3-2cc8-40ec-ae19-d9a596a4c0ed", + "uuid": "3e39d120-ea6c-4184-a29c-92e829d9ff4b", "when": null, "workflow_outputs": [] }, - "26": { + "23": { "annotation": "", - "id": 26, + "id": 23, "input_connections": { - "Do you want to add suffixes to the scaffold names?": { - "id": 8, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "Hap1": { - "id": 5, + "0:Input dataset collection": { + "id": 15, "input_subworkflow_step_id": 0, "output_name": "output" - }, - "Hap1 suffix": { - "id": 9, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "Hap2": { - "id": 7, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Hap2 suffix": { - "id": 10, - "input_subworkflow_step_id": 4, - "output_name": "output" - }, - "when": { - "id": 6, - "output_name": "output" } }, "inputs": [], "label": null, - "name": "Add suffix to 2 haplotypes", + "name": "Test if collection has only one item or is empty", "outputs": [], "position": { - "left": 1078.1321411132812, - "top": 498.4587402343751 + "left": 2036.3281238676334, + "top": 2091.8124494257754 }, "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", "comments": [], "format-version": "0.1", - "name": "Add suffix to 2 haplotypes", + "name": "Test if collection has only one item or is empty", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, @@ -1062,1200 +934,839 @@ "errors": null, "id": 0, "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1" - } - ], - "label": "Hap1", - "name": "Input dataset", + "inputs": [], + "label": null, + "name": "Input dataset collection", "outputs": [], "position": { "left": 0, - "top": 0 + "top": 122.83984375 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "data_input", - "uuid": "9a207b86-2fda-4783-93ca-a6ec3664017a", + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", "when": null, "workflow_outputs": [] }, "1": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", "errors": null, "id": 1, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ { - "description": "", - "name": "Hap2" + "name": "output", + "type": "txt" } ], - "label": "Hap2", - "name": "Input dataset", - "outputs": [], "position": { - "left": 33.55078125, - "top": 122.01953125 + "left": 300, + "top": 0 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "62da2b90-e4d7-440f-a285-b3c32f655a00", + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", "when": null, "workflow_outputs": [] }, "2": { "annotation": "", - "content_id": null, + "content_id": "wc_gnu", "errors": null, "id": 2, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ { - "description": "", - "name": "Do you want to add suffixes to the scaffold names?" + "name": "out_file1", + "type": "tabular" } ], - "label": "Do you want to add suffixes to the scaffold names?", - "name": "Input parameter", - "outputs": [], "position": { - "left": 106.40234375, - "top": 238.078125 + "left": 586.63671875, + "top": 103.203125 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "8b13ed89-3e9c-4542-b381-5297e0db982b", + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": null, + "content_id": "Cut1", "errors": null, "id": 3, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ { - "description": "", - "name": "Hap1 suffix" + "name": "out_file1", + "type": "tabular" } ], - "label": "Hap1 suffix", - "name": "Input parameter", - "outputs": [], "position": { - "left": 215.90450646112865, - "top": 413.8826660328491 + "left": 880, + "top": 70 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", - "tool_version": null, - "type": "parameter_input", - "uuid": "22ea2bf8-e1a7-44ee-b9de-db7674742bdd", + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", "when": null, "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": null, + "content_id": "param_value_from_file", "errors": null, "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap2 suffix" - } - ], - "label": "Hap2 suffix", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 274.272015645431, - "top": 551.9168666758391 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", - "tool_version": null, - "type": "parameter_input", - "uuid": "07975a8d-532f-4dbc-9b9c-eaa0a819def0", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", - "errors": null, - "id": 5, "input_connections": { - "components_1|param_type|component_value": { + "input1": { "id": 3, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" + "output_name": "out_file1" } }, "inputs": [], - "label": "Expression for hap1 suffixing", - "name": "Compose text parameter value", + "label": null, + "name": "Parse parameter value", "outputs": [ { - "name": "out1", + "name": "text_param", "type": "expression.json" } ], "position": { - "left": 715.759396154146, - "top": 105.88705185789851 + "left": 1130, + "top": 180 }, "post_job_actions": { - "HideDatasetActionout1": { + "HideDatasetActiontext_param": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out1" + "output_name": "text_param" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", - "tool_shed_repository": { - "changeset_revision": "e188c9826e0f", - "name": "compose_text_param", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.1", + "tool_version": "0.1.0", "type": "tool", - "uuid": "aa72ce5a-74c8-4298-a4c1-71c5f8c50124", - "when": "$(inputs.when)", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, "workflow_outputs": [] }, - "6": { + "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 6, + "id": 5, "input_connections": { - "components_1|param_type|component_value": { + "input_param_type|input_param": { "id": 4, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" + "output_name": "text_param" } }, "inputs": [], - "label": "Expression for hap2 suffixing", - "name": "Compose text parameter value", + "label": null, + "name": "Map parameter value", "outputs": [ { - "name": "out1", + "name": "output_param_boolean", "type": "expression.json" } ], "position": { - "left": 719.1663154242431, - "top": 464.07762394765837 + "left": 1410, + "top": 200 }, "post_job_actions": { - "HideDatasetActionout1": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out1" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "e188c9826e0f", - "name": "compose_text_param", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "df8ef7a4-280f-4551-ae6b-45dcc1b51d0d", - "when": "$(inputs.when)", - "workflow_outputs": [] + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] }, - "7": { + "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 7, + "id": 6, "input_connections": { - "infile": { - "id": 0, - "output_name": "output" - }, - "replacements_0|replace_pattern": { - "id": 5, - "output_name": "out1" - }, - "when": { - "id": 2, - "output_name": "output" + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" } }, "inputs": [], - "label": "add hap1 suffix", - "name": "Replace Text", + "label": null, + "name": "Map parameter value", "outputs": [ { - "name": "outfile", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 1153.1568123752954, - "top": 65.28236324842067 + "left": 1410, + "top": 440 }, "post_job_actions": { - "HideDatasetActionoutfile": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "outfile" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "9.5+galaxy3", + "tool_version": "0.2.0", "type": "tool", - "uuid": "0d494264-b35e-4084-b8b8-f4bacd1bc3d0", - "when": "$(inputs.when)", - "workflow_outputs": [] + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] }, - "8": { + "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 8, + "id": 7, "input_connections": { - "infile": { - "id": 1, - "output_name": "output" - }, - "replacements_0|replace_pattern": { - "id": 6, - "output_name": "out1" - }, - "when": { - "id": 2, - "output_name": "output" + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" } }, "inputs": [], - "label": "add hap2 suffix", - "name": "Replace Text", + "label": null, + "name": "Map parameter value", "outputs": [ { - "name": "outfile", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 1157.53513037215, - "top": 294.29634625957476 + "left": 1410, + "top": 680 }, "post_job_actions": { - "HideDatasetActionoutfile": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "outfile" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "9.5+galaxy3", + "tool_version": "0.2.0", "type": "tool", - "uuid": "5d369c5c-05fc-4477-897a-42b948900499", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 9, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 7, - "output_name": "outfile" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1563.750750466131, - "top": 23.243878725375495 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap1 with Suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "2a99e9f1-c4c1-466e-b2f8-d520213c6b34", - "when": null, - "workflow_outputs": [ - { - "label": "Processed Hap1", - "output_name": "data_param", - "uuid": "8fff3233-16ad-4388-8544-bd3954fbfe71" - } - ] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 10, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 8, - "output_name": "outfile" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1562.8912962386594, - "top": 473.2480811314234 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap2 with suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "3a64f0a3-bd8b-4ca5-a118-877ee37d239a", - "when": null, - "workflow_outputs": [ - { - "label": "Processed Hap2", - "output_name": "data_param", - "uuid": "99e3e643-db15-4942-b9f1-8925526ff367" - } - ] - }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "errors": null, - "id": 11, - "input_connections": { - "inputs": { - "id": 9, - "output_name": "data_param" - }, - "queries_0|inputs2": { - "id": 10, - "output_name": "data_param" - } - }, - "inputs": [], - "label": null, - "name": "Concatenate datasets", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 1914.872391014437, - "top": 246.32152277721676 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "b2f8c163-76e4-4e8e-bcf6-56c69b322e6f", - "when": null, - "workflow_outputs": [ - { - "label": "Merged Haplotypes", - "output_name": "out_file1", - "uuid": "4f149f33-9aee-4c14-84ed-7b7cddea91ec" + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" } ] } }, "tags": [], - "uuid": "981c39a4-4f6b-47d1-ac30-08ce1d6a9394" + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" }, "tool_id": null, "type": "subworkflow", - "uuid": "e3fb5fbc-543e-405a-aa5d-0c4f512abd61", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "Both Haplotypes merged", - "output_name": "Merged Haplotypes", - "uuid": "6af5a08f-74aa-4a03-bf0c-22d443a02b18" - } - ] + "uuid": "c96d9580-43de-4a1a-a59a-3d46b80511c3", + "when": null, + "workflow_outputs": [] }, - "27": { + "24": { "annotation": "", - "id": 27, + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "errors": null, + "id": 24, "input_connections": { - "0:Input dataset collection": { + "library|input_1": { + "id": 15, + "output_name": "output" + }, + "when": { "id": 16, - "input_subworkflow_step_id": 0, "output_name": "output" } }, "inputs": [], "label": null, - "name": "Test if collection has only one item or is empty", - "outputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "out1", + "type": "fastqsanger" + }, + { + "name": "report", + "type": "txt" + }, + { + "name": "json_stats", + "type": "json" + } + ], "position": { - "left": 2036.3281238676334, - "top": 2091.8124494257754 + "left": 876.0514401153265, + "top": 1266.2266772927594 }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Test if collection has only one item or is empty", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + "post_job_actions": { + "HideDatasetActionjson_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "json_stats" }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [], - "label": null, - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 0, - "top": 122.83984375 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", - "when": null, - "workflow_outputs": [] + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "HiFi reads without adapters" }, - "1": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "errors": null, - "id": 1, - "input_connections": { - "input_collection": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Extract element identifiers", - "outputs": [ - { - "name": "output", - "type": "txt" - } - ], - "position": { - "left": 300, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionreport": { + "action_arguments": { + "newname": "HiFi reads adapters trimming report" + }, + "action_type": "RenameDatasetAction", + "output_name": "report" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\", \"json_stats\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "HiFi reads without adapters", + "output_name": "out1", + "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" + }, + { + "label": "HiFi reads adapters trimming report", + "output_name": "report", + "uuid": "71d127d4-af3f-4fbe-a54b-e609fe2a9209" + } + ] + }, + "25": { + "annotation": "", + "id": 25, + "input_connections": { + "Do you want to add suffixes to the scaffold names?": { + "id": 7, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Hap1": { + "id": 5, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Hap1 suffix": { + "id": 8, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Hap2": { + "id": 6, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Hap2 suffix": { + "id": 9, + "input_subworkflow_step_id": 4, + "output_name": "output" + }, + "when": { + "id": 22, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Add suffix to 2 haplotypes", + "outputs": [], + "position": { + "left": 1078.1321411132812, + "top": 498.4587402343751 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Add suffix to 2 haplotypes", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap1" } + ], + "label": "Hap1", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 0 }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "tool_shed_repository": { - "changeset_revision": "3e27acfa4830", - "name": "collection_element_identifiers", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "9a207b86-2fda-4783-93ca-a6ec3664017a", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap2" + } + ], + "label": "Hap2", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 33.55078125, + "top": 122.01953125 }, - "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.3", - "type": "tool", - "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "62da2b90-e4d7-440f-a285-b3c32f655a00", "when": null, "workflow_outputs": [] }, "2": { "annotation": "", - "content_id": "wc_gnu", + "content_id": null, "errors": null, "id": 2, - "input_connections": { - "input1": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Line/Word/Character count", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "out_file1", - "type": "tabular" + "description": "", + "name": "Do you want to add suffixes to the scaffold names?" } ], + "label": "Do you want to add suffixes to the scaffold names?", + "name": "Input parameter", + "outputs": [], "position": { - "left": 586.63671875, - "top": 103.203125 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } + "left": 106.40234375, + "top": 238.078125 }, - "tool_id": "wc_gnu", - "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.0", - "type": "tool", - "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "8b13ed89-3e9c-4542-b381-5297e0db982b", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": "Cut1", + "content_id": null, "errors": null, "id": 3, - "input_connections": { - "input": { - "id": 2, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Cut", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "out_file1", - "type": "tabular" + "description": "", + "name": "Hap1 suffix" } ], + "label": "Hap1 suffix", + "name": "Input parameter", + "outputs": [], "position": { - "left": 880, - "top": 70 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } + "left": 215.90450646112865, + "top": 413.8826660328491 }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "22ea2bf8-e1a7-44ee-b9de-db7674742bdd", "when": null, "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": "param_value_from_file", + "content_id": null, "errors": null, "id": 4, - "input_connections": { - "input1": { - "id": 3, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Parse parameter value", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "text_param", - "type": "expression.json" + "description": "", + "name": "Hap2 suffix" } ], + "label": "Hap2 suffix", + "name": "Input parameter", + "outputs": [], "position": { - "left": 1130, - "top": 180 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } + "left": 274.272015645431, + "top": 551.9168666758391 }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "07975a8d-532f-4dbc-9b9c-eaa0a819def0", "when": null, "workflow_outputs": [] }, "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, "id": 5, "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" + "style_cond|type_cond|pick_from_0|value": { + "id": 1, + "output_name": "output" } }, "inputs": [], "label": null, - "name": "Map parameter value", + "name": "Pick parameter value", "outputs": [ { - "name": "output_param_boolean", - "type": "expression.json" + "name": "data_param", + "type": "input" } ], "position": { - "left": 1410, - "top": 200 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } + "left": 659.6124341306107, + "top": 325.1248717867535 }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "b19e21af9c52", + "name": "pick_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first_or_error\", \"__current_case__\": 2, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "uuid": "d8569d1d-471a-4ee4-8d01-cfbb66bd09bb", "when": null, - "workflow_outputs": [ - { - "label": "Is empty", - "output_name": "output_param_boolean", - "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" - } - ] + "workflow_outputs": [] }, "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, "id": 6, "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" + "components_1|param_type|component_value": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Map parameter value", + "label": "Expression for hap1 suffixing", + "name": "Compose text parameter value", "outputs": [ { - "name": "output_param_boolean", + "name": "out1", "type": "expression.json" } ], "position": { - "left": 1410, - "top": 440 + "left": 715.759396154146, + "top": 105.88705185789851 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActionout1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.1.1", "type": "tool", - "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", - "when": null, - "workflow_outputs": [ - { - "label": "Has a single sample", - "output_name": "output_param_boolean", - "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" - } - ] + "uuid": "aa72ce5a-74c8-4298-a4c1-71c5f8c50124", + "when": "$(inputs.when)", + "workflow_outputs": [] }, "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, "id": 7, "input_connections": { - "input_param_type|input_param": { + "components_1|param_type|component_value": { "id": 4, - "output_name": "text_param" + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Map parameter value", + "label": "Expression for hap2 suffixing", + "name": "Compose text parameter value", "outputs": [ { - "name": "output_param_boolean", + "name": "out1", "type": "expression.json" } ], "position": { - "left": 1410, - "top": 680 + "left": 719.1663154242431, + "top": 464.07762394765837 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActionout1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.1.1", "type": "tool", - "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", - "when": null, - "workflow_outputs": [ + "uuid": "df8ef7a4-280f-4551-ae6b-45dcc1b51d0d", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "errors": null, + "id": 8, + "input_connections": { + "infile": { + "id": 0, + "output_name": "output" + }, + "replacements_0|replace_pattern": { + "id": 6, + "output_name": "out1" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "add hap1 suffix", + "name": "Replace Text", + "outputs": [ { - "label": "Has multiple samples", - "output_name": "output_param_boolean", - "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" - } - ] - } - }, - "tags": [], - "uuid": "dddd606b-1301-4fa4-bde5-0281131c064d" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "c96d9580-43de-4a1a-a59a-3d46b80511c3", - "when": null, - "workflow_outputs": [] - }, - "28": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "errors": null, - "id": 28, - "input_connections": { - "library|input_1": { - "id": 16, - "output_name": "output" - }, - "when": { - "id": 17, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Cutadapt", - "outputs": [ - { - "name": "out1", - "type": "fastqsanger" - }, - { - "name": "report", - "type": "txt" - }, - { - "name": "json_stats", - "type": "json" - } - ], - "position": { - "left": 876.0514401153265, - "top": 1266.2266772927594 - }, - "post_job_actions": { - "HideDatasetActionjson_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "json_stats" - }, - "RenameDatasetActionout1": { - "action_arguments": { - "newname": "HiFi reads without adapters" - }, - "action_type": "RenameDatasetAction", - "output_name": "out1" - }, - "RenameDatasetActionreport": { - "action_arguments": { - "newname": "HiFi reads adapters trimming report" - }, - "action_type": "RenameDatasetAction", - "output_name": "report" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "f6168dd17f82", - "name": "cutadapt", - "owner": "lparsons", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\", \"json_stats\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "5.2+galaxy2", - "type": "tool", - "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "HiFi reads adapters trimming report", - "output_name": "report", - "uuid": "71d127d4-af3f-4fbe-a54b-e609fe2a9209" - }, - { - "label": "HiFi reads without adapters ", - "output_name": "out1", - "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" - } - ] - }, - "29": { - "annotation": "", - "id": 29, - "input_connections": { - "Do you want to add suffixes to the scaffold names?": { - "id": 8, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Hap1": { - "id": 5, - "input_subworkflow_step_id": 0, - "output_name": "output" - }, - "Hap1 suffix": { - "id": 9, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "when": { - "id": 25, - "output_name": "output_param_boolean" - } - }, - "inputs": [], - "label": null, - "name": "Add Suffix 1 haplotype", - "outputs": [], - "position": { - "left": 1079.9147328570098, - "top": 902.8465562420048 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Add Suffix 1 haplotype", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1" - } - ], - "label": "Hap1", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 0, - "top": 0 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "33bd9c56-0929-4b8e-85ab-48ebf584e4ab", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Do you want to add suffixes to the scaffold names?" - } - ], - "label": "Do you want to add suffixes to the scaffold names?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 74.46610679000048, - "top": 103.59444232917119 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "675084df-0ed2-4fa2-b507-6271ee93aad0", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1 suffix" - } - ], - "label": "Hap1 suffix", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 168.86746754459963, - "top": 269.5369890878619 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", - "tool_version": null, - "type": "parameter_input", - "uuid": "1c5ef3b8-0f1f-45ae-96d6-2d02e032c1ee", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", - "errors": null, - "id": 3, - "input_connections": { - "components_1|param_type|component_value": { - "id": 2, - "output_name": "output" - }, - "when": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": "Expression for hap1 suffixing", - "name": "Compose text parameter value", - "outputs": [ - { - "name": "out1", - "type": "expression.json" + "name": "outfile", + "type": "input" } ], "position": { - "left": 680.6779970312689, - "top": 154.92723110280613 + "left": 1153.1568123752954, + "top": 65.28236324842067 }, "post_job_actions": { - "HideDatasetActionout1": { + "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out1" + "output_name": "outfile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "tool_shed_repository": { - "changeset_revision": "e188c9826e0f", - "name": "compose_text_param", - "owner": "iuc", + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.1", + "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "0dba8558-24cb-494f-bec3-a6be089df05e", + "uuid": "0d494264-b35e-4084-b8b8-f4bacd1bc3d0", "when": "$(inputs.when)", "workflow_outputs": [] }, - "4": { + "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "errors": null, - "id": 4, + "id": 9, "input_connections": { "infile": { - "id": 0, - "output_name": "output" + "id": 5, + "output_name": "data_param" }, "replacements_0|replace_pattern": { - "id": 3, + "id": 7, "output_name": "out1" }, "when": { - "id": 1, + "id": 2, "output_name": "output" } }, "inputs": [], - "label": "add hap1 suffix", + "label": "add hap2 suffix", "name": "Replace Text", "outputs": [ { @@ -2264,8 +1775,8 @@ } ], "position": { - "left": 1042.6204171244863, - "top": 117.72698978106516 + "left": 1157.53513037215, + "top": 294.29634625957476 }, "post_job_actions": { "HideDatasetActionoutfile": { @@ -2285,18 +1796,18 @@ "tool_uuid": null, "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "035ade88-6466-4cfd-bff6-fe954f352772", + "uuid": "5d369c5c-05fc-4477-897a-42b948900499", "when": "$(inputs.when)", "workflow_outputs": [] }, - "5": { + "10": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 5, + "id": 10, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 4, + "id": 8, "output_name": "outfile" }, "style_cond|type_cond|pick_from_1|value": { @@ -2314,14 +1825,21 @@ } ], "position": { - "left": 1459.6101679904903, - "top": 267.5340308459985 + "left": 1563.750750466131, + "top": 23.243878725375495 }, "post_job_actions": { "HideDatasetActiondata_param": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Decontaminated Hap1 with Suffix" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" } }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -2335,158 +1853,216 @@ "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "79b86d06-475a-43b1-9a32-d9788cf0e977", + "uuid": "2a99e9f1-c4c1-466e-b2f8-d520213c6b34", "when": null, "workflow_outputs": [ { "label": "Processed Hap1", "output_name": "data_param", - "uuid": "67cbd3bf-e5bf-4149-a1ee-e1884a2177c9" + "uuid": "8fff3233-16ad-4388-8544-bd3954fbfe71" } ] - } - }, - "tags": [], - "uuid": "3b32e78f-36dd-4dc9-94c6-2b62613fb166" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "963aaf4e-14cf-449b-99b5-f3693b8b19b6", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "30": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 30, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 26, - "output_name": "Processed Hap2" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 7, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 2208.3701753216055, - "top": 505.8000045132802 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap2 with Suffix" }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "decont_hap2_suffix" + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 11, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 9, + "output_name": "outfile" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 5, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1562.8912962386594, + "top": 473.2480811314234 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Decontaminated Hap2 with suffix" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "decont_hap2_suffix" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "3a64f0a3-bd8b-4ca5-a118-877ee37d239a", + "when": null, + "workflow_outputs": [ + { + "label": "Decontaminated Hap2 with Suffix", + "output_name": "data_param", + "uuid": "e4e07746-f66d-4106-87f9-3ddb93f852e2" + } + ] }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", + "errors": null, + "id": 12, + "input_connections": { + "inputs": { + "id": 10, + "output_name": "data_param" + }, + "queries_0|inputs2": { + "id": 11, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1914.872391014437, + "top": 246.32152277721676 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "b2f8c163-76e4-4e8e-bcf6-56c69b322e6f", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Haplotypes", + "output_name": "out_file1", + "uuid": "4f149f33-9aee-4c14-84ed-7b7cddea91ec" + } + ] + } + }, + "tags": [], + "uuid": "63454d41-dd2d-4667-a916-fb3eb931673e" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "60006e6d-f56d-431c-992d-acc49cc4638b", - "when": null, + "tool_id": null, + "type": "subworkflow", + "uuid": "e3fb5fbc-543e-405a-aa5d-0c4f512abd61", + "when": "$(inputs.when)", "workflow_outputs": [ { "label": "Decontaminated Hap2 with Suffix", - "output_name": "data_param", - "uuid": "c34f2961-3386-4be9-bcb5-77ca2f0fffe5" + "output_name": "Decontaminated Hap2 with Suffix", + "uuid": "d0f7d9ba-6ba3-4507-be06-844f727feab2" } ] }, - "31": { + "26": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 31, + "id": 26, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 28, - "output_name": "out1" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 16, - "output_name": "output" + "input_param_type|input_param": { + "id": 22, + "output_name": "output_param_boolean" } }, "inputs": [], - "label": null, - "name": "Pick parameter value", + "label": "Hap2 not provided", + "name": "Map parameter value", "outputs": [ { - "name": "data_param", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 1114.380535145976, - "top": 1528.2735657128362 + "left": 785.0946591345934, + "top": 1045.2696554701588 }, "post_job_actions": { - "HideDatasetActiondata_param": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "data_param" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"true\"}, {\"__index__\": 1, \"from\": true, \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "2d624ce0-5498-4a42-a215-00c70b8773a3", + "uuid": "08114aa3-2cc8-40ec-ae19-d9a596a4c0ed", "when": null, "workflow_outputs": [] }, - "32": { + "27": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 32, + "id": 27, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 26, - "output_name": "Merged Haplotypes" + "id": 24, + "output_name": "out1" }, "style_cond|type_cond|pick_from_1|value": { - "id": 29, - "output_name": "Processed Hap1" + "id": 15, + "output_name": "output" } }, "inputs": [], - "label": "Pick Assembly", + "label": null, "name": "Pick parameter value", "outputs": [ { @@ -2495,22 +2071,13 @@ } ], "position": { - "left": 1438.4073811566127, - "top": 776.0878898442162 + "left": 1114.380535145976, + "top": 1528.2735657128362 }, "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Assembly for curation" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "merged_haps" - }, - "action_type": "TagDatasetAction", + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", "output_name": "data_param" } }, @@ -2521,170 +2088,80 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "c5cb7d6b-6d51-41cf-9914-c3df478246a9", + "uuid": "2d624ce0-5498-4a42-a215-00c70b8773a3", "when": null, - "workflow_outputs": [ - { - "label": "Assembly for curation", - "output_name": "data_param", - "uuid": "ef7e194c-19b7-4bc0-a6f7-f049d1a6b25d" - } - ] + "workflow_outputs": [] }, - "33": { + "28": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 33, + "id": 28, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 26, - "output_name": "Processed Hap1" + "Do you want to add suffixes to the scaffold names?": { + "id": 7, + "input_subworkflow_step_id": 1, + "output_name": "output" }, - "style_cond|type_cond|pick_from_1|value": { - "id": 29, - "output_name": "Processed Hap1" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 2209.82453439378, - "top": 266.1637635391988 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap1 with Suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "decont_hap1_suffix" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "126228b7-2718-4db7-8eb4-0700ea2ff709", - "when": null, - "workflow_outputs": [ - { - "label": "Decontaminated Hap1 with Suffix", - "output_name": "data_param", - "uuid": "f5841bfd-2f87-4676-88a5-6c64f139c7e0" - } - ] - }, - "34": { - "annotation": "", - "id": 34, - "input_connections": { - "Do you want to trim the Hi-C data?": { - "id": 13, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "Estimated Genome Size": { - "id": 11, - "input_subworkflow_step_id": 3, + "Hap1": { + "id": 5, + "input_subworkflow_step_id": 0, "output_name": "output" }, - "Hi-C reads": { - "id": 12, - "input_subworkflow_step_id": 1, + "Hap1 suffix": { + "id": 8, + "input_subworkflow_step_id": 2, "output_name": "output" }, - "Reference": { - "id": 32, - "input_subworkflow_step_id": 0, - "output_name": "data_param" - }, - "Remove HiC duplicates ?": { - "id": 14, - "input_subworkflow_step_id": 4, - "output_name": "output" + "when": { + "id": 26, + "output_name": "output_param_boolean" } }, "inputs": [], "label": null, - "name": "Trim, Align, deduplicate Hi-C - Precuration", + "name": "Add Suffix 1 haplotype", "outputs": [], "position": { - "left": 1552.0680051124978, - "top": 1358.2567456089375 + "left": 1075.28716709916, + "top": 939.8753534849833 }, "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", "comments": [], - "creator": [ - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6228-2785", - "name": "Patrik Smeds" - }, - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6421-3484", - "name": "Delphine Lariviere" - } - ], "format-version": "0.1", - "license": "MIT", - "name": "Trim, Align, deduplicate Hi-C - Precuration", + "name": "Add Suffix 1 haplotype", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, "steps": { "0": { - "annotation": "Assembly for Haplotype 1.", + "annotation": "", "content_id": null, "errors": null, "id": 0, "input_connections": {}, "inputs": [ { - "description": "Assembly for Haplotype 1.", - "name": "Reference" + "description": "", + "name": "Hap1" } ], - "label": "Reference", + "label": "Hap1", "name": "Input dataset", "outputs": [], "position": { "left": 0, - "top": 472.97492244496857 + "top": 0 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null}", "tool_version": null, "type": "data_input", - "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "uuid": "33bd9c56-0929-4b8e-85ab-48ebf584e4ab", "when": null, "workflow_outputs": [] }, @@ -2697,4607 +2174,1060 @@ "inputs": [ { "description": "", - "name": "Hi-C reads" + "name": "Do you want to add suffixes to the scaffold names?" } ], - "label": "Hi-C reads", - "name": "Input dataset collection", + "label": "Do you want to add suffixes to the scaffold names?", + "name": "Input parameter", "outputs": [], "position": { - "left": 24.900863986875255, - "top": 568.7987808236342 + "left": 74.46610679000048, + "top": 103.59444232917119 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, - "type": "data_collection_input", - "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "type": "parameter_input", + "uuid": "675084df-0ed2-4fa2-b507-6271ee93aad0", "when": null, "workflow_outputs": [] }, "2": { - "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "annotation": "", "content_id": null, "errors": null, "id": 2, "input_connections": {}, "inputs": [ { - "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", - "name": "Do you want to trim the Hi-C data?" + "description": "", + "name": "Hap1 suffix" } ], - "label": "Do you want to trim the Hi-C data?", + "label": "Hap1 suffix", "name": "Input parameter", "outputs": [], "position": { - "left": 87.29051288561523, - "top": 670.9221943657891 + "left": 168.86746754459963, + "top": 269.5369890878619 }, "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", "tool_version": null, "type": "parameter_input", - "uuid": "6d1391db-7fef-4b5c-a236-26016d6d0aab", + "uuid": "1c5ef3b8-0f1f-45ae-96d6-2d02e032c1ee", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, "id": 3, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Estimated Genome Size" + "input_connections": { + "components_1|param_type|component_value": { + "id": 2, + "output_name": "output" + }, + "when": { + "id": 1, + "output_name": "output" } - ], - "label": "Estimated Genome Size", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 127.04701718304551, - "top": 807.1174349926957 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "75d82c6b-19cd-4ca8-86e3-2806f9c01e2b", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ + "inputs": [], + "label": "Expression for hap1 suffixing", + "name": "Compose text parameter value", + "outputs": [ { - "description": "", - "name": "Remove HiC duplicates ?" + "name": "out1", + "type": "expression.json" } ], - "label": "Remove HiC duplicates ?", - "name": "Input parameter", - "outputs": [], "position": { - "left": 152.62563696711496, - "top": 912.6429174544365 + "left": 680.6779970312689, + "top": 154.92723110280613 }, - "tool_id": null, - "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", - "when": null, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.1", + "type": "tool", + "uuid": "0dba8558-24cb-494f-bec3-a6be089df05e", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "5": { + "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "errors": null, - "id": 5, + "id": 4, "input_connections": { "infile": { "id": 0, "output_name": "output" + }, + "replacements_0|replace_pattern": { + "id": 3, + "output_name": "out1" + }, + "when": { + "id": 1, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Search in textfiles", + "label": "add hap1 suffix", + "name": "Replace Text", "outputs": [ { - "name": "output", + "name": "outfile", "type": "input" } ], "position": { - "left": 2050.334659953477, - "top": 3.9427453625997657 + "left": 1042.6204171244863, + "top": 117.72698978106516 }, "post_job_actions": { - "HideDatasetActionoutput": { + "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output" + "output_name": "outfile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "tool_shed_repository": { "changeset_revision": "ab83aa685821", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \">\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "b06586f9-7bb2-469d-87c5-a79ac25c2040", - "when": null, + "uuid": "035ade88-6466-4cfd-bff6-fe954f352772", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "6": { + "5": { "annotation": "", - "id": 6, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 5, "input_connections": { - "0:Input dataset collection": { - "id": 1, - "input_subworkflow_step_id": 0, + "style_cond|type_cond|pick_from_0|value": { + "id": 4, + "output_name": "outfile" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, "output_name": "output" } }, "inputs": [], "label": null, - "name": "Test if collection has only one item or is empty", - "outputs": [], + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], "position": { - "left": 1413.3019710918868, - "top": 865.2761180121176 + "left": 1459.6101679904903, + "top": 267.5340308459985 }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Test if collection has only one item or is empty", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [], - "label": null, - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 0, - "top": 122.83984375 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "errors": null, - "id": 1, - "input_connections": { - "input_collection": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Extract element identifiers", - "outputs": [ - { - "name": "output", - "type": "txt" - } - ], - "position": { - "left": 300, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "tool_shed_repository": { - "changeset_revision": "3e27acfa4830", - "name": "collection_element_identifiers", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.3", - "type": "tool", - "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": "wc_gnu", - "errors": null, - "id": 2, - "input_connections": { - "input1": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Line/Word/Character count", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 586.63671875, - "top": 103.203125 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "wc_gnu", - "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.0", - "type": "tool", - "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 3, - "input_connections": { - "input": { - "id": 2, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 880, - "top": 70 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 4, - "input_connections": { - "input1": { - "id": 3, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 1130, - "top": 180 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 5, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" - } - }, - "inputs": [], - "label": null, - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1410, - "top": 200 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", - "when": null, - "workflow_outputs": [ - { - "label": "Is empty", - "output_name": "output_param_boolean", - "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" - } - ] - }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 6, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" - } - }, - "inputs": [], - "label": null, - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1410, - "top": 440 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", - "when": null, - "workflow_outputs": [ - { - "label": "Has a single sample", - "output_name": "output_param_boolean", - "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" - } - ] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 7, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" - } - }, - "inputs": [], - "label": null, - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1410, - "top": 680 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", - "when": null, - "workflow_outputs": [ - { - "label": "Has multiple samples", - "output_name": "output_param_boolean", - "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" - } - ] - } - }, - "tags": [], - "uuid": "5f125eb2-c713-4df4-8a71-e49ba9852fc8" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "45a60cd2-4176-46d6-9e72-62c4597f00ca", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "", - "id": 7, - "input_connections": { - "Do you want to trim the Hi-C data?": { - "id": 2, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "Estimated Genome size": { - "id": 3, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "Hi-C reads": { - "id": 1, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Reference": { - "id": 0, - "input_subworkflow_step_id": 0, - "output_name": "output" + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" } }, - "inputs": [ + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "79b86d06-475a-43b1-9a32-d9788cf0e977", + "when": null, + "workflow_outputs": [ { - "description": "", - "name": "Size dependent alignment" + "label": "Processed Hap1", + "output_name": "data_param", + "uuid": "67cbd3bf-e5bf-4149-a1ee-e1884a2177c9" } - ], - "label": "Size dependent alignment", - "name": "optional alignement", - "outputs": [], - "position": { - "left": 1225.3311064782304, - "top": 414.04870986867905 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "creator": [ - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6228-2785", - "name": "Patrik Smeds" - }, - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6421-3484", - "name": "Delphine Lariviere" - } - ], - "format-version": "0.1", - "license": "MIT", - "name": "optional alignement", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "Assembly for Haplotype 1.", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 1.", - "name": "Reference" - } - ], - "label": "Reference", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 0, - "top": 117.4984149132323 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hi-C reads" - } - ], - "label": "Hi-C reads", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 24.900863986875255, - "top": 213.3222732918979 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", - "name": "Do you want to trim the Hi-C data?" - } - ], - "label": "Do you want to trim the Hi-C data?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 111.02187825492916, - "top": 314.3801214696325 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "6d1391db-7fef-4b5c-a236-26016d6d0aab", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Estimated Genome size" - } - ], - "label": "Estimated Genome size", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 198.90903413710075, - "top": 449.1965436679154 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "d4563544-4752-4a01-8658-9f143d4a282d", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", - "errors": null, - "id": 4, - "input_connections": { - "reference": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "BWA-MEM2 indexer", - "outputs": [ - { - "name": "index", - "type": "bwa_mem2_index" - } - ], - "position": { - "left": 1096.1772811073727, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActionindex": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "index" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "af91699b8d4c", - "name": "bwa_mem2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.3+galaxy0", - "type": "tool", - "uuid": "10446b69-0dc2-4e05-84da-647b70d6bad9", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "errors": null, - "id": 5, - "input_connections": { - "library|input_1": { - "id": 1, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": "Trim Hi-C reads 2", - "name": "Cutadapt", - "outputs": [ - { - "name": "out_pairs", - "type": "input" - }, - { - "name": "report", - "type": "txt" - } - ], - "position": { - "left": 782.453125, - "top": 254.9359149132323 - }, - "post_job_actions": { - "HideDatasetActionout_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_pairs" - }, - "HideDatasetActionreport": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "report" - }, - "RenameDatasetActionout1": { - "action_arguments": { - "newname": "Trimmed Hi-C Forward Reads" - }, - "action_type": "RenameDatasetAction", - "output_name": "out1" - }, - "RenameDatasetActionout2": { - "action_arguments": { - "newname": "Trimmed Hi-C Reverse Reads" - }, - "action_type": "RenameDatasetAction", - "output_name": "out2" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "f6168dd17f82", - "name": "cutadapt", - "owner": "lparsons", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "5.2+galaxy2", - "type": "tool", - "uuid": "15c5cc40-ce0a-4e29-a891-87f55bf2bd6b", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", - "errors": null, - "id": 6, - "input_connections": { - "infile": { - "id": 3, - "output_name": "output" - } - }, - "inputs": [], - "label": "True if Genome size higher than 10Gb", - "name": "Text reformatting", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 507.38482635055703, - "top": 571.3482580122119 - }, - "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"code\": \"{if ($1 >= 10000000000) print \\\"true\\\"; else print \\\"false\\\"} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "af759549-bbe3-4923-8e5a-a62952106de0", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 7, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 5, - "output_name": "out_pairs" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1070.6821138797554, - "top": 478.17850107909 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Trimmed Hi-C data" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "hic_trimmed" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "325884ac-c2c1-4a5c-b74f-c1c422662b78", - "when": null, - "workflow_outputs": [ - { - "label": "Trimmed Hi-C data", - "output_name": "data_param", - "uuid": "73027165-8c18-45a9-9df1-76e3cc2421fb" - } - ] - }, - "8": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 8, - "input_connections": { - "input1": { - "id": 6, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 752.2943156269191, - "top": 676.6099689052414 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "e4ffd666-dc5a-4ded-bcd2-67e2a7ecb203", - "when": null, - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 9, - "input_connections": { - "input_param_type|input_param": { - "id": 8, - "output_name": "text_param" - } - }, - "inputs": [], - "label": "When genome smaller than 10gb", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1041.6498874098133, - "top": 833.0361537241724 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"false\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"true\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "8d02989c-49bb-4b66-9b2a-418f1adc4d9e", - "when": null, - "workflow_outputs": [] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 10, - "input_connections": { - "input_param_type|input_param": { - "id": 8, - "output_name": "text_param" - } - }, - "inputs": [], - "label": "When genome bigger than 10gb", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1046.3414281234843, - "top": 1089.522831743084 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"true\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"false\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "9515d07b-297d-4261-8773-a71e4986a503", - "when": null, - "workflow_outputs": [] - }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", - "errors": null, - "id": 11, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 7, - "output_name": "data_param" - }, - "reference_source|ref_file": { - "id": 4, - "output_name": "index" - }, - "when": { - "id": 9, - "output_name": "output_param_boolean" - } - }, - "inputs": [], - "label": null, - "name": "BWA-MEM2", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "left": 1530.655705341112, - "top": 285.849105522478 - }, - "post_job_actions": { - "HideDatasetActionbam_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "bam_output" - }, - "RenameDatasetActionbam_output": { - "action_arguments": { - "newname": "Hi-C Alignments" - }, - "action_type": "RenameDatasetAction", - "output_name": "bam_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "af91699b8d4c", - "name": "bwa_mem2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.3+galaxy0", - "type": "tool", - "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "12": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", - "errors": null, - "id": 12, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 7, - "output_name": "data_param" - }, - "reference_source|ref_file": { - "id": 0, - "output_name": "output" - }, - "when": { - "id": 10, - "output_name": "output_param_boolean" - } - }, - "inputs": [], - "label": null, - "name": "Map with BWA-MEM", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "left": 1535.7145267538042, - "top": 682.7199382680614 - }, - "post_job_actions": { - "HideDatasetActionbam_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "bam_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", - "tool_shed_repository": { - "changeset_revision": "1dfc975b48d5", - "name": "bwa", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.7.19", - "type": "tool", - "uuid": "cebb83f8-86b3-4a6e-b377-9d49f414730c", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "13": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 13, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 11, - "output_name": "bam_output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 12, - "output_name": "bam_output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1860.8286890244565, - "top": 547.8063933642267 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "0279f93e-3825-41fd-a2aa-7c346ac39b37", - "when": null, - "workflow_outputs": [ - { - "label": "Alignments", - "output_name": "data_param", - "uuid": "dbe0fa6e-d89f-4c0b-a465-20543e4886d5" - } - ] - } - }, - "tags": [], - "uuid": "aadd5059-73ae-42f2-8056-d4e10af5653e" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "37ccbbb0-f709-48b1-b4a0-dabbc5ce599a", - "when": null, - "workflow_outputs": [ - { - "label": "Alignments", - "output_name": "Alignments", - "uuid": "5eb4cac7-2c43-4ba0-a4c7-303195680d31" - }, - { - "label": "Trimmed Hi-C data", - "output_name": "Trimmed Hi-C data", - "uuid": "41a35b53-a316-40b4-854d-b23e777ac04d" - } - ] - }, - "8": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 8, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "output" - } - }, - "inputs": [], - "label": "False when removal is true", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 2964.7900692749863, - "top": 1420.0180180585944 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", - "when": null, - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", - "errors": null, - "id": 9, - "input_connections": { - "bamfile": { - "id": 7, - "output_name": "Alignments" - } - }, - "inputs": [], - "label": null, - "name": "Samtools fixmate", - "outputs": [ - { - "name": "output", - "type": "qname_sorted.bam" - } - ], - "position": { - "left": 1896.4875232723236, - "top": 490.91412456456 - }, - "post_job_actions": { - "ChangeDatatypeActionoutput": { - "action_arguments": { - "newtype": "qname_sorted.bam" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "output" - }, - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "84819580b8a5", - "name": "samtools_fixmate", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "1db82bd3-3108-4f39-a0f0-f9e5450e1f4f", - "when": null, - "workflow_outputs": [] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", - "errors": null, - "id": 10, - "input_connections": { - "input1": { - "id": 9, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Samtools sort", - "outputs": [ - { - "name": "output1", - "type": "bam" - } - ], - "position": { - "left": 2289.4479412815194, - "top": 519.3556477175839 - }, - "post_job_actions": { - "HideDatasetActionoutput1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", - "tool_shed_repository": { - "changeset_revision": "2ce517eb9af2", - "name": "samtools_sort", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.0.8", - "type": "tool", - "uuid": "5033d744-4b6d-4486-b2ea-732697d51e45", - "when": null, - "workflow_outputs": [] - }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", - "errors": null, - "id": 11, - "input_connections": { - "chroms_path": { - "id": 5, - "output_name": "output" - }, - "sam_path": { - "id": 9, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pairtools parse", - "outputs": [ - { - "name": "output_parsed_pairs", - "type": "4dn_pairsam" - }, - { - "name": "parsed_pairs_stats", - "type": "tabular" - } - ], - "position": { - "left": 2927.5259623065385, - "top": 66.3908541727944 - }, - "post_job_actions": { - "HideDatasetActionoutput_parsed_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_parsed_pairs" - }, - "HideDatasetActionparsed_pairs_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "parsed_pairs_stats" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", - "tool_shed_repository": { - "changeset_revision": "a5876cca7b05", - "name": "pairtools_parse", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"assembly_name\": \"\", \"chroms_path\": {\"__class__\": \"ConnectedValue\"}, \"compress_output\": true, \"drop_readid\": false, \"drop_sam\": true, \"drop_seq\": true, \"max_inter_algn_gap\": \"20\", \"max_molecule_size\": \"2000\", \"min_mapq\": \"1\", \"output_stats\": true, \"sam_path\": {\"__class__\": \"ConnectedValue\"}, \"select_add_columns\": {\"add_columns_selection\": \"no\", \"__current_case__\": 1}, \"sort_output\": true, \"walks_policy\": \"mask\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.3+galaxy6", - "type": "tool", - "uuid": "9205b952-9164-4ba4-9c25-4456a206e12b", - "when": null, - "workflow_outputs": [] - }, - "12": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 12, - "input_connections": { - "input": { - "id": 10, - "output_name": "output1" - }, - "when": { - "id": 6, - "output_name": "Has a single sample" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 2632.9323345231205, - "top": 483.13780589990847 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "22bcd1ca-c4f9-4802-b545-c20f2f7798f4", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "13": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", - "errors": null, - "id": 13, - "input_connections": { - "bamfiles": { - "id": 10, - "output_name": "output1" - }, - "when": { - "id": 6, - "output_name": "Has multiple samples" - } - }, - "inputs": [], - "label": null, - "name": "Samtools merge", - "outputs": [ - { - "name": "output", - "type": "bam" - } - ], - "position": { - "left": 2622.2988641864786, - "top": 732.1479927873434 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "37c8eb55315d", - "name": "samtools_merge", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "03cf4998-54d1-43b4-9005-828e8e1da14c", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "14": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", - "errors": null, - "id": 14, - "input_connections": { - "pairs_path": { - "id": 11, - "output_name": "output_parsed_pairs" - } - }, - "inputs": [], - "label": null, - "name": "Pairtools dedup", - "outputs": [ - { - "name": "output_dedup_pairs", - "type": "input" - }, - { - "name": "dedup_pairs_stats", - "type": "tabular" - } - ], - "position": { - "left": 3269.7967904728735, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActiondedup_pairs_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "dedup_pairs_stats" - }, - "HideDatasetActionoutput_dedup_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_dedup_pairs" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", - "tool_shed_repository": { - "changeset_revision": "3d1d241ceff2", - "name": "pairtools_dedup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"compress_output\": true, \"mark_dups\": true, \"max_mismatch\": \"0\", \"output_bytile_stats\": false, \"output_dups\": false, \"output_stats\": true, \"pairs_path\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.3+galaxy6", - "type": "tool", - "uuid": "222ad224-925a-495f-ab74-44c2fb2af4a4", - "when": null, - "workflow_outputs": [] - }, - "15": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 15, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 13, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 12, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 3030.7036252124967, - "top": 771.7493692529479 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Merged Hi-C Alignments on Scaffolds" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "merged_alignments_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "e9571afc-84e8-44b7-a213-8d484124a0bc", - "when": null, - "workflow_outputs": [ - { - "label": "Merged Hi-C Alignments on Scaffolds", - "output_name": "data_param", - "uuid": "73c1bd3b-29d8-4b4c-b62c-eb105c50c455" - } - ] - }, - "16": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", - "errors": null, - "id": 16, - "input_connections": { - "input_tabular": { - "id": 14, - "output_name": "dedup_pairs_stats" - } - }, - "inputs": [], - "label": null, - "name": "Column join", - "outputs": [ - { - "name": "tabular_output", - "type": "tabular" - } - ], - "position": { - "left": 3643.390891223076, - "top": 513.4889769208286 - }, - "post_job_actions": { - "RenameDatasetActiontabular_output": { - "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds: Raw" - }, - "action_type": "RenameDatasetAction", - "output_name": "tabular_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", - "tool_shed_repository": { - "changeset_revision": "3ddd99c7efee", - "name": "collection_column_join", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"fill_char\": \".\", \"has_header\": \"0\", \"identifier_column\": \"1\", \"include_outputs\": null, \"input_tabular\": {\"__class__\": \"ConnectedValue\"}, \"old_col_in_header\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.3", - "type": "tool", - "uuid": "9b13d478-eb6a-410d-9fb0-aa13a4543d0e", - "when": null, - "workflow_outputs": [ - { - "label": "Hi-C duplication stats on Scaffolds: Raw", - "output_name": "tabular_output", - "uuid": "d8a7cd1e-0599-4689-a043-9abbd78ba998" - } - ] - }, - "17": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", - "errors": null, - "id": 17, - "input_connections": { - "results_0|software_cond|input": { - "id": 14, - "output_name": "dedup_pairs_stats" - } - }, - "inputs": [], - "label": "Pairtools Multiqc", - "name": "MultiQC", - "outputs": [ - { - "name": "plots", - "type": "input" - }, - { - "name": "png_plot", - "type": "input" - }, - { - "name": "html_report", - "type": "html" - }, - { - "name": "stats", - "type": "tabular" - } - ], - "position": { - "left": 3989.2982637108043, - "top": 301.5986199229453 - }, - "post_job_actions": { - "ChangeDatatypeActionstats": { - "action_arguments": { - "newtype": "tsv" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "stats" - }, - "HideDatasetActionplots": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "plots" - }, - "RenameDatasetActionhtml_report": { - "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds: MultiQc" - }, - "action_type": "RenameDatasetAction", - "output_name": "html_report" - }, - "RenameDatasetActionpng_plot": { - "action_arguments": { - "newname": "Pairtools MultiQc on Scaffolds: Plots" - }, - "action_type": "RenameDatasetAction", - "output_name": "png_plot" - }, - "RenameDatasetActionstats": { - "action_arguments": { - "newname": "Pairtools Multiqc Stats on Scaffolds" - }, - "action_type": "RenameDatasetAction", - "output_name": "stats" - }, - "TagDatasetActionhtml_report": { - "action_arguments": { - "tags": "hic_dup_multiqc_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "html_report" - }, - "TagDatasetActionstats": { - "action_arguments": { - "tags": "hic_dup_raw_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "stats" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", - "tool_shed_repository": { - "changeset_revision": "862943c10425", - "name": "multiqc", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 40, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.33+galaxy3", - "type": "tool", - "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", - "when": null, - "workflow_outputs": [ - { - "label": "Pairtools Multiqc Stats on Scaffolds", - "output_name": "stats", - "uuid": "4a116025-b7d6-48b1-adb9-f0023cd84582" - }, - { - "label": "Hi-C duplication stats on Scaffolds: MultiQc", - "output_name": "html_report", - "uuid": "97ad859e-9e00-493b-bc24-c953af6ba495" - }, - { - "label": "Pairtools MultiQc on Scaffolds: Plots", - "output_name": "png_plot", - "uuid": "7992a75f-dca5-41fe-84e0-ae612a7c5ac6" - } - ] - }, - "18": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "errors": null, - "id": 18, - "input_connections": { - "bamfile": { - "id": 15, - "output_name": "data_param" - }, - "when": { - "id": 4, - "output_name": "output" - } - }, - "inputs": [], - "label": "Remove duplicates", - "name": "Samtools markdup", - "outputs": [ - { - "name": "output", - "type": "bam" - }, - { - "name": "stats_output", - "type": "txt" - } - ], - "position": { - "left": 3513.4500625546125, - "top": 904.7579298870468 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - }, - "HideDatasetActionstats_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "stats_output" - }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "name:no_duplicates" - }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "ef678e1f70a2", - "name": "samtools_markdup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "294a749f-e96a-45d7-9e2b-fd71d0afe5b2", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "19": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "errors": null, - "id": 19, - "input_connections": { - "bamfile": { - "id": 15, - "output_name": "data_param" - }, - "when": { - "id": 8, - "output_name": "output_param_boolean" - } - }, - "inputs": [], - "label": "Keep duplicated", - "name": "Samtools markdup", - "outputs": [ - { - "name": "output", - "type": "bam" - }, - { - "name": "stats_output", - "type": "txt" - } - ], - "position": { - "left": 3505.1000217766386, - "top": 1184.7675817632073 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - }, - "HideDatasetActionstats_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "stats_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "ef678e1f70a2", - "name": "samtools_markdup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": false, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "9172e934-6ce0-4bc6-a526-e3d3fe539e58", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "20": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 20, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 18, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 19, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 3895.0499323909808, - "top": 959.7107727965537 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Precuration Hi-C alignments" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "precur_hic_alignments" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", - "when": null, - "workflow_outputs": [ - { - "label": "Precuration Hi-C alignments", - "output_name": "data_param", - "uuid": "7a45c47e-138b-4a85-8df7-82fc71fd587a" - } - ] - }, - "21": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 21, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 18, - "output_name": "stats_output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 19, - "output_name": "stats_output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 3894.1790786103747, - "top": 1189.1824762726665 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "hic_dup_stats_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "e1be9200-6f90-4b6f-a920-416e730a4721", - "when": null, - "workflow_outputs": [ - { - "label": "Hi-C duplication stats on Scaffolds", - "output_name": "data_param", - "uuid": "474d51ef-99fd-4718-a403-497eab1db380" - } - ] - } - }, - "tags": [], - "uuid": "fbaaa11a-d22f-4eaf-83df-6356de4e95ea" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "cbc36287-42a8-4989-b9f0-71f32229c140", - "when": null, - "workflow_outputs": [ - { - "label": "Pairtools Multiqc Stats on Scaffolds", - "output_name": "Pairtools Multiqc Stats on Scaffolds", - "uuid": "f6e65a23-e1e9-4d7a-9002-7cb6290f3c17" - }, - { - "label": "Pairtools MultiQc on Scaffolds: Plots", - "output_name": "Pairtools MultiQc on Scaffolds: Plots", - "uuid": "1eeda1e7-9e92-4391-bc75-68f454a5e45f" - }, - { - "label": "Alignments", - "output_name": "Alignments", - "uuid": "438502d4-1283-4e9b-bf4c-8ceafe365ddf" - }, - { - "label": "Precuration Hi-C alignments", - "output_name": "Precuration Hi-C alignments", - "uuid": "6b3631b2-9f33-4697-8294-cc0091a26988" - }, - { - "label": "Trimmed Hi-C data", - "output_name": "Trimmed Hi-C data", - "uuid": "dcfda183-0f3d-4230-8df5-c5cdf57ce8ed" - }, - { - "label": "Hi-C duplication stats on Scaffolds: Raw", - "output_name": "Hi-C duplication stats on Scaffolds: Raw", - "uuid": "9029ce2c-a017-40d8-a2fa-fb5a1f5e633b" - }, - { - "label": "Merged Hi-C Alignments on Scaffolds", - "output_name": "Merged Hi-C Alignments on Scaffolds", - "uuid": "5e57b67b-0d56-4bde-8fd2-3d974e378137" - }, - { - "label": "Hi-C duplication stats on Scaffolds: MultiQc", - "output_name": "Hi-C duplication stats on Scaffolds: MultiQc", - "uuid": "08d9dbc2-45e9-4f9b-ac5d-bfa3ae3e6212" - }, - { - "label": "Hi-C duplication stats on Scaffolds", - "output_name": "Hi-C duplication stats on Scaffolds", - "uuid": "04e4799b-2eaf-4ea1-875b-33a4b8948a35" - } - ] - }, - "35": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", - "errors": null, - "id": 35, - "input_connections": { - "canonical": { - "id": 19, - "output_name": "output" - }, - "input_sequence": { - "id": 32, - "output_name": "data_param" - }, - "patterns": { - "id": 20, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Teloscope", - "outputs": [ - { - "name": "terminal_telomeres", - "type": "bed" - }, - { - "name": "telo_report", - "type": "tabular" - } - ], - "position": { - "left": 2387.6812133789062, - "top": 1382.1624755859375 - }, - "post_job_actions": { - "RenameDatasetActiontelo_report": { - "action_arguments": { - "newname": "Telomere Report" - }, - "action_type": "RenameDatasetAction", - "output_name": "telo_report" - }, - "RenameDatasetActionterminal_telomeres": { - "action_arguments": { - "newname": "terminal telomeres" - }, - "action_type": "RenameDatasetAction", - "output_name": "terminal_telomeres" - }, - "TagDatasetActiontelo_report": { - "action_arguments": { - "tags": "telomere_report" - }, - "action_type": "TagDatasetAction", - "output_name": "telo_report" - }, - "TagDatasetActionterminal_telomeres": { - "action_arguments": { - "tags": "terminal_telomeres" - }, - "action_type": "TagDatasetAction", - "output_name": "terminal_telomeres" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", - "tool_shed_repository": { - "changeset_revision": "321ceb58023e", - "name": "teloscope", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"canonical\": {\"__class__\": \"ConnectedValue\"}, \"edit_distance\": \"0\", \"input_sequence\": {\"__class__\": \"ConnectedValue\"}, \"max_block_distance\": \"200\", \"max_match_distance\": \"50\", \"min_block_density\": \"0.5\", \"min_block_length\": \"500\", \"out_entropy\": false, \"out_gc\": false, \"out_its\": false, \"out_matches\": false, \"out_win_repeats\": false, \"patterns\": {\"__class__\": \"ConnectedValue\"}, \"step\": \"500\", \"terminal_limit\": \"50000\", \"ultra_fast\": true, \"verbose\": false, \"window\": \"1000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.3+galaxy1", - "type": "tool", - "uuid": "437d8023-f3b8-47d0-a34e-56b0471de43f", - "when": null, - "workflow_outputs": [ - { - "label": "terminal telomeres", - "output_name": "terminal_telomeres", - "uuid": "edf9292a-fd55-4391-80ca-d8e0eef89960" - }, - { - "label": "Telomere Report", - "output_name": "telo_report", - "uuid": "83cf865b-a124-4a84-9cf7-8bb6d966ad7c" - } - ] - }, - "36": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", - "errors": null, - "id": 36, - "input_connections": { - "input_file": { - "id": 32, - "output_name": "data_param" - } - }, - "inputs": [], - "label": null, - "name": "gfastats", - "outputs": [ - { - "name": "stats", - "type": "tabular" - } - ], - "position": { - "left": 2806.71773975613, - "top": 998.8499106927812 - }, - "post_job_actions": { - "ChangeDatatypeActionstats": { - "action_arguments": { - "newtype": "bed" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "stats" - }, - "RenameDatasetActionstats": { - "action_arguments": { - "newname": "Gaps Bed" - }, - "action_type": "RenameDatasetAction", - "output_name": "stats" - }, - "TagDatasetActionstats": { - "action_arguments": { - "tags": "Gaps_bed" - }, - "action_type": "TagDatasetAction", - "output_name": "stats" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", - "tool_shed_repository": { - "changeset_revision": "10dc0f5a82e2", - "name": "gfastats", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.3.11+galaxy2", - "type": "tool", - "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", - "when": null, - "workflow_outputs": [ - { - "label": "Gaps Bed", - "output_name": "stats", - "uuid": "4a7f2ef2-c635-4ddb-b23b-8546f9290ef9" - } - ] - }, - "37": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 37, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 23, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 32, - "output_name": "data_param" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1754.538310590754, - "top": 2590.4403003291627 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "3a32edd4-d4e1-4837-a3d2-3d5a26c4f330", - "when": null, - "workflow_outputs": [] - }, - "38": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", - "errors": null, - "id": 38, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 31, - "output_name": "data_param" - }, - "reference_source|ref_file": { - "id": 32, - "output_name": "data_param" - } - }, - "inputs": [], - "label": null, - "name": "Map with minimap2", - "outputs": [ - { - "name": "alignment_output", - "type": "bam" - } - ], - "position": { - "left": 2481.356559673871, - "top": 1969.797536524506 - }, - "post_job_actions": { - "HideDatasetActionalignment_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "alignment_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", - "tool_shed_repository": { - "changeset_revision": "3faf9a2bf58d", - "name": "minimap2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"b\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"end_bonus\": \"0\", \"score_N\": \"1\", \"no_end_flt\": true, \"jump_min_match\": \"3\", \"end_seed_pen\": \"6\", \"cap_sw_mem\": \"100m\", \"cap_kalloc\": \"500m\"}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false, \"copy_comments\": false, \"ds_tag\": false, \"secondary_seq\": false, \"two_io_threads\": false, \"seed\": null}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null, \"rmq_inner\": \"1000\", \"no_hash_name\": false, \"pairing\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.30+galaxy0", - "type": "tool", - "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", - "when": null, - "workflow_outputs": [] - }, - "39": { - "annotation": "", - "id": 39, - "input_connections": { - "Database for Compleasm": { - "id": 4, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Haplotype 1": { - "id": 33, - "input_subworkflow_step_id": 2, - "output_name": "data_param" - }, - "Haplotype 2": { - "id": 30, - "input_subworkflow_step_id": 4, - "output_name": "data_param" - }, - "Lineage for Compleasm": { - "id": 3, - "input_subworkflow_step_id": 0, - "output_name": "output" - }, - "Will you use a second haplotype?": { - "id": 6, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Gene Tracks for PretextMap", - "outputs": [], - "position": { - "left": 2859.614458148943, - "top": 240.65437722692624 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [ - { - "child_steps": [ - 5, - 6, - 7, - 8, - 9, - 10, - 11, - 12 - ], - "color": "turquoise", - "data": { - "title": "Gene Annotations" - }, - "id": 0, - "position": [ - 533.1600054474995, - 0 - ], - "size": [ - 1878, - 674 - ], - "type": "frame" - } - ], - "creator": [ - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6228-2785", - "name": "Patrik Smeds" - }, - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6421-3484", - "name": "Delphine Lariviere" - } - ], - "format-version": "0.1", - "license": "MIT", - "name": "Gene Tracks for PretextMap", - "report": { - "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nMarkduplicate deduplication stats (if applicable)\n\n```galaxy\nhistory_dataset_embedded(output=\"Markduplicates Summary\")\n```\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n\n\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Lineage for Compleasm" - } - ], - "label": "Lineage for Compleasm", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 0, - "top": 85.32391557497368 - }, - "tool_id": null, - "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "c5aa113e-5a56-4b29-8d56-6c1eb8a3fd25", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Database for Compleasm" - } - ], - "label": "Database for Compleasm", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 41.75634461605, - "top": 182.8222030363895 - }, - "tool_id": null, - "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "c5675865-8136-4234-b434-c3c9c1f64d63", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "Assembly for Haplotype 1.", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 1.", - "name": "Haplotype 1" - } - ], - "label": "Haplotype 1", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 61.29385043769571, - "top": 275.80325102051034 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Will you use a second haplotype?" - } - ], - "label": "Will you use a second haplotype?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 99.30947543769571, - "top": 372.6782510205104 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "697b66dc-1c0f-40d7-9d03-51318db580f1", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "content_id": null, - "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "name": "Haplotype 2" - } - ], - "label": "Haplotype 2", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 146.6219754376957, - "top": 485.6470010205102 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "errors": null, - "id": 5, - "input_connections": { - "busco_database": { - "id": 1, - "output_name": "output" - }, - "input": { - "id": 2, - "output_name": "output" - }, - "lineage_dataset": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "compleasm", - "outputs": [ - { - "name": "full_table_busco", - "type": "tsv" - }, - { - "name": "miniprot", - "type": "gff3" - } - ], - "position": { - "left": 905.7228651529651, - "top": 37.836439137037075 - }, - "post_job_actions": { - "HideDatasetActionfull_table_busco": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionfull_table_busco": { - "action_arguments": { - "newname": "Compleasm hap1 - Busco" - }, - "action_type": "RenameDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionminiprot": { - "action_arguments": { - "newname": "Compleasm hap1 - Miniprot" - }, - "action_type": "RenameDatasetAction", - "output_name": "miniprot" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "tool_shed_repository": { - "changeset_revision": "fc7334661489", - "name": "compleasm", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.6+galaxy3", - "type": "tool", - "uuid": "e4ca5b86-c0b2-464a-b382-a4f4e97c40a0", - "when": null, - "workflow_outputs": [ - { - "label": "Compleasm hap1 - Miniprot", - "output_name": "miniprot", - "uuid": "336d5918-9421-4d36-b2e0-e89209c0d6bb" - }, - { - "label": "Compleasm hap1 - Busco", - "output_name": "full_table_busco", - "uuid": "9433e53e-de87-4279-8401-84d955a35da0" - } - ] - }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "errors": null, - "id": 6, - "input_connections": { - "busco_database": { - "id": 1, - "output_name": "output" - }, - "input": { - "id": 4, - "output_name": "output" - }, - "lineage_dataset": { - "id": 0, - "output_name": "output" - }, - "when": { - "id": 3, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "compleasm", - "outputs": [ - { - "name": "full_table_busco", - "type": "tsv" - }, - { - "name": "miniprot", - "type": "gff3" - } - ], - "position": { - "left": 904.6898830986931, - "top": 334.1815908697498 - }, - "post_job_actions": { - "HideDatasetActionfull_table_busco": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionfull_table_busco": { - "action_arguments": { - "newname": "Compleasm hap2 - Busco" - }, - "action_type": "RenameDatasetAction", - "output_name": "full_table_busco" - }, - "RenameDatasetActionminiprot": { - "action_arguments": { - "newname": "Compleasm hap2 - Miniprot" - }, - "action_type": "RenameDatasetAction", - "output_name": "miniprot" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", - "tool_shed_repository": { - "changeset_revision": "fc7334661489", - "name": "compleasm", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.6+galaxy3", - "type": "tool", - "uuid": "f1c6f5a9-c3a6-42b3-ae7c-8a10068550b3", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "Compleasm hap2 - Miniprot", - "output_name": "miniprot", - "uuid": "d85e1256-c930-44d3-a7a5-632e74d0f3db" - }, - { - "label": "Compleasm hap2 - Busco", - "output_name": "full_table_busco", - "uuid": "e96ed079-858f-4610-ad93-844fd95f77c2" - } - ] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "errors": null, - "id": 7, - "input_connections": { - "inputs": [ - { - "id": 5, - "output_name": "miniprot" - }, - { - "id": 6, - "output_name": "miniprot" - } - ] - }, - "inputs": [], - "label": null, - "name": "Concatenate datasets", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 1153.9599688264059, - "top": 242.00007324218757 - }, - "post_job_actions": { - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Merged Compleasm Gffs" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "1185817d-9a3a-4949-912a-3d0738f6f112", - "when": null, - "workflow_outputs": [ - { - "label": "Merged Compleasm Gffs", - "output_name": "out_file1", - "uuid": "5e40c8c2-7163-45e3-9e1c-98765e2486ee" - } - ] - }, - "8": { - "annotation": "", - "content_id": "gff2bed1", - "errors": null, - "id": 8, - "input_connections": { - "input": { - "id": 7, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "GFF-to-BED", - "outputs": [ - { - "name": "out_file1", - "type": "bed" - } - ], - "position": { - "left": 1332.1163408967184, - "top": 460.55012207031257 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "gff2bed1", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.1", - "type": "tool", - "uuid": "8b3c70e3-68f4-4af1-a91d-3d4a2aebee15", - "when": null, - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "Filter1", - "errors": null, - "id": 9, - "input_connections": { - "input": { - "id": 8, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Keep CDS", - "name": "Filter", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 1443.2725908967184, - "top": 119.82502441406257 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Filter1", - "tool_state": "{\"cond\": \"c4=='CDS'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.1", - "type": "tool", - "uuid": "61b1c6f2-cb71-470b-973a-5065c32b4275", - "when": null, - "workflow_outputs": [] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", - "errors": null, - "id": 10, - "input_connections": { - "infile": { - "id": 9, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Unique lines", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 1675.5415117951559, - "top": 273.86872558593757 - }, - "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"grouping\": {\"grouping_select\": \"no\", \"__current_case__\": 0, \"count\": false, \"repeated\": false, \"uniqueonly\": true}, \"ignorecase\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"skipfields\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "96bd05b5-633e-4b34-8cef-fd09cf615cac", - "when": null, - "workflow_outputs": [] - }, - "11": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 11, - "input_connections": { - "input": { - "id": 10, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 1873.7536699982809, - "top": 436.83759765625007 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "3c457431-0357-4287-bb3d-16dfca800c6a", - "when": null, - "workflow_outputs": [] - }, - "12": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", - "errors": null, - "id": 12, - "input_connections": { - "input": { - "id": 11, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Add column", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 2105.841072342031, - "top": 490.40009765625007 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Compleasm Genes track" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "gene_bedgraph" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", - "tool_shed_repository": { - "changeset_revision": "023f0a3760b3", - "name": "add_value", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.1", - "type": "tool", - "uuid": "09fd742a-1113-4ded-a5f1-0ee1200d30a0", - "when": null, - "workflow_outputs": [ - { - "label": "Compleasm Genes track", - "output_name": "out_file1", - "uuid": "94f1d13d-0964-4469-bb33-416a6012dcd0" - } - ] - } - }, - "tags": [], - "uuid": "7fc536e9-da91-49ef-b42c-32ae1d0ac00c" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "d0a10285-7606-4302-ba3b-5c43b42e2602", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "Compleasm Genes track", - "output_name": "Compleasm Genes track", - "uuid": "f8399762-1903-4af7-ba37-4c75350cef30" - } - ] - }, - "40": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "errors": null, - "id": 40, - "input_connections": { - "highRes": { - "id": 15, - "output_name": "output" - }, - "input": { - "id": 34, - "output_name": "Precuration Hi-C alignments" - }, - "map_qual": { - "id": 18, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "PretextMap", - "outputs": [ - { - "name": "pretext_map_out", - "type": "pretext" - } - ], - "position": { - "left": 3973.4164481149905, - "top": 1136.237612582866 - }, - "post_job_actions": { - "HideDatasetActionpretext_map_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" - }, - "TagDatasetActionpretext_map_out": { - "action_arguments": { - "tags": "haps_pretext" - }, - "action_type": "TagDatasetAction", - "output_name": "pretext_map_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", - "type": "tool", - "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", - "when": null, - "workflow_outputs": [] - }, - "41": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "errors": null, - "id": 41, - "input_connections": { - "highRes": { - "id": 15, - "output_name": "output" - }, - "input": { - "id": 34, - "output_name": "Precuration Hi-C alignments" - } - }, - "inputs": [], - "label": "PretextMap - Multimapping", - "name": "PretextMap", - "outputs": [ - { - "name": "pretext_map_out", - "type": "pretext" - } - ], - "position": { - "left": 4136.625251693286, - "top": 346.86115561767815 - }, - "post_job_actions": { - "HideDatasetActionpretext_map_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" - }, - "TagDatasetActionpretext_map_out": { - "action_arguments": { - "tags": "haps_pretext" - }, - "action_type": "TagDatasetAction", - "output_name": "pretext_map_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", - "type": "tool", - "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", - "when": null, - "workflow_outputs": [] - }, - "42": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "errors": null, - "id": 42, - "input_connections": { - "input": { - "id": 34, - "output_name": "Precuration Hi-C alignments" - } - }, - "inputs": [], - "label": "PretextMap - Multimapping low res", - "name": "PretextMap", - "outputs": [ - { - "name": "pretext_map_out", - "type": "pretext" - } - ], - "position": { - "left": 5765.761554435896, - "top": 777.3727930905267 - }, - "post_job_actions": { - "HideDatasetActionpretext_map_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", - "type": "tool", - "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", - "when": null, - "workflow_outputs": [] - }, - "43": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "errors": null, - "id": 43, - "input_connections": { - "input": { - "id": 34, - "output_name": "Precuration Hi-C alignments" - }, - "map_qual": { - "id": 18, - "output_name": "output" - } - }, - "inputs": [], - "label": "PretextMap low res", - "name": "PretextMap", - "outputs": [ - { - "name": "pretext_map_out", - "type": "pretext" - } - ], - "position": { - "left": 5673.928332926333, - "top": 1567.174596178742 - }, - "post_job_actions": { - "HideDatasetActionpretext_map_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_map_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", - "type": "tool", - "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", - "when": null, - "workflow_outputs": [] - }, - "44": { - "annotation": "", - "content_id": "Filter1", - "errors": null, - "id": 44, - "input_connections": { - "input": { - "id": 35, - "output_name": "terminal_telomeres" - } - }, - "inputs": [], - "label": "Select Q telomeres", - "name": "Filter", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 2626.2625122070312, - "top": 1262.8624877929688 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "name:q" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Filter1", - "tool_state": "{\"cond\": \"c5=='q'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.1", - "type": "tool", - "uuid": "a73922af-2560-4a97-853a-ca8a5498686f", - "when": null, - "workflow_outputs": [] - }, - "45": { - "annotation": "", - "content_id": "Filter1", - "errors": null, - "id": 45, - "input_connections": { - "input": { - "id": 35, - "output_name": "terminal_telomeres" - } - }, - "inputs": [], - "label": "Select P telomeres", - "name": "Filter", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 2665.8374633789062, - "top": 1619.3125 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "name:p" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Filter1", - "tool_state": "{\"cond\": \"c5=='p'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.1", - "type": "tool", - "uuid": "37467b63-9fb8-4488-85cb-0c748f625b55", - "when": null, - "workflow_outputs": [] - }, - "46": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", - "errors": null, - "id": 46, - "input_connections": { - "input": { - "id": 36, - "output_name": "stats" - } - }, - "inputs": [], - "label": null, - "name": "Compute", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 3034.7278944620984, - "top": 999.5879286334185 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Gaps Bedgraph" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "Gaps" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", - "tool_shed_repository": { - "changeset_revision": "61f9ddbc63ca", - "name": "column_maker", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.1+galaxy0", - "type": "tool", - "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", - "when": null, - "workflow_outputs": [ - { - "label": "Gaps Bedgraph", - "output_name": "out_file1", - "uuid": "9fa64361-b645-4ca3-91cd-4a0d13f13a41" - } - ] - }, - "47": { - "annotation": "", - "content_id": "CONVERTER_gz_to_uncompressed", - "errors": null, - "id": 47, - "input_connections": { - "input1": { - "id": 37, - "output_name": "data_param" - }, - "when": { - "id": 22, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Convert gz compressed file to uncompressed.", - "outputs": [ - { - "name": "output1", - "type": "auto" - } - ], - "position": { - "left": 2360.837093879186, - "top": 2649.969030395428 - }, - "post_job_actions": { - "ChangeDatatypeActionoutput1": { - "action_arguments": { - "newtype": "fasta" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "output1" - } - }, - "tool_id": "CONVERTER_gz_to_uncompressed", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.0", - "type": "tool", - "uuid": "3573f560-1fd1-4748-94f5-530c89717387", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "48": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", - "errors": null, - "id": 48, - "input_connections": { - "bamfiles": { - "id": 38, - "output_name": "alignment_output" - }, - "when": { - "id": 27, - "output_name": "Has multiple samples" - } - }, - "inputs": [], - "label": null, - "name": "Samtools merge", - "outputs": [ - { - "name": "output", - "type": "bam" - } - ], - "position": { - "left": 2737.3809424386664, - "top": 1876.5829215416961 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "37c8eb55315d", - "name": "samtools_merge", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "48c3b202-85ca-447b-8f91-fbc440e33366", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "49": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 49, - "input_connections": { - "input": { - "id": 38, - "output_name": "alignment_output" - }, - "when": { - "id": 27, - "output_name": "Has a single sample" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 2737.1827748438227, - "top": 2185.366944111388 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "72de31ed-6ef4-4f67-9150-459573b7e7e5", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "50": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", - "errors": null, - "id": 50, - "input_connections": { - "input": { - "id": 42, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": null, - "name": "Pretext Snapshot", - "outputs": [ - { - "name": "pretext_snap_out", - "type": "input" - } - ], - "position": { - "left": 6099.3355097740405, - "top": 778.0990311701319 - }, - "post_job_actions": { - "HideDatasetActionpretext_snap_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_snap_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", - "tool_shed_repository": { - "changeset_revision": "c4fb391275a0", - "name": "pretext_snapshot", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.7+galaxy0", - "type": "tool", - "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", - "when": null, - "workflow_outputs": [] - }, - "51": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", - "errors": null, - "id": 51, - "input_connections": { - "input": { - "id": 43, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": null, - "name": "Pretext Snapshot", - "outputs": [ - { - "name": "pretext_snap_out", - "type": "input" - } - ], - "position": { - "left": 6019.383156159895, - "top": 1473.3425883338787 - }, - "post_job_actions": { - "HideDatasetActionpretext_snap_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "pretext_snap_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", - "tool_shed_repository": { - "changeset_revision": "c4fb391275a0", - "name": "pretext_snapshot", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.7+galaxy0", - "type": "tool", - "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", - "when": null, - "workflow_outputs": [] - }, - "52": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 52, - "input_connections": { - "input": { - "id": 44, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Q telomere bed", - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 2896.8187866210938, - "top": 1319.72509765625 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Q telomeres Bed" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "q_telomeres" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "676086b9-9a0a-40b2-8d7b-466ead68cf2b", - "when": null, - "workflow_outputs": [ - { - "label": "Q telomeres Bed", - "output_name": "out_file1", - "uuid": "b9b7d743-5f41-49f3-a640-5a68ee3a63a4" - } - ] - }, - "53": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 53, - "input_connections": { - "input": { - "id": 45, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "P telomere bed ", - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 2899.6375122070312, - "top": 1543.53125 - }, - "post_job_actions": { - "ChangeDatatypeActionout_file1": { - "action_arguments": { - "newtype": "bedgraph" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out_file1" - }, - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "P telomeres bed" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - }, - "TagDatasetActionout_file1": { - "action_arguments": { - "tags": "p_telomeres" - }, - "action_type": "TagDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "512bfacb-51f6-4820-a16e-61ec7b484be4", - "when": null, - "workflow_outputs": [ - { - "label": "P telomeres bed", - "output_name": "out_file1", - "uuid": "4b23fce7-a313-42ef-b365-783ee0bd24e6" - } - ] - }, - "54": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 54, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 39, - "output_name": "Compleasm Genes track" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 46, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 3663.9331595238805, - "top": 440.8730581971614 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "3158715d-0e51-4f0d-a427-d4c20744a9cb", - "when": null, - "workflow_outputs": [] - }, - "55": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 55, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 48, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 49, - "output_name": "output" - } - }, - "inputs": [], - "label": "Hifi Alignments", - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 3009.3609015626676, - "top": 2051.606896331395 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Merged HiFi Alignments" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "merged_hifi_align_precur" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "2afb1f1a-4687-4c63-9496-d66c63c23a01", - "when": null, - "workflow_outputs": [ - { - "label": "Merged HiFi Alignments", - "output_name": "data_param", - "uuid": "b0149c13-2ddf-4fb1-9939-5d38c8a98312" - } - ] - }, - "56": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 56, - "input_connections": { - "input": { - "id": 50, - "output_name": "pretext_snap_out" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 6385.092527631594, - "top": 742.7570387373108 - }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "Pretext Snapshot With tracks - Multimapping" - }, - "action_type": "RenameDatasetAction", - "output_name": "output" - }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "pretext_img_multimapping" - }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "7815d57b-da36-42a2-b25c-4cf3dbf89c69", - "when": null, - "workflow_outputs": [ - { - "label": "Pretext Snapshot With tracks - Multimapping", - "output_name": "output", - "uuid": "70a9b730-a184-47e3-ad69-de0034bf35ed" - } - ] - }, - "57": { - "annotation": "", - "content_id": "__EXTRACT_DATASET__", - "errors": null, - "id": 57, - "input_connections": { - "input": { - "id": 51, - "output_name": "pretext_snap_out" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ - { - "name": "output", - "type": "data" - } - ], - "position": { - "left": 6387.01295886191, - "top": 1600.5355317281906 - }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "Pretext Snapshot With tracks" - }, - "action_type": "RenameDatasetAction", - "output_name": "output" + ] + } }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "pretext_img_coverage" - }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "1a9ded49-abf8-425f-b4a2-abcbcb537aa0", - "when": null, - "workflow_outputs": [ - { - "label": "Pretext Snapshot With tracks", - "output_name": "output", - "uuid": "892bc21e-a9b2-4524-8b1e-02f2a139ab25" - } - ] - }, - "58": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 58, - "input_connections": { - "input1": { - "id": 52, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Test if Q telomere track is empty", - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 3158.901898076252, - "top": 1266.582592170533 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "7617ecee-71c5-40fc-b7a0-46ec5e6d09c6", - "when": null, - "workflow_outputs": [] - }, - "59": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 59, - "input_connections": { - "input1": { - "id": 53, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": "Test if P telomere track is empty", - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 3174.0897711185717, - "top": 1637.7439948451865 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } + "tags": [], + "uuid": "247a97c1-a0ec-4308-9280-a2ae4a42a18c" }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "eaf0278b-fb8e-4001-9def-bc26d8846694", - "when": null, + "tool_id": null, + "type": "subworkflow", + "uuid": "963aaf4e-14cf-449b-99b5-f3693b8b19b6", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "60": { + "29": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 60, + "id": 29, "input_connections": { - "bamInput": { - "id": 55, - "output_name": "data_param" + "style_cond|type_cond|pick_from_0|value": { + "id": 25, + "output_name": "Merged Haplotypes" }, - "binSize": { - "id": 21, - "output_name": "output" + "style_cond|type_cond|pick_from_1|value": { + "id": 28, + "output_name": "Processed Hap1" } }, "inputs": [], - "label": null, - "name": "bamCoverage", + "label": "Pick Assembly", + "name": "Pick parameter value", "outputs": [ { - "name": "outFileName", - "type": "bigwig" + "name": "data_param", + "type": "input" } ], "position": { - "left": 3268.6408118386503, - "top": 1932.8127046094655 + "left": 1438.4073811566127, + "top": 776.0878898442162 }, "post_job_actions": { - "RenameDatasetActionoutFileName": { + "RenameDatasetActiondata_param": { "action_arguments": { - "newname": "BigWig Coverage" + "newname": "Assembly for curation" }, "action_type": "RenameDatasetAction", - "output_name": "outFileName" + "output_name": "data_param" }, - "TagDatasetActionoutFileName": { + "TagDatasetActiondata_param": { "action_arguments": { - "tags": "coverage" + "tags": "merged_haps" }, "action_type": "TagDatasetAction", - "output_name": "outFileName" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", - "tool_shed_repository": { - "changeset_revision": "0e49b109abc2", - "name": "deeptools_bam_coverage", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bamInput\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"type\": \"no\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.5.4+galaxy0", - "type": "tool", - "uuid": "43e863a6-80b4-4c02-a249-ca7a6469ac01", - "when": null, - "workflow_outputs": [ - { - "label": "BigWig Coverage", - "output_name": "outFileName", - "uuid": "99e50ff7-22ae-4afc-af83-e81b69c73931" - } - ] - }, - "61": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", - "errors": null, - "id": 61, - "input_connections": { - "input_bams": { - "id": 55, "output_name": "data_param" } }, - "inputs": [], - "label": null, - "name": "Samtools depth", - "outputs": [ - { - "name": "output", - "type": "tabular" - } - ], - "position": { - "left": 3270.6159423253503, - "top": 2206.55560224621 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", - "tool_shed_repository": { - "changeset_revision": "fb6d5ffc365f", - "name": "samtools_depth", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"additional_options\": {\"required_flags\": null, \"skipped_flags\": [\"4\", \"256\", \"512\", \"1024\"], \"deletions\": false, \"single_read\": false}, \"all\": \"-a\", \"basequality\": null, \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"mapquality\": null, \"maxdepth\": null, \"minlength\": null, \"output_options\": {\"header\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy1", - "type": "tool", - "uuid": "75e128e1-596f-4804-9d3d-2788ee7bf5b3", - "when": null, - "workflow_outputs": [] - }, - "62": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 62, - "input_connections": { - "input_param_type|input_param": { - "id": 58, - "output_name": "text_param" - } - }, - "inputs": [], - "label": "False if Q telomere track is empty", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 3459.9078024663245, - "top": 1351.4977300677754 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "b19e21af9c52", + "name": "pick_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "3de1eefb-971f-4e56-9dd4-da995d9facc8", + "uuid": "c5cb7d6b-6d51-41cf-9914-c3df478246a9", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Assembly for curation", + "output_name": "data_param", + "uuid": "ef7e194c-19b7-4bc0-a6f7-f049d1a6b25d" + } + ] }, - "63": { + "30": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 63, + "id": 30, "input_connections": { - "input_param_type|input_param": { - "id": 59, - "output_name": "text_param" + "style_cond|type_cond|pick_from_0|value": { + "id": 25, + "output_name": "Processed Hap1" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 28, + "output_name": "Processed Hap1" } }, "inputs": [], - "label": "False if P telomere track is empty", - "name": "Map parameter value", + "label": null, + "name": "Pick parameter value", "outputs": [ { - "name": "output_param_boolean", - "type": "expression.json" + "name": "data_param", + "type": "input" } ], "position": { - "left": 3464.3675577025474, - "top": 1561.2479958064835 + "left": 2209.82453439378, + "top": 266.1637635391988 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Decontaminated Hap1 with Suffix" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "decont_hap1_suffix" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "b19e21af9c52", + "name": "pick_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "2ddee770-02bd-4e81-bb00-491a92b06dc1", + "uuid": "126228b7-2718-4db7-8eb4-0700ea2ff709", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Decontaminated Hap1 with Suffix", + "output_name": "data_param", + "uuid": "f5841bfd-2f87-4676-88a5-6c64f139c7e0" + } + ] }, - "64": { + "31": { "annotation": "", - "id": 64, + "id": 31, "input_connections": { - "Coverage": { - "id": 60, - "input_subworkflow_step_id": 6, - "output_name": "outFileName" - }, - "Gaps": { - "id": 36, - "input_subworkflow_step_id": 5, - "output_name": "stats" - }, - "Hap1 fasta": { - "id": 33, - "input_subworkflow_step_id": 0, - "output_name": "data_param" - }, - "Related Species": { - "id": 47, + "Do you want to trim the Hi-C data?": { + "id": 12, "input_subworkflow_step_id": 2, - "output_name": "output1" - }, - "Telomeres P": { - "id": 53, - "input_subworkflow_step_id": 4, - "output_name": "out_file1" + "output_name": "output" }, - "Telomeres Q": { - "id": 52, + "Estimated Genome Size": { + "id": 10, "input_subworkflow_step_id": 3, - "output_name": "out_file1" + "output_name": "output" }, - "Use related species": { - "id": 22, + "Hi-C reads": { + "id": 11, "input_subworkflow_step_id": 1, "output_name": "output" }, - "when": { - "id": 25, - "output_name": "output_param_boolean" + "Reference": { + "id": 29, + "input_subworkflow_step_id": 0, + "output_name": "data_param" + }, + "Remove HiC duplicates ?": { + "id": 13, + "input_subworkflow_step_id": 4, + "output_name": "output" } }, "inputs": [], "label": null, - "name": "Jbrowse for pre-curation single haplotype - 1 related Species ", + "name": "Trim, Align, deduplicate Hi-C - Precuration", "outputs": [], "position": { - "left": 3398.4932677353545, - "top": 2665.6965483971267 + "left": 1542.71875, + "top": 1481.2421875 }, "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], "format-version": "0.1", - "name": "Jbrowse for pre-curation single haplotype - 1 related Species ", + "license": "MIT", + "name": "Trim, Align, deduplicate Hi-C - Precuration", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, "steps": { "0": { - "annotation": "", + "annotation": "Assembly for Haplotype 1.", "content_id": null, "errors": null, "id": 0, "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 195.55555646042225 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 24.900863986875255, + "top": 291.3794148390879 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "name": "Do you want to trim the Hi-C data?" + } + ], + "label": "Do you want to trim the Hi-C data?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 87.29051288561523, + "top": 393.5028283812428 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6d1391db-7fef-4b5c-a236-26016d6d0aab", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome Size" + } + ], + "label": "Estimated Genome Size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 127.04701718304551, + "top": 529.6980690081494 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "75d82c6b-19cd-4ca8-86e3-2806f9c01e2b", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, "inputs": [ { "description": "", - "name": "Hap1 fasta" + "name": "Remove HiC duplicates ?" + } + ], + "label": "Remove HiC duplicates ?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 152.62563696711496, + "top": 635.2235514698903 + }, + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "id": 5, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" } - ], - "label": "Hap1 fasta", - "name": "Input dataset", + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", "outputs": [], "position": { - "left": 0, - "top": 686.8914778117049 + "left": 1351.2851229338844, + "top": 1158.78766917316 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" }, "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", + "type": "subworkflow", + "uuid": "45a60cd2-4176-46d6-9e72-62c4597f00ca", "when": null, "workflow_outputs": [] }, - "1": { + "6": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Use related species" + "id": 6, + "input_connections": { + "library|input_1": { + "id": 1, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" } - ], - "label": "Use related species", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 97.33530571454516, - "top": 833.1606579195632 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "71dda500-06c4-4a48-a224-7fde74d2748c", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ + "inputs": [], + "label": "Trim Hi-C reads 2", + "name": "Cutadapt", + "outputs": [ { - "description": "", - "name": "Related Species" - } - ], - "label": "Related Species", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 202.5747418320626, - "top": 962.9951825363166 - }, - "tool_id": null, - "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "771229b7-cdcc-462a-a1e5-314204a3fca1", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ + "name": "out_pairs", + "type": "input" + }, { - "description": "", - "name": "Telomeres Q" + "name": "report", + "type": "txt" } ], - "label": "Telomeres Q", - "name": "Input dataset", - "outputs": [], "position": { - "left": 287.6245497455406, - "top": 1093.6253398337244 + "left": 673.688898616038, + "top": 179.94029357204343 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Telomeres P" + "post_job_actions": { + "HideDatasetActionout_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_pairs" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Trimmed Hi-C Forward Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionout2": { + "action_arguments": { + "newname": "Trimmed Hi-C Reverse Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out2" } - ], - "label": "Telomeres P", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 360.4670294190771, - "top": 1217.260852908304 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 5, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Gaps" - } - ], - "label": "Gaps", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 428.24001452834693, - "top": 1339.6729807500467 + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", - "when": null, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "0911f75c-8b87-4d51-943e-40b6500e8b35", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "6": { + "7": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 6, - "input_connections": {}, - "inputs": [ + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": "False when removal is true", + "name": "Map parameter value", + "outputs": [ { - "description": "", - "name": "Coverage" + "name": "output_param_boolean", + "type": "expression.json" } ], - "label": "Coverage", - "name": "Input dataset", - "outputs": [], "position": { - "left": 525.7135234989578, - "top": 1459.6992362130693 + "left": 972.1510215857712, + "top": 815.2317568452488 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "738f43fc-5f88-4117-bcc3-4a9c1b01c0a1", + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", "when": null, "workflow_outputs": [] }, - "7": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 7, + "id": 8, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 2, - "output_name": "output" + "id": 6, + "output_name": "out_pairs" }, "style_cond|type_cond|pick_from_1|value": { - "id": 0, + "id": 1, "output_name": "output" } }, @@ -7311,1881 +3241,4885 @@ } ], "position": { - "left": 619.5075673031254, - "top": 971.9101001267942 + "left": 999.2019776562693, + "top": 374.61376378472 }, "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Trimmed Hi-C data" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "hic_trimmed" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "6a4b6c8a-7de9-49eb-9088-da803e2842dc", + "when": null, + "workflow_outputs": [ + { + "label": "Trimmed Hi-C data", + "output_name": "data_param", + "uuid": "73027165-8c18-45a9-9df1-76e3cc2421fb" + } + ] + }, + "9": { + "annotation": "", + "id": 9, + "input_connections": { + "Estimated Genome size": { + "id": 3, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Hi-C reads": { + "id": 8, + "input_subworkflow_step_id": 1, "output_name": "data_param" }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Haplotype 2" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "Reference": { + "id": 0, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "", + "name": "Size dependent alignment" + } + ], + "label": "Size dependent alignment", + "name": "Optional alignement", + "outputs": [], + "position": { + "left": 1393.73032928119, + "top": 0 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Optional alignement", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 120.9261596776607 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 24.900863986875255, + "top": 216.7500180563263 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome size" + } + ], + "label": "Estimated Genome size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 71.39700103875718, + "top": 335.3499420786681 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d4563544-4752-4a01-8658-9f143d4a282d", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "id": 3, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 1523.5635698054007, + "top": 898.4287267590571 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "3df9e273-7596-4cfd-a083-e7329f5c9119", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "True if Genome size higher than 10Gb", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 507.38482635055703, + "top": 574.7760027766403 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{if ($1 >= 10000000000) print \\\"true\\\"; else print \\\"false\\\"} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "af759549-bbe3-4923-8e5a-a62952106de0", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 4, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 752.2943156269191, + "top": 680.0377136696699 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e4ffd666-dc5a-4ded-bcd2-67e2a7ecb203", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome smaller than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1000.911391627979, + "top": 374.36198514548585 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"false\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"true\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8d02989c-49bb-4b66-9b2a-418f1adc4d9e", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome bigger than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 996.9096769207425, + "top": 647.9665315266978 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"true\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"false\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9515d07b-297d-4261-8773-a71e4986a503", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 1416.7165099815827, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "10446b69-0dc2-4e05-84da-647b70d6bad9", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "errors": null, + "id": 9, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Map with BWA-MEM", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2067.262583043971, + "top": 613.2228557089854 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "cebb83f8-86b3-4a6e-b377-9d49f414730c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 8, + "output_name": "index" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1758.2954333536668, + "top": 274.1130105826607 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "1402a65e-66da-4598-8f65-808c75a2ba6a", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 10, + "output_name": "data_param" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2081.206563661144, + "top": 311.57812928123315 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 12, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 11, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 9, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2613.358073103046, + "top": 476.71963493441115 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0279f93e-3825-41fd-a2aa-7c346ac39b37", + "when": null, + "workflow_outputs": [ + { + "label": "Alignments", + "output_name": "data_param", + "uuid": "dbe0fa6e-d89f-4c0b-a465-20543e4886d5" + } + ] + }, + "13": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 13, + "input_connections": { + "input": { + "id": 12, + "output_name": "data_param" + }, + "when": { + "id": 3, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 3390.237666600868, + "top": 592.4139779736178 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "0e8e2d15-b317-4632-936b-a85ba4811ac8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "errors": null, + "id": 14, + "input_connections": { + "bamfiles": { + "id": 12, + "output_name": "data_param" + }, + "when": { + "id": 3, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 3390.6826706631687, + "top": 878.4197987630438 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "77fbb7c6-9430-4d88-ad5f-e7161d541142", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 15, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 14, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 13, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3764.411748680119, + "top": 806.7051169013986 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Precuration Hi-C alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds,precur_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9d3c6d02-f461-4197-86d1-a70ac35f15ba", + "when": null, + "workflow_outputs": [ + { + "label": "Precuration Hi-C alignments", + "output_name": "data_param", + "uuid": "f8476f37-1eaa-474b-981b-eb9086627373" + } + ] + } + }, + "tags": [], + "uuid": "5af42851-d8d8-4e6b-9c4e-4d146e8a34f1" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "cad00f23-5894-47db-82ed-268f774ccaea", - "when": null, + "tool_id": null, + "type": "subworkflow", + "uuid": "37ccbbb0-f709-48b1-b4a0-dabbc5ce599a", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "8": { + "10": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", - "errors": null, - "id": 8, + "id": 10, "input_connections": { - "assemblies_0|reference_genome|genome": { - "id": 0, - "output_name": "output" - }, - "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "Estimated Genome size": { "id": 3, + "input_subworkflow_step_id": 2, "output_name": "output" }, - "assemblies_0|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { - "id": 4, - "output_name": "output" + "Hi-C reads": { + "id": 8, + "input_subworkflow_step_id": 1, + "output_name": "data_param" }, - "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 5, + "Reference": { + "id": 0, + "input_subworkflow_step_id": 0, "output_name": "output" }, - "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 6, + "when": { + "id": 4, "output_name": "output" } }, "inputs": [], - "label": "JBrowse2 Hap1 vs Hap2 with no related species", - "name": "JBrowse2", - "outputs": [ - { - "name": "output", - "type": "html" - } - ], + "label": null, + "name": "Optional alignement and deduplication", + "outputs": [], "position": { - "left": 1798.734334125839, - "top": 0 + "left": 1387.2517179347483, + "top": 551.239946496607 }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "JBrowse2 Single Haplotype" + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Optional alignement and deduplication", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 120.9261596776607 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 24.900863986875255, + "top": 216.7500180563263 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome size" + } + ], + "label": "Estimated Genome size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 163.31604558412107, + "top": 392.05355172952386 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d4563544-4752-4a01-8658-9f143d4a282d", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "id": 3, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 1677.9895124723516, + "top": 1209.8241932436654 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "0e5d977b-e036-4356-97de-c35b220554e1", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "True if Genome size higher than 10Gb", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 507.38482635055703, + "top": 574.7760027766403 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{if ($1 >= 10000000000) print \\\"true\\\"; else print \\\"false\\\"} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "af759549-bbe3-4923-8e5a-a62952106de0", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 4, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 752.2943156269191, + "top": 680.0377136696699 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e4ffd666-dc5a-4ded-bcd2-67e2a7ecb203", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd903fbbc26e", - "name": "jbrowse2", - "owner": "fubar", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Telomeres\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_off\"}}]}, {\"__index__\": 1, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.7.0+galaxy0", - "type": "tool", - "uuid": "252b3e45-ec8a-4989-bfe2-7c1e3285310b", - "when": null, - "workflow_outputs": [ - { - "label": "JBrowse2 Single Haplotype", - "output_name": "output", - "uuid": "20eb67af-6a5e-44f1-a9eb-4cd7c7cf627a" - } - ] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", - "errors": null, - "id": 9, - "input_connections": { - "query": { - "id": 0, - "output_name": "output" - }, - "reflist": { - "id": 7, - "output_name": "data_param" - }, - "when": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": "hap1 vs species", - "name": "mashmap", - "outputs": [ - { - "name": "mashout", - "type": "paf" - } - ], - "position": { - "left": 955.5494790136057, - "top": 786.0873120373774 - }, - "post_job_actions": { - "HideDatasetActionmashout": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "mashout" - }, - "RenameDatasetActionmashout": { - "action_arguments": { - "newname": "hap1 vs species" + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome smaller than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1041.6498874098133, + "top": 836.4638984886009 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"false\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"true\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8d02989c-49bb-4b66-9b2a-418f1adc4d9e", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "mashout" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "a3a6b0b31f2d", - "name": "mashmap", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"85.0\", \"query\": {\"__class__\": \"ConnectedValue\"}, \"reflist\": {\"__class__\": \"ConnectedValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.1.3+galaxy0", - "type": "tool", - "uuid": "b1a857dd-1140-4641-943b-cb141b6a6f81", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 10, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 9, - "output_name": "mashout" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1224.2937845515573, - "top": 1116.8354674745467 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Haplotype 2" + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome bigger than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1046.3414281234843, + "top": 1092.9505765075123 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"true\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"false\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9515d07b-297d-4261-8773-a71e4986a503", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 1416.7165099815827, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "10446b69-0dc2-4e05-84da-647b70d6bad9", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "904004ca-fd2e-4feb-8e60-6ae1479a7cc0", - "when": null, - "workflow_outputs": [] - }, - "11": { - "annotation": "", - "id": 11, - "input_connections": { - "Coverage": { - "id": 6, - "input_subworkflow_step_id": 6, - "output_name": "output" - }, - "Gaps": { - "id": 5, - "input_subworkflow_step_id": 5, - "output_name": "output" - }, - "Hap1 fasta": { - "id": 0, - "input_subworkflow_step_id": 0, - "output_name": "output" - }, - "Hap1 vs Species": { - "id": 10, - "input_subworkflow_step_id": 2, - "output_name": "data_param" - }, - "Related Fasta": { - "id": 7, - "input_subworkflow_step_id": 1, - "output_name": "data_param" - }, - "Telomeres P": { - "id": 4, - "input_subworkflow_step_id": 4, - "output_name": "output" - }, - "Telomeres Q": { - "id": 3, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "when": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Jbrowse2 for 1 related species - single haplotype", - "outputs": [], - "position": { - "left": 1647.5351247457652, - "top": 1085.328180259472 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Jbrowse2 for 1 related species - single haplotype", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { + "9": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ + "id": 9, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Map with BWA-MEM", + "outputs": [ { - "description": "", - "name": "Hap1 fasta" + "name": "bam_output", + "type": "bam" } ], - "label": "Hap1 fasta", - "name": "Input dataset", - "outputs": [], "position": { - "left": 0, - "top": 209.77609965576414 + "left": 2076.9954336369315, + "top": 769.1250209781961 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "cebb83f8-86b3-4a6e-b377-9d49f414730c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 8, + "output_name": "index" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1758.2954333536668, + "top": 274.1130105826607 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "1402a65e-66da-4598-8f65-808c75a2ba6a", "when": null, "workflow_outputs": [] }, - "1": { + "11": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ + "id": 11, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 10, + "output_name": "data_param" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ { - "description": "", - "name": "Related Fasta" + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2080.2365646760154, + "top": 311.5795221876163 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 12, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 11, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 9, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2514.7437808929476, + "top": 466.4928221254056 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" } - ], - "label": "Related Fasta", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 64.19044612855507, - "top": 340.1894548398588 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "385825a9-198e-425f-9fb3-55af892d20dc", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0279f93e-3825-41fd-a2aa-7c346ac39b37", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Alignments", + "output_name": "data_param", + "uuid": "dbe0fa6e-d89f-4c0b-a465-20543e4886d5" + } + ] }, - "2": { + "13": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ + "id": 13, + "input_connections": { + "bamfile": { + "id": 12, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools fixmate", + "outputs": [ { - "description": "", - "name": "Hap1 vs Species" + "name": "output", + "type": "qname_sorted.bam" } ], - "label": "Hap1 vs Species", - "name": "Input dataset", - "outputs": [], "position": { - "left": 113.31939864522589, - "top": 479.71782494540537 + "left": 2927.2313274141284, + "top": 804.2692108154217 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"paf\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "c18b3a25-89e8-4853-81fe-affb519a9ae0", + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "qname_sorted.bam" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "84819580b8a5", + "name": "samtools_fixmate", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "67d0caa5-4147-426c-becc-0f9f47dc651f", "when": null, "workflow_outputs": [] }, - "3": { + "14": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ + "id": 14, + "input_connections": { + "input1": { + "id": 13, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools sort", + "outputs": [ { - "description": "", - "name": "Telomeres Q" + "name": "output1", + "type": "bam" } ], - "label": "Telomeres Q", - "name": "Input dataset", - "outputs": [], "position": { - "left": 173.91872965677103, - "top": 641.211210134653 + "left": 3312.2702874436673, + "top": 772.7787001985029 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "tool_shed_repository": { + "changeset_revision": "2ce517eb9af2", + "name": "samtools_sort", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "88a21f05-dffc-46d0-9bd8-4bcfeecfbbe4", "when": null, "workflow_outputs": [] }, - "4": { + "15": { "annotation": "", - "content_id": null, + "content_id": "__EXTRACT_DATASET__", "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ + "id": 15, + "input_connections": { + "input": { + "id": 14, + "output_name": "output1" + }, + "when": { + "id": 3, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ { - "description": "", - "name": "Telomeres P" + "name": "output", + "type": "data" } ], - "label": "Telomeres P", - "name": "Input dataset", - "outputs": [], "position": { - "left": 262.08020244071406, - "top": 800.007485299661 + "left": 3729.1928352266104, + "top": 784.5012459161436 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", - "when": null, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "3c1bad0f-bffc-4235-86ca-8304fe7d486d", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "5": { + "16": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", "errors": null, - "id": 5, - "input_connections": {}, - "inputs": [ + "id": 16, + "input_connections": { + "bamfiles": { + "id": 14, + "output_name": "output1" + }, + "when": { + "id": 3, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ { - "description": "", - "name": "Gaps" + "name": "output", + "type": "bam" } ], - "label": "Gaps", - "name": "Input dataset", - "outputs": [], "position": { - "left": 334.3294215467986, - "top": 926.8224375339558 + "left": 3729.637839288911, + "top": 1070.5070667055697 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", - "when": null, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "4e480630-9a94-4ac7-b35d-1f50aee89e45", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "6": { + "17": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 6, - "input_connections": {}, - "inputs": [ + "id": 17, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 16, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 15, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ { - "description": "", - "name": "Coverage" + "name": "data_param", + "type": "input" } ], - "label": "Coverage", - "name": "Input dataset", - "outputs": [], "position": { - "left": 431.83941564925703, - "top": 1079.271676485952 + "left": 4103.3669173058615, + "top": 998.7923848439243 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "2131fd1e-4f34-4662-be5c-382101fcbc76", + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged Hi-C Alignments on Scaffolds" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "63a811d6-654a-4e22-ad6f-79d81ab263b1", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "data_param", + "uuid": "73c1bd3b-29d8-4b4c-b62c-eb105c50c455" + } + ] }, - "7": { + "18": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", "errors": null, - "id": 7, + "id": 18, "input_connections": { - "assemblies_0|reference_genome|genome": { - "id": 0, - "output_name": "output" - }, - "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 2, - "output_name": "output" - }, - "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 3, - "output_name": "output" - }, - "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { - "id": 4, - "output_name": "output" - }, - "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 5, - "output_name": "output" - }, - "assemblies_0|track_groups_3|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 6, - "output_name": "output" - }, - "assemblies_1|reference_genome|genome": { - "id": 1, - "output_name": "output" + "bamfile": { + "id": 17, + "output_name": "data_param" } }, "inputs": [], - "label": "JBrowse2 Hap1 and hap2 with 1st related species", - "name": "JBrowse2", + "label": "Remove duplicates", + "name": "Samtools markdup", "outputs": [ { "name": "output", - "type": "html" + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" } ], "position": { - "left": 1931.9531457553405, - "top": 0 + "left": 4488.289807413368, + "top": 1146.8101992730617 }, "post_job_actions": { "RenameDatasetActionoutput": { "action_arguments": { - "newname": "JBrowse2 Single Haplotype with related species" + "newname": "Precuration Hi-C alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "RenameDatasetActionstats_output": { + "action_arguments": { + "newname": "Hi-C duplication stats on Scaffolds" }, "action_type": "RenameDatasetAction", + "output_name": "stats_output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "name:no_duplicates,precur_hic_alignments" + }, + "action_type": "TagDatasetAction", "output_name": "output" + }, + "TagDatasetActionstats_output": { + "action_arguments": { + "tags": "hic_dup_stats_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "stats_output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", "tool_shed_repository": { - "changeset_revision": "bd903fbbc26e", - "name": "jbrowse2", - "owner": "fubar", + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Telomeres Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 3, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": []}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "3.7.0+galaxy0", + "tool_version": "1.22+galaxy2", "type": "tool", - "uuid": "0dba1c5e-903c-46f3-a58c-2b9341b92a15", + "uuid": "bd0b9bd6-860f-430b-998f-15e38b1d4a90", "when": null, "workflow_outputs": [ { - "label": "JBrowse2 Single Haplotype with related species", + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "stats_output", + "uuid": "261a8d4d-07a5-45bd-a322-7ef49932394c" + }, + { + "label": "Precuration Hi-C alignments", "output_name": "output", - "uuid": "448fe2be-896a-49d7-b5c3-dfc4ceae0352" + "uuid": "13a0c271-b0e0-4d7b-8fbc-e0b8a2d45d52" } ] } }, "tags": [], - "uuid": "cbf1ff46-2fda-482b-aa3d-33cef23120e5" + "uuid": "5b3d0317-dcf5-41de-a587-f9b0895af5ce" }, "tool_id": null, "type": "subworkflow", - "uuid": "6ad9fa44-c0d3-49e8-af09-e1a93e66eb8a", + "uuid": "7f47849a-ac9b-4d96-90dd-7a1c0848b8f8", "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "JBrowse2 Single Haplotype with related species", - "output_name": "JBrowse2 Single Haplotype with related species", - "uuid": "3c519fbb-453d-418c-8af3-e4532cf23c28" - } - ] - } - }, - "tags": [], - "uuid": "95a5ecaa-5b9f-48ee-935d-0d0bfcf5369b" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "7fa40e11-ee9e-4492-852e-fa55278c26fe", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "JBrowse2 Single Haplotype with related species", - "output_name": "JBrowse2 Single Haplotype with related species", - "uuid": "3a5bf4bd-0e11-4289-b09a-3126d1da9594" - }, - { - "label": "JBrowse2 Single Haplotype", - "output_name": "JBrowse2 Single Haplotype", - "uuid": "ea2c03ae-4fde-4f58-8efc-5eb54043a083" - } - ] - }, - "65": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "errors": null, - "id": 65, - "input_connections": { - "input": { - "id": 60, - "output_name": "outFileName" - }, - "pretext": { - "id": 41, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": "Add Coverage Track - Multimapping", - "name": "Pretextgraph", - "outputs": [ - { - "name": "graph_out", - "type": "pretext" - } - ], - "position": { - "left": 4314.893682463086, - "top": 618.766281070267 - }, - "post_job_actions": { - "HideDatasetActiongraph_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "graph_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "tool_shed_repository": { - "changeset_revision": "8e422c873d02", - "name": "pretext_graph", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.9+galaxy0", - "type": "tool", - "uuid": "fd4f30e5-128b-4a4d-b9f6-2239323f99da", - "when": null, - "workflow_outputs": [] - }, - "66": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "errors": null, - "id": 66, - "input_connections": { - "input": { - "id": 60, - "output_name": "outFileName" - }, - "pretext": { - "id": 40, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": "Add Coverage Track", - "name": "Pretextgraph", - "outputs": [ - { - "name": "graph_out", - "type": "pretext" - } - ], - "position": { - "left": 4200.272826576246, - "top": 1518.2005106436195 - }, - "post_job_actions": { - "HideDatasetActiongraph_out": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "graph_out" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", - "tool_shed_repository": { - "changeset_revision": "8e422c873d02", - "name": "pretext_graph", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.9+galaxy0", - "type": "tool", - "uuid": "68583f52-0bd8-41b4-8f10-0bd0ed274177", - "when": null, - "workflow_outputs": [] - }, - "67": { - "annotation": "", - "id": 67, - "input_connections": { - "Coverage": { - "id": 60, - "input_subworkflow_step_id": 7, - "output_name": "outFileName" - }, - "Gaps": { - "id": 36, - "input_subworkflow_step_id": 6, - "output_name": "stats" - }, - "Hap1 fasta": { - "id": 33, - "input_subworkflow_step_id": 0, - "output_name": "data_param" - }, - "Hap2 fasta": { - "id": 30, - "input_subworkflow_step_id": 1, - "output_name": "data_param" - }, - "Related Species": { - "id": 47, - "input_subworkflow_step_id": 3, - "output_name": "output1" - }, - "Telomeres P": { - "id": 53, - "input_subworkflow_step_id": 5, - "output_name": "out_file1" - }, - "Telomeres Q": { - "id": 52, - "input_subworkflow_step_id": 4, - "output_name": "out_file1" - }, - "Use related species": { - "id": 22, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "when": { - "id": 6, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Jbrowse for pre-curation", - "outputs": [], - "position": { - "left": 3903.743940776823, - "top": 2427.333635312456 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Jbrowse for pre-curation", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1 fasta" - } - ], - "label": "Hap1 fasta", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 0, - "top": 742.8897015690675 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap2 fasta" - } - ], - "label": "Hap2 fasta", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 51.81545453466647, - "top": 862.3884271960488 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "177f6825-e58e-45e9-a3fc-8c7623187e02", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Use related species" - } - ], - "label": "Use related species", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 139.93115566784982, - "top": 988.3634184555182 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "71dda500-06c4-4a48-a224-7fde74d2748c", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "Hi-C duplication stats on Scaffolds", + "uuid": "002a523e-5c31-454f-9ff1-5524800a4ea3" + }, { - "description": "", - "name": "Related Species" + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "Merged Hi-C Alignments on Scaffolds", + "uuid": "0c3c6d81-86da-4515-ac56-7f04282b5cc8" } - ], - "label": "Related Species", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 297.860981218189, - "top": 1267.0769707757688 - }, - "tool_id": null, - "tool_state": "{\"optional\": true, \"format\": [\"fasta\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "20f7abfb-20b8-49bb-b522-cd911fd1ec4c", - "when": null, - "workflow_outputs": [] + ] }, - "4": { + "11": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Telomeres Q" + "id": 11, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 9, + "output_name": "Precuration Hi-C alignments" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 10, + "output_name": "Precuration Hi-C alignments" } - ], - "label": "Telomeres Q", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 347.4491076529599, - "top": 1423.3470983747302 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 5, - "input_connections": {}, - "inputs": [ + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ { - "description": "", - "name": "Telomeres P" + "name": "data_param", + "type": "input" } ], - "label": "Telomeres P", - "name": "Input dataset", - "outputs": [], "position": { - "left": 455.5329585464028, - "top": 1527.4447919828074 + "left": 1807.797710925467, + "top": 363.5238351392891 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", - "when": null, - "workflow_outputs": [] - }, - "6": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 6, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Gaps" + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Precuration Hi-C alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "precur_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" } - ], - "label": "Gaps", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 524.1536909971493, - "top": 1620.8115508618534 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 7, - "input_connections": {}, - "inputs": [ + "workflow_outputs": [ { - "description": "", - "name": "Coverage" + "label": "Precuration Hi-C alignments", + "output_name": "data_param", + "uuid": "7a45c47e-138b-4a85-8df7-82fc71fd587a" } - ], - "label": "Coverage", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 581.1909253334677, - "top": 1707.9310177752473 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "738f43fc-5f88-4117-bcc3-4a9c1b01c0a1", - "when": null, - "workflow_outputs": [] + ] + } + }, + "tags": [], + "uuid": "d1381e4b-2f66-48c2-a7df-514689bb328f" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "cbc36287-42a8-4989-b9f0-71f32229c140", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "Merged Hi-C Alignments on Scaffolds", + "uuid": "eec2f684-5bb0-4df1-a855-fe7ec129bd30" + }, + { + "label": "Trimmed Hi-C data", + "output_name": "Trimmed Hi-C data", + "uuid": "dcfda183-0f3d-4230-8df5-c5cdf57ce8ed" + }, + { + "label": "Precuration Hi-C alignments", + "output_name": "Precuration Hi-C alignments", + "uuid": "6b3631b2-9f33-4697-8294-cc0091a26988" + }, + { + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "Hi-C duplication stats on Scaffolds", + "uuid": "04e4799b-2eaf-4ea1-875b-33a4b8948a35" + } + ] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "errors": null, + "id": 32, + "input_connections": { + "canonical": { + "id": 18, + "output_name": "output" + }, + "input_sequence": { + "id": 29, + "output_name": "data_param" + }, + "patterns": { + "id": 19, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Teloscope", + "outputs": [ + { + "name": "terminal_telomeres", + "type": "bed" + }, + { + "name": "telo_report", + "type": "tabular" + } + ], + "position": { + "left": 2387.6812133789062, + "top": 1382.1624755859375 + }, + "post_job_actions": { + "RenameDatasetActiontelo_report": { + "action_arguments": { + "newname": "Telomere Report" + }, + "action_type": "RenameDatasetAction", + "output_name": "telo_report" + }, + "RenameDatasetActionterminal_telomeres": { + "action_arguments": { + "newname": "terminal telomeres" + }, + "action_type": "RenameDatasetAction", + "output_name": "terminal_telomeres" + }, + "TagDatasetActiontelo_report": { + "action_arguments": { + "tags": "telomere_report" + }, + "action_type": "TagDatasetAction", + "output_name": "telo_report" + }, + "TagDatasetActionterminal_telomeres": { + "action_arguments": { + "tags": "terminal_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "terminal_telomeres" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "321ceb58023e", + "name": "teloscope", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"canonical\": {\"__class__\": \"ConnectedValue\"}, \"edit_distance\": \"0\", \"input_sequence\": {\"__class__\": \"ConnectedValue\"}, \"max_block_distance\": \"200\", \"max_match_distance\": \"50\", \"min_block_density\": \"0.5\", \"min_block_length\": \"500\", \"out_entropy\": false, \"out_gc\": false, \"out_its\": false, \"out_matches\": false, \"out_win_repeats\": false, \"patterns\": {\"__class__\": \"ConnectedValue\"}, \"step\": \"500\", \"terminal_limit\": \"50000\", \"ultra_fast\": true, \"verbose\": false, \"window\": \"1000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.3+galaxy1", + "type": "tool", + "uuid": "437d8023-f3b8-47d0-a34e-56b0471de43f", + "when": null, + "workflow_outputs": [ + { + "label": "Telomere Report", + "output_name": "telo_report", + "uuid": "83cf865b-a124-4a84-9cf7-8bb6d966ad7c" + }, + { + "label": "terminal telomeres", + "output_name": "terminal_telomeres", + "uuid": "edf9292a-fd55-4391-80ca-d8e0eef89960" + } + ] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 33, + "input_connections": { + "input_file": { + "id": 29, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2806.71773975613, + "top": 998.8499106927812 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "bed" }, - "8": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", - "errors": null, - "id": 8, - "input_connections": { - "query": { - "id": 0, - "output_name": "output" - }, - "reflist": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": "Align Haplotypes Hap1 is query", - "name": "mashmap", - "outputs": [ - { - "name": "mashout", - "type": "paf" - } - ], - "position": { - "left": 1778.2294988244635, - "top": 198.21919351320366 - }, - "post_job_actions": { - "HideDatasetActionmashout": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "mashout" - }, - "RenameDatasetActionmashout": { - "action_arguments": { - "newname": "Alignment Hap1 vs Hap2" - }, - "action_type": "RenameDatasetAction", - "output_name": "mashout" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "a3a6b0b31f2d", - "name": "mashmap", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"dense\": false, \"filter_mode\": \"map\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"90.0\", \"query\": {\"__class__\": \"ConnectedValue\"}, \"reflist\": {\"__class__\": \"ConnectedValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.1.3+galaxy0", - "type": "tool", - "uuid": "d60c6cf5-bdb8-450f-b910-603613c28949", - "when": null, - "workflow_outputs": [] + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Gaps Bed" }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 9, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 3, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 780.0001300734693, - "top": 1172.4278015865104 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Haplotype 2" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "4c0237a8-60c2-4eb0-9fc6-bcd985a50402", - "when": null, - "workflow_outputs": [] + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "Gaps_bed" }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", - "errors": null, - "id": 10, - "input_connections": { - "assemblies_0|reference_genome|genome": { - "id": 0, - "output_name": "output" - }, - "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 8, - "output_name": "mashout" - }, - "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 4, - "output_name": "output" - }, - "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { - "id": 5, - "output_name": "output" - }, - "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 6, - "output_name": "output" - }, - "assemblies_0|track_groups_3|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 7, - "output_name": "output" - }, - "assemblies_1|reference_genome|genome": { - "id": 1, - "output_name": "output" - }, - "assemblies_1|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 4, - "output_name": "output" - }, - "assemblies_1|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { - "id": 5, - "output_name": "output" - }, - "assemblies_1|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 6, - "output_name": "output" - }, - "assemblies_1|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 7, - "output_name": "output" - } - }, - "inputs": [], - "label": "JBrowse2 Hap1 vs Hap2 with no related species", - "name": "JBrowse2", - "outputs": [ - { - "name": "output", - "type": "html" - } + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps Bed", + "output_name": "stats", + "uuid": "4a7f2ef2-c635-4ddb-b23b-8546f9290ef9" + } + ] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", + "errors": null, + "id": 34, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 27, + "output_name": "data_param" + }, + "reference_source|ref_file": { + "id": 29, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 2481.356559673871, + "top": 1969.797536524506 + }, + "post_job_actions": { + "HideDatasetActionalignment_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3faf9a2bf58d", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"b\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"end_bonus\": \"0\", \"score_N\": \"1\", \"no_end_flt\": true, \"jump_min_match\": \"3\", \"end_seed_pen\": \"6\", \"cap_sw_mem\": \"100m\", \"cap_kalloc\": \"500m\"}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false, \"copy_comments\": false, \"ds_tag\": false, \"secondary_seq\": false, \"two_io_threads\": false, \"seed\": null}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null, \"rmq_inner\": \"1000\", \"no_hash_name\": false, \"pairing\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.30+galaxy0", + "type": "tool", + "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", + "when": null, + "workflow_outputs": [] + }, + "35": { + "annotation": "", + "id": 35, + "input_connections": { + "Database for Compleasm": { + "id": 4, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Haplotype 1": { + "id": 30, + "input_subworkflow_step_id": 2, + "output_name": "data_param" + }, + "Haplotype 2": { + "id": 25, + "input_subworkflow_step_id": 3, + "output_name": "Decontaminated Hap2 with Suffix" + }, + "Lineage for Compleasm": { + "id": 3, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Gene Tracks for PretextMap", + "outputs": [], + "position": { + "left": 2820.521790957233, + "top": 230.4970932602946 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [ + { + "child_steps": [ + 4, + 7, + 8, + 9, + 10, + 11, + 12, + 5, + 6 ], - "position": { - "left": 2889.4791473624273, - "top": 0 - }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "JBrowse2 Hap1 vs Hap2 with no related species" - }, - "action_type": "RenameDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd903fbbc26e", - "name": "jbrowse2", - "owner": "fubar", - "tool_shed": "toolshed.g2.bx.psu.edu" + "color": "turquoise", + "data": { + "title": "Gene Annotations" }, - "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Alignments\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Telomeres Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_off\"}}]}, {\"__index__\": 2, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 3, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Telomeres\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.7.0+galaxy0", - "type": "tool", - "uuid": "252b3e45-ec8a-4989-bfe2-7c1e3285310b", - "when": null, - "workflow_outputs": [ - { - "label": "JBrowse2 Hap1 vs Hap2 with no related species", - "output_name": "output", - "uuid": "8827e928-aee0-4cfe-ac92-93fa5972035a" - } - ] + "id": 0, + "position": [ + 533.1600054474995, + 0 + ], + "size": [ + 1907, + 932 + ], + "type": "frame" + } + ], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" }, - "11": { + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Gene Tracks for PretextMap", + "report": { + "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nMarkduplicate deduplication stats (if applicable)\n\n```galaxy\nhistory_dataset_embedded(output=\"Markduplicates Summary\")\n```\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n\n\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "content_id": null, "errors": null, - "id": 11, - "input_connections": { - "query": { - "id": 0, - "output_name": "output" - }, - "reflist": { - "id": 9, - "output_name": "data_param" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": "Hap1 vs Species", - "name": "mashmap", - "outputs": [ + "id": 0, + "input_connections": {}, + "inputs": [ { - "name": "mashout", - "type": "paf" + "description": "", + "name": "Lineage for Compleasm" } ], + "label": "Lineage for Compleasm", + "name": "Input parameter", + "outputs": [], "position": { - "left": 1211.2240968936799, - "top": 657.3499600528801 - }, - "post_job_actions": { - "HideDatasetActionmashout": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "mashout" - }, - "RenameDatasetActionmashout": { - "action_arguments": { - "newname": "Species to Hap2" - }, - "action_type": "RenameDatasetAction", - "output_name": "mashout" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "a3a6b0b31f2d", - "name": "mashmap", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 0, + "top": 85.32391557497368 }, - "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"85.0\", \"query\": {\"__class__\": \"RuntimeValue\"}, \"reflist\": {\"__class__\": \"RuntimeValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.1.3+galaxy0", - "type": "tool", - "uuid": "ba8fe065-a989-4cff-bcda-2e6883b1f6cd", - "when": "$(inputs.when)", + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c5aa113e-5a56-4b29-8d56-6c1eb8a3fd25", + "when": null, "workflow_outputs": [] }, - "12": { + "1": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "content_id": null, "errors": null, - "id": 12, - "input_connections": { - "query": { - "id": 9, - "output_name": "data_param" - }, - "reflist": { - "id": 1, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": "Species vs Hap2", - "name": "mashmap", - "outputs": [ + "id": 1, + "input_connections": {}, + "inputs": [ { - "name": "mashout", - "type": "paf" + "description": "", + "name": "Database for Compleasm" } ], + "label": "Database for Compleasm", + "name": "Input parameter", + "outputs": [], "position": { - "left": 1224.8019253851462, - "top": 1023.194677480063 - }, - "post_job_actions": { - "HideDatasetActionmashout": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "mashout" - }, - "RenameDatasetActionmashout": { - "action_arguments": { - "newname": "Species to Hap2" - }, - "action_type": "RenameDatasetAction", - "output_name": "mashout" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "a3a6b0b31f2d", - "name": "mashmap", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 41.75634461605, + "top": 182.8222030363895 }, - "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"85.0\", \"query\": {\"__class__\": \"RuntimeValue\"}, \"reflist\": {\"__class__\": \"RuntimeValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.1.3+galaxy0", - "type": "tool", - "uuid": "cf1e95b5-3bd6-41c1-a2d4-93ac6c1b1b1a", - "when": "$(inputs.when)", + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c5675865-8136-4234-b434-c3c9c1f64d63", + "when": null, "workflow_outputs": [] }, - "13": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "2": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, "errors": null, - "id": 13, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 11, - "output_name": "mashout" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 8, - "output_name": "mashout" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ + "id": 2, + "input_connections": {}, + "inputs": [ { - "name": "data_param", - "type": "input" + "description": "Assembly for Haplotype 1.", + "name": "Haplotype 1" } ], + "label": "Haplotype 1", + "name": "Input dataset", + "outputs": [], "position": { - "left": 1718.6272050699724, - "top": 1176.1114408896244 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Haplotype 2" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 61.29385043769571, + "top": 275.80325102051034 }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "da65eec3-0c6c-4d37-81ba-4661abc5f076", + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", "when": null, "workflow_outputs": [] }, - "14": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 14, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 12, - "output_name": "mashout" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 8, - "output_name": "mashout" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ + "3": { + "annotation": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ { - "name": "data_param", - "type": "input" + "description": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", + "name": "Haplotype 2" } ], + "label": "Haplotype 2", + "name": "Input dataset", + "outputs": [], "position": { - "left": 1705.5894014018074, - "top": 917.0710444155519 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Haplotype 2" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 148.96736152646798, + "top": 550.4783156591526 }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "b5f42764-7e45-47df-9e96-cd6e05861527", + "tool_id": null, + "tool_state": "{\"optional\": true, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", "when": null, "workflow_outputs": [] }, - "15": { + "4": { "annotation": "", - "id": 15, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "errors": null, + "id": 4, "input_connections": { - "Coverage": { - "id": 7, - "input_subworkflow_step_id": 8, - "output_name": "output" - }, - "Gaps": { - "id": 6, - "input_subworkflow_step_id": 7, - "output_name": "output" - }, - "Hap1 fasta": { - "id": 0, - "input_subworkflow_step_id": 0, - "output_name": "output" - }, - "Hap1 vs Species": { - "id": 13, - "input_subworkflow_step_id": 4, - "output_name": "data_param" - }, - "Hap2 fasta": { + "busco_database": { "id": 1, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Related Species": { - "id": 9, - "input_subworkflow_step_id": 2, - "output_name": "data_param" - }, - "Species vs Hap2": { - "id": 14, - "input_subworkflow_step_id": 3, - "output_name": "data_param" - }, - "Telomeres P": { - "id": 5, - "input_subworkflow_step_id": 6, "output_name": "output" }, - "Telomeres Q": { - "id": 4, - "input_subworkflow_step_id": 5, + "input": { + "id": 2, "output_name": "output" }, - "when": { - "id": 2, + "lineage_dataset": { + "id": 0, "output_name": "output" } }, "inputs": [], "label": null, - "name": "Jbrowse2 for 1 related species", - "outputs": [], - "position": { - "left": 2292.870790775461, - "top": 1001.1439041017042 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Jbrowse2 for 1 related species", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + "name": "compleasm", + "outputs": [ + { + "name": "full_table_busco", + "type": "tsv" }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1 fasta" - } - ], - "label": "Hap1 fasta", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 0, - "top": 271.13908772215916 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "4a20362f-2551-4a60-9118-e4c3e7c4f264", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap2 fasta" - } - ], - "label": "Hap2 fasta", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 53.14881800970572, - "top": 420.7641795440555 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "177f6825-e58e-45e9-a3fc-8c7623187e02", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Related Species" - } - ], - "label": "Related Species", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 98.91709918730632, - "top": 553.1054764799819 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "604a6bec-8c1f-47e3-8884-c32f63246589", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Species vs Hap2" - } - ], - "label": "Species vs Hap2", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 147.9198303415696, - "top": 670.2931389328182 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"paf\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "ebdc47b3-16f5-48e9-a101-c82b2370181a", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1 vs Species" - } - ], - "label": "Hap1 vs Species", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 175.64670268098203, - "top": 777.2105888619357 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"paf\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "385825a9-198e-425f-9fb3-55af892d20dc", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 5, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Telomeres Q" - } - ], - "label": "Telomeres Q", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 206.21568172170709, - "top": 895.0983900914266 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "ce01ac46-a3c2-4013-ba5b-ea8a0e46be64", - "when": null, - "workflow_outputs": [] - }, - "6": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 6, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Telomeres P" - } - ], - "label": "Telomeres P", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 274.77222990165984, - "top": 1069.4502766623036 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "8044ff06-8a3b-4ac1-b6ee-521cc28e585d", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 7, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Gaps" - } - ], - "label": "Gaps", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 353.8919295731858, - "top": 1244.9653893778952 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "37e56713-8aa6-474e-9a87-6c702d7d6b49", - "when": null, - "workflow_outputs": [] + { + "name": "miniprot", + "type": "gff3" + } + ], + "position": { + "left": 1183.2582928520926, + "top": 125.52405367841573 + }, + "post_job_actions": { + "HideDatasetActionfull_table_busco": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "full_table_busco" + }, + "RenameDatasetActionfull_table_busco": { + "action_arguments": { + "newname": "Compleasm hap1 - Busco" }, - "8": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 8, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Coverage" - } - ], - "label": "Coverage", - "name": "Input dataset", - "outputs": [], - "position": { - "left": 391.49614814580605, - "top": 1410.3962329181184 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bigwig\"], \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "2131fd1e-4f34-4662-be5c-382101fcbc76", - "when": null, - "workflow_outputs": [] + "action_type": "RenameDatasetAction", + "output_name": "full_table_busco" + }, + "RenameDatasetActionminiprot": { + "action_arguments": { + "newname": "Compleasm hap1 - Miniprot" }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", - "errors": null, - "id": 9, - "input_connections": { - "assemblies_0|reference_genome|genome": { - "id": 0, - "output_name": "output" - }, - "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 4, - "output_name": "output" - }, - "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 5, - "output_name": "output" - }, - "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { - "id": 6, - "output_name": "output" - }, - "assemblies_0|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 7, - "output_name": "output" - }, - "assemblies_0|track_groups_3|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 8, - "output_name": "output" - }, - "assemblies_1|reference_genome|genome": { - "id": 2, - "output_name": "output" - }, - "assemblies_1|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 3, - "output_name": "output" - }, - "assemblies_2|reference_genome|genome": { - "id": 1, - "output_name": "output" - }, - "assemblies_2|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 5, - "output_name": "output" - }, - "assemblies_2|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { - "id": 6, - "output_name": "output" - }, - "assemblies_2|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 7, - "output_name": "output" - }, - "assemblies_2|track_groups_2|data_tracks_0|data_format|annotation_cond|annotation": { - "id": 8, - "output_name": "output" - } - }, - "inputs": [], - "label": "JBrowse2 Hap1 and hap2 with 1st related species", - "name": "JBrowse2", - "outputs": [ - { - "name": "output", - "type": "html" - } - ], - "position": { - "left": 1960.7191746063156, - "top": 0 - }, - "post_job_actions": { - "RenameDatasetActionoutput": { - "action_arguments": { - "newname": "JBrowse2 Hap1 and hap2 with related species" - }, - "action_type": "RenameDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", - "tool_shed_repository": { - "changeset_revision": "bd903fbbc26e", - "name": "jbrowse2", - "owner": "fubar", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Telomeres Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 3, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny Hap2\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 2, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Telomeres Haplotype 2\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Gaps\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 2, \"category\": \"HiFi Coverage\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.7.0+galaxy0", - "type": "tool", - "uuid": "0dba1c5e-903c-46f3-a58c-2b9341b92a15", - "when": null, - "workflow_outputs": [ - { - "label": "JBrowse2 Hap1 and hap2 with related species", - "output_name": "output", - "uuid": "ce6026de-ad8b-4dec-8926-fccc97f25df6" - } - ] + "action_type": "RenameDatasetAction", + "output_name": "miniprot" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "tool_shed_repository": { + "changeset_revision": "fc7334661489", + "name": "compleasm", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.6+galaxy3", + "type": "tool", + "uuid": "e4ca5b86-c0b2-464a-b382-a4f4e97c40a0", + "when": null, + "workflow_outputs": [ + { + "label": "Compleasm hap1 - Busco", + "output_name": "full_table_busco", + "uuid": "9433e53e-de87-4279-8401-84d955a35da0" + }, + { + "label": "Compleasm hap1 - Miniprot", + "output_name": "miniprot", + "uuid": "336d5918-9421-4d36-b2e0-e89209c0d6bb" + } + ] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 3, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 746.9256373665904, + "top": 430.7771701722245 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"RuntimeValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "698ddeb1-6e84-45cc-90ea-085480ecb65d", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 750.8966317506477, + "top": 641.3761348336536 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"data\", \"__current_case__\": 4, \"input_param\": {\"__class__\": \"RuntimeValue\"}, \"mappings\": []}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "307bee50-826f-4d00-949a-12b49dc02f69", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "errors": null, + "id": 7, + "input_connections": { + "busco_database": { + "id": 1, + "output_name": "output" + }, + "input": { + "id": 5, + "output_name": "data_param" + }, + "lineage_dataset": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "compleasm", + "outputs": [ + { + "name": "full_table_busco", + "type": "tsv" + }, + { + "name": "miniprot", + "type": "gff3" + } + ], + "position": { + "left": 1185.8452970971932, + "top": 508.18761488562814 + }, + "post_job_actions": { + "HideDatasetActionfull_table_busco": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "full_table_busco" + }, + "RenameDatasetActionfull_table_busco": { + "action_arguments": { + "newname": "Compleasm hap2 - Busco" + }, + "action_type": "RenameDatasetAction", + "output_name": "full_table_busco" + }, + "RenameDatasetActionminiprot": { + "action_arguments": { + "newname": "Compleasm hap2 - Miniprot" + }, + "action_type": "RenameDatasetAction", + "output_name": "miniprot" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "tool_shed_repository": { + "changeset_revision": "fc7334661489", + "name": "compleasm", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"busco_database\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.6+galaxy3", + "type": "tool", + "uuid": "f1c6f5a9-c3a6-42b3-ae7c-8a10068550b3", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Compleasm hap2 - Miniprot", + "output_name": "miniprot", + "uuid": "d85e1256-c930-44d3-a7a5-632e74d0f3db" + }, + { + "label": "Compleasm hap2 - Busco", + "output_name": "full_table_busco", + "uuid": "e96ed079-858f-4610-ad93-844fd95f77c2" + } + ] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", + "errors": null, + "id": 8, + "input_connections": { + "inputs": [ + { + "id": 4, + "output_name": "miniprot" + }, + { + "id": 7, + "output_name": "miniprot" } + ] + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1523.98198855252, + "top": 284.23731575830993 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Merged Compleasm Gffs" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "1185817d-9a3a-4949-912a-3d0738f6f112", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Compleasm Gffs", + "output_name": "out_file1", + "uuid": "5e40c8c2-7163-45e3-9e1c-98765e2486ee" + } + ] + }, + "9": { + "annotation": "", + "content_id": "gff2bed1", + "errors": null, + "id": 9, + "input_connections": { + "input": { + "id": 8, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "GFF-to-BED", + "outputs": [ + { + "name": "out_file1", + "type": "bed" + } + ], + "position": { + "left": 1654.9581382906902, + "top": 509.1752168828822 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "gff2bed1", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "8b3c70e3-68f4-4af1-a91d-3d4a2aebee15", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 10, + "input_connections": { + "input": { + "id": 9, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Keep CDS", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1794.0132403968241, + "top": 137.49084080981893 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c4=='CDS'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "61b1c6f2-cb71-470b-973a-5065c32b4275", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", + "errors": null, + "id": 11, + "input_connections": { + "infile": { + "id": 10, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Unique lines", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 1970.3524821920116, + "top": 348.8763838955442 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": {\"grouping_select\": \"no\", \"__current_case__\": 0, \"count\": false, \"repeated\": false, \"uniqueonly\": true}, \"ignorecase\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"skipfields\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "96bd05b5-633e-4b34-8cef-fd09cf615cac", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 12, + "input_connections": { + "input": { + "id": 11, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2189.450255861953, + "top": 568.0292815975416 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "3c457431-0357-4287-bb3d-16dfca800c6a", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "errors": null, + "id": 13, + "input_connections": { + "input": { + "id": 12, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2399.7988913424965, + "top": 714.6015058165053 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" }, - "tags": [], - "uuid": "33815832-0a6d-4939-a521-99df7c0ecc72" + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Compleasm Genes track" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "gene_bedgraph" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } }, - "tool_id": null, - "type": "subworkflow", - "uuid": "e134915a-f5b7-4b32-a511-921e0b363bff", - "when": "$(inputs.when)", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "09fd742a-1113-4ded-a5f1-0ee1200d30a0", + "when": null, "workflow_outputs": [ { - "label": "JBrowse2 Hap1 and hap2 with related species", - "output_name": "JBrowse2 Hap1 and hap2 with related species", - "uuid": "7562c81f-4b86-4932-8056-52f4dc17d2a9" + "label": "Compleasm Genes track", + "output_name": "out_file1", + "uuid": "94f1d13d-0964-4469-bb33-416a6012dcd0" } ] } }, - "tags": [], - "uuid": "6eaa2fd3-4247-45c6-8858-492b7b5929d4" + "tags": [], + "uuid": "6386e89f-541f-4110-bb72-aef511b4df2d" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "d0a10285-7606-4302-ba3b-5c43b42e2602", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Compleasm Genes track", + "output_name": "Compleasm Genes track", + "uuid": "f8399762-1903-4af7-ba37-4c75350cef30" + } + ] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "errors": null, + "id": 36, + "input_connections": { + "highRes": { + "id": 14, + "output_name": "output" + }, + "input": { + "id": 31, + "output_name": "Precuration Hi-C alignments" + }, + "map_qual": { + "id": 17, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 3973.4164481149905, + "top": 1136.237612582866 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.4+galaxy0", + "type": "tool", + "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", + "when": null, + "workflow_outputs": [] + }, + "37": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "errors": null, + "id": 37, + "input_connections": { + "highRes": { + "id": 14, + "output_name": "output" + }, + "input": { + "id": 31, + "output_name": "Precuration Hi-C alignments" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4136.625251693286, + "top": 346.86115561767815 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.4+galaxy0", + "type": "tool", + "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", + "when": null, + "workflow_outputs": [] + }, + "38": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "errors": null, + "id": 38, + "input_connections": { + "input": { + "id": 31, + "output_name": "Precuration Hi-C alignments" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping low res", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 5765.761554435896, + "top": 777.3727930905267 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.4+galaxy0", + "type": "tool", + "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "errors": null, + "id": 39, + "input_connections": { + "input": { + "id": 31, + "output_name": "Precuration Hi-C alignments" + }, + "map_qual": { + "id": 17, + "output_name": "output" + } + }, + "inputs": [], + "label": "PretextMap low res", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 5673.928332926333, + "top": 1567.174596178742 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd07b0d0f568", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.4+galaxy0", + "type": "tool", + "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", + "when": null, + "workflow_outputs": [] + }, + "40": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 40, + "input_connections": { + "input": { + "id": 32, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select Q telomeres", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2626.2625122070312, + "top": 1262.8624877929688 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:q" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='q'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "a73922af-2560-4a97-853a-ca8a5498686f", + "when": null, + "workflow_outputs": [] + }, + "41": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 41, + "input_connections": { + "input": { + "id": 32, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select P telomeres", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2665.8374633789062, + "top": 1619.3125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:p" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='p'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "37467b63-9fb8-4488-85cb-0c748f625b55", + "when": null, + "workflow_outputs": [] + }, + "42": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", + "errors": null, + "id": 42, + "input_connections": { + "input": { + "id": 33, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3034.7278944620984, + "top": 999.5879286334185 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Gaps Bedgraph" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "Gaps" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "61f9ddbc63ca", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.1+galaxy0", + "type": "tool", + "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps Bedgraph", + "output_name": "out_file1", + "uuid": "9fa64361-b645-4ca3-91cd-4a0d13f13a41" + } + ] + }, + "43": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "errors": null, + "id": 43, + "input_connections": { + "bamfiles": { + "id": 34, + "output_name": "alignment_output" + }, + "when": { + "id": 23, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2737.3809424386664, + "top": 1876.5829215416961 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "48c3b202-85ca-447b-8f91-fbc440e33366", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "44": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 44, + "input_connections": { + "input": { + "id": 34, + "output_name": "alignment_output" + }, + "when": { + "id": 23, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 2737.1827748438227, + "top": 2185.366944111388 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "72de31ed-6ef4-4f67-9150-459573b7e7e5", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "45": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "errors": null, + "id": 45, + "input_connections": { + "input": { + "id": 38, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6099.3355097740405, + "top": 778.0990311701319 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "tool_shed_repository": { + "changeset_revision": "c4fb391275a0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.7+galaxy0", + "type": "tool", + "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", + "when": null, + "workflow_outputs": [] + }, + "46": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "errors": null, + "id": 46, + "input_connections": { + "input": { + "id": 39, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6019.383156159895, + "top": 1473.3425883338787 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", + "tool_shed_repository": { + "changeset_revision": "c4fb391275a0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.7+galaxy0", + "type": "tool", + "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", + "when": null, + "workflow_outputs": [] + }, + "47": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 47, + "input_connections": { + "input": { + "id": 40, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Q telomere bed", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2896.8187866210938, + "top": 1319.72509765625 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Q telomeres Bed" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "q_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "676086b9-9a0a-40b2-8d7b-466ead68cf2b", + "when": null, + "workflow_outputs": [ + { + "label": "Q telomeres Bed", + "output_name": "out_file1", + "uuid": "b9b7d743-5f41-49f3-a640-5a68ee3a63a4" + } + ] + }, + "48": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 48, + "input_connections": { + "input": { + "id": 41, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "P telomere bed", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2899.6375122070312, + "top": 1543.53125 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "P telomeres bed" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "p_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "512bfacb-51f6-4820-a16e-61ec7b484be4", + "when": null, + "workflow_outputs": [ + { + "label": "P telomeres bed", + "output_name": "out_file1", + "uuid": "4b23fce7-a313-42ef-b365-783ee0bd24e6" + } + ] + }, + "49": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 49, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 35, + "output_name": "Compleasm Genes track" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 42, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3638.4556330865757, + "top": 323.205798530103 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "3158715d-0e51-4f0d-a427-d4c20744a9cb", + "when": null, + "workflow_outputs": [] + }, + "50": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 50, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 43, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 44, + "output_name": "output" + } + }, + "inputs": [], + "label": "Hifi Alignments", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3009.3609015626676, + "top": 2051.606896331395 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged HiFi Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_hifi_align_precur" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2afb1f1a-4687-4c63-9496-d66c63c23a01", + "when": null, + "workflow_outputs": [ + { + "label": "Merged HiFi Alignments", + "output_name": "data_param", + "uuid": "b0149c13-2ddf-4fb1-9939-5d38c8a98312" + } + ] + }, + "51": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 51, + "input_connections": { + "input": { + "id": 45, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 6385.092527631594, + "top": 742.7570387373108 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Pretext Snapshot With tracks - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_multimapping" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "7815d57b-da36-42a2-b25c-4cf3dbf89c69", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot With tracks - Multimapping", + "output_name": "output", + "uuid": "70a9b730-a184-47e3-ad69-de0034bf35ed" + } + ] + }, + "52": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 52, + "input_connections": { + "input": { + "id": 46, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 6387.01295886191, + "top": 1600.5355317281906 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Pretext Snapshot With tracks" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1a9ded49-abf8-425f-b4a2-abcbcb537aa0", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot With tracks", + "output_name": "output", + "uuid": "892bc21e-a9b2-4524-8b1e-02f2a139ab25" + } + ] + }, + "53": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 53, + "input_connections": { + "input1": { + "id": 47, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Test if Q telomere track is empty", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 3158.901898076252, + "top": 1266.582592170533 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "7617ecee-71c5-40fc-b7a0-46ec5e6d09c6", + "when": null, + "workflow_outputs": [] + }, + "54": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 54, + "input_connections": { + "input1": { + "id": 48, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Test if P telomere track is empty", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 3174.0897711185717, + "top": 1637.7439948451865 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "eaf0278b-fb8e-4001-9def-bc26d8846694", + "when": null, + "workflow_outputs": [] + }, + "55": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "errors": null, + "id": 55, + "input_connections": { + "bamInput": { + "id": 50, + "output_name": "data_param" + }, + "binSize": { + "id": 20, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "bamCoverage", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 3268.6408118386503, + "top": 1932.8127046094655 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "BigWig Coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "0e49b109abc2", + "name": "deeptools_bam_coverage", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bamInput\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"type\": \"no\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "43e863a6-80b4-4c02-a249-ca7a6469ac01", + "when": null, + "workflow_outputs": [ + { + "label": "BigWig Coverage", + "output_name": "outFileName", + "uuid": "99e50ff7-22ae-4afc-af83-e81b69c73931" + } + ] + }, + "56": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "errors": null, + "id": 56, + "input_connections": { + "input_bams": { + "id": 50, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools depth", + "outputs": [ + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 3270.6159423253503, + "top": 2206.55560224621 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "fb6d5ffc365f", + "name": "samtools_depth", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"additional_options\": {\"required_flags\": null, \"skipped_flags\": [\"4\", \"256\", \"512\", \"1024\"], \"deletions\": false, \"single_read\": false}, \"all\": \"-a\", \"basequality\": null, \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"mapquality\": null, \"maxdepth\": null, \"minlength\": null, \"output_options\": {\"header\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "75e128e1-596f-4804-9d3d-2788ee7bf5b3", + "when": null, + "workflow_outputs": [] + }, + "57": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 57, + "input_connections": { + "input_param_type|input_param": { + "id": 53, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "False if Q telomere track is empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3459.9078024663245, + "top": 1351.4977300677754 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "3de1eefb-971f-4e56-9dd4-da995d9facc8", + "when": null, + "workflow_outputs": [] + }, + "58": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 58, + "input_connections": { + "input_param_type|input_param": { + "id": 54, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "False if P telomere track is empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3464.3675577025474, + "top": 1561.2479958064835 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2ddee770-02bd-4e81-bb00-491a92b06dc1", + "when": null, + "workflow_outputs": [] + }, + "59": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 59, + "input_connections": { + "input": { + "id": 55, + "output_name": "outFileName" + }, + "pretext": { + "id": 37, + "output_name": "pretext_map_out" + } }, - "tool_id": null, - "type": "subworkflow", - "uuid": "af188630-081d-489b-b46f-eae324b3df01", - "when": "$(inputs.when)", - "workflow_outputs": [ + "inputs": [], + "label": "Add Coverage Track - Multimapping", + "name": "Pretextgraph", + "outputs": [ { - "label": "JBrowse2 Hap1 vs Hap2 with no related species", - "output_name": "JBrowse2 Hap1 vs Hap2 with no related species", - "uuid": "e237f77b-a125-413e-b442-ecaa029c07dc" + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4314.893682463086, + "top": 618.766281070267 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "fd4f30e5-128b-4a4d-b9f6-2239323f99da", + "when": null, + "workflow_outputs": [] + }, + "60": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 60, + "input_connections": { + "input": { + "id": 55, + "output_name": "outFileName" }, + "pretext": { + "id": 36, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Add Coverage Track", + "name": "Pretextgraph", + "outputs": [ { - "label": "JBrowse2 Hap1 and hap2 with related species", - "output_name": "JBrowse2 Hap1 and hap2 with related species", - "uuid": "6861e850-7a02-47cf-aab2-4093019878e9" + "name": "graph_out", + "type": "pretext" } - ] + ], + "position": { + "left": 4200.272826576246, + "top": 1518.2005106436195 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "68583f52-0bd8-41b4-8f10-0bd0ed274177", + "when": null, + "workflow_outputs": [] }, - "68": { + "61": { "annotation": "", "content_id": "Filter1", "errors": null, - "id": 68, + "id": 61, "input_connections": { "input": { - "id": 61, + "id": 56, "output_name": "output" } }, @@ -9202,7 +8136,13 @@ "left": 3501.703996641955, "top": 2151.1234876899525 }, - "post_job_actions": {}, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, "tool_id": "Filter1", "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond\": \"c3==0\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, @@ -9212,22 +8152,22 @@ "when": null, "workflow_outputs": [] }, - "69": { + "62": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 69, + "id": 62, "input_connections": { "input": { - "id": 53, + "id": 48, "output_name": "out_file1" }, "pretext": { - "id": 65, + "id": 59, "output_name": "graph_out" }, "when": { - "id": 63, + "id": 58, "output_name": "output_param_boolean" } }, @@ -9266,22 +8206,22 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "70": { + "63": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 70, + "id": 63, "input_connections": { "input": { - "id": 53, + "id": 48, "output_name": "out_file1" }, "pretext": { - "id": 66, + "id": 60, "output_name": "graph_out" }, "when": { - "id": 63, + "id": 58, "output_name": "output_param_boolean" } }, @@ -9320,14 +8260,14 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "71": { + "64": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "errors": null, - "id": 71, + "id": 64, "input_connections": { "input": { - "id": 68, + "id": 61, "output_name": "out_file1" } }, @@ -9344,7 +8284,13 @@ "left": 3690, "top": 1950 }, - "post_job_actions": {}, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "tool_shed_repository": { "changeset_revision": "61f9ddbc63ca", @@ -9360,18 +8306,18 @@ "when": null, "workflow_outputs": [] }, - "72": { + "65": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 72, + "id": 65, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 69, + "id": 62, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 65, + "id": 59, "output_name": "graph_out" } }, @@ -9410,18 +8356,18 @@ "when": null, "workflow_outputs": [] }, - "73": { + "66": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 73, + "id": 66, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 70, + "id": 63, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 66, + "id": 60, "output_name": "graph_out" } }, @@ -9460,14 +8406,14 @@ "when": null, "workflow_outputs": [] }, - "74": { + "67": { "annotation": "", "content_id": "Cut1", "errors": null, - "id": 74, + "id": 67, "input_connections": { "input": { - "id": 71, + "id": 64, "output_name": "out_file1" } }, @@ -9491,6 +8437,11 @@ }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" } }, "tool_id": "Cut1", @@ -9502,22 +8453,22 @@ "when": null, "workflow_outputs": [] }, - "75": { + "68": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 75, + "id": 68, "input_connections": { "input": { - "id": 52, + "id": 47, "output_name": "out_file1" }, "pretext": { - "id": 72, + "id": 65, "output_name": "data_param" }, "when": { - "id": 62, + "id": 57, "output_name": "output_param_boolean" } }, @@ -9556,22 +8507,22 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "76": { + "69": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 76, + "id": 69, "input_connections": { "input": { - "id": 52, + "id": 47, "output_name": "out_file1" }, "pretext": { - "id": 73, + "id": 66, "output_name": "data_param" }, "when": { - "id": 62, + "id": 57, "output_name": "output_param_boolean" } }, @@ -9610,14 +8561,14 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "77": { + "70": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", "errors": null, - "id": 77, + "id": 70, "input_connections": { "input": { - "id": 74, + "id": 67, "output_name": "out_file1" } }, @@ -9634,7 +8585,13 @@ "left": 4000, "top": 1930 }, - "post_job_actions": {}, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", "tool_shed_repository": { "changeset_revision": "2892111d91f8", @@ -9650,18 +8607,18 @@ "when": null, "workflow_outputs": [] }, - "78": { + "71": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 78, + "id": 71, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 75, + "id": 68, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 72, + "id": 65, "output_name": "data_param" } }, @@ -9675,8 +8632,8 @@ } ], "position": { - "left": 5209.343908674279, - "top": 454.22902989287815 + "left": 5173.922126970842, + "top": 540.3943162334747 }, "post_job_actions": { "HideDatasetActiondata_param": { @@ -9700,18 +8657,18 @@ "when": null, "workflow_outputs": [] }, - "79": { + "72": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 79, + "id": 72, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 76, + "id": 69, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 73, + "id": 66, "output_name": "data_param" } }, @@ -9750,14 +8707,14 @@ "when": null, "workflow_outputs": [] }, - "80": { + "73": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, - "id": 80, + "id": 73, "input_connections": { "input": { - "id": 77, + "id": 70, "output_name": "output" } }, @@ -9818,18 +8775,18 @@ } ] }, - "81": { + "74": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 81, + "id": 74, "input_connections": { "input": { - "id": 46, + "id": 42, "output_name": "out_file1" }, "pretext": { - "id": 78, + "id": 71, "output_name": "data_param" } }, @@ -9868,18 +8825,18 @@ "when": null, "workflow_outputs": [] }, - "82": { + "75": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 82, + "id": 75, "input_connections": { "input": { - "id": 46, + "id": 42, "output_name": "out_file1" }, "pretext": { - "id": 79, + "id": 72, "output_name": "data_param" } }, @@ -9918,18 +8875,18 @@ "when": null, "workflow_outputs": [] }, - "83": { + "76": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 83, + "id": 76, "input_connections": { "input": { - "id": 80, + "id": 73, "output_name": "out_file1" }, "pretext": { - "id": 81, + "id": 74, "output_name": "graph_out" } }, @@ -9968,18 +8925,18 @@ "when": null, "workflow_outputs": [] }, - "84": { + "77": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 84, + "id": 77, "input_connections": { "input": { - "id": 80, + "id": 73, "output_name": "out_file1" }, "pretext": { - "id": 82, + "id": 75, "output_name": "graph_out" } }, @@ -10025,18 +8982,18 @@ "when": null, "workflow_outputs": [] }, - "85": { + "78": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 85, + "id": 78, "input_connections": { "input": { - "id": 54, + "id": 49, "output_name": "data_param" }, "pretext": { - "id": 83, + "id": 76, "output_name": "graph_out" }, "when": { @@ -10079,18 +9036,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "86": { + "79": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", "errors": null, - "id": 86, + "id": 79, "input_connections": { "input": { - "id": 54, + "id": 49, "output_name": "data_param" }, "pretext": { - "id": 84, + "id": 77, "output_name": "graph_out" }, "when": { @@ -10133,18 +9090,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "87": { + "80": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 87, + "id": 80, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 85, + "id": 78, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 83, + "id": 76, "output_name": "graph_out" } }, @@ -10198,18 +9155,18 @@ } ] }, - "88": { + "81": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 88, + "id": 81, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 86, + "id": 79, "output_name": "graph_out" }, "style_cond|type_cond|pick_from_1|value": { - "id": 84, + "id": 77, "output_name": "graph_out" } }, @@ -10265,6 +9222,6 @@ } }, "tags": [], - "uuid": "fad73f97-70b3-4dc8-8d70-e03cd132f6c5", - "version": 12 + "uuid": "9186ddc6-a5c8-48db-863f-d2c6d44010fa", + "version": 13 } From 114a6137004e5e8d2e2ccc24a835be2ed20f039f Mon Sep 17 00:00:00 2001 From: Delphine-L Date: Tue, 26 May 2026 17:10:58 -0400 Subject: [PATCH 3/3] update pretextmap --- .../CHANGELOG.md | 6 + .../README.md | 2 +- ...map-for-assembly-manual-curation-tests.yml | 4 +- .../hi-c-map-for-assembly-manual-curation.ga | 313 +++++++++--------- 4 files changed, 166 insertions(+), 159 deletions(-) diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md index 6d40add349..1d8c5427a6 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md @@ -6,6 +6,12 @@ - BWA-MEM is now used for large genomes (>10 Gb) instead of BWA-MEM2 used for smaller genomes. - New input `Estimated Genome Size` (single-value file with the estimated genome size in bp) drives the BWA-MEM vs BWA-MEM2 aligner selection. +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1` (high-resolution PretextMap steps; the low-resolution variants remain on `0.2.4+galaxy0`) + +### Changed +- Input `Generate high resolution Hi-C maps` renamed to `Generate ultra resolution Hi-C maps`. + ### Removed - Input `Will you use a second haplotype?` — the workflow now infers single- vs two-haplotype mode from whether `Haplotype 2` is provided. - Output `Both Haplotypes merged` (no longer surfaced; merge happens internally). diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md index 5e4d840b42..51f69ba1a1 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md @@ -49,7 +49,7 @@ The Pretext files can be opened in PretextView for manual curation of genome ass ### Hi-C Map Resolution -20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources) +20. **Generate ultra resolution Hi-C maps** [boolean] - Generate ultra resolution Pretext maps (slower, requires more resources) ### Visualization Options diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml index 5d30cba696..d6564f3495 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml @@ -63,7 +63,7 @@ Lineage for Compleasm: vertebrata_odb10 Database for Compleasm: v5 Generate gene annotations: true - Generate high resolution Hi-C maps: false + Generate ultra resolution Hi-C maps: false Estimated Genome Size: class: File location: https://zenodo.org/records/19925237/files/real_size.txt @@ -195,7 +195,7 @@ Lineage for Compleasm: vertebrata_odb10 Database for Compleasm: v5 Generate gene annotations: false - Generate high resolution Hi-C maps: false + Generate ultra resolution Hi-C maps: false Estimated Genome Size: class: File location: https://zenodo.org/records/19925237/files/large_size.txt diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga index 35f589f71b..c86e80d4dd 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga @@ -4,82 +4,67 @@ "comments": [ { "child_steps": [ - 37, - 38, - 45, - 51, - 59, - 62, - 65, - 68, - 71, - 74, - 76, - 78, - 80 + 31 ], - "color": "none", + "color": "yellow", "data": { - "title": "Generate Pretext Maps and Tracks - Multimapping" + "title": "Trim and align Hi-C reads" }, - "id": 7, + "id": 1, "position": [ - 4041, - 202.3 + 1355.2, + 1286.1 ], "size": [ - 2729, - 780 + 596, + 971 ], "type": "frame" }, { "child_steps": [ - 31 + 32, + 40, + 41, + 47, + 48, + 53, + 54, + 57, + 58 ], - "color": "yellow", + "color": "lime", "data": { - "title": "Trim and align Hi-C reads" + "title": "Telomeres" }, - "id": 1, + "id": 3, "position": [ - 1355.2, - 1286.1 + 2136.8, + 1212.9 ], "size": [ - 596, - 971 + 1479, + 607 ], "type": "frame" }, { "child_steps": [ - 36, - 39, - 46, - 52, - 60, - 63, - 66, - 69, - 72, - 75, - 77, - 79, - 81 + 33, + 42 ], - "color": "orange", + "color": "red", "data": { - "title": "Add tracks to the Hi-C map - MAPQ filtering" + "title": "Gaps" }, - "id": 6, + "id": 4, "position": [ - 3899.8, - 1046.6 + 2767.1, + 944.3 ], "size": [ - 2787, - 772 + 542, + 213 ], "type": "frame" }, @@ -114,91 +99,107 @@ }, { "child_steps": [ - 25, - 26, - 28, - 29 + 36, + 39, + 60, + 46, + 52, + 63, + 66, + 69, + 72, + 75, + 77, + 79, + 81 ], - "color": "blue", + "color": "orange", "data": { - "title": "Merge Haplotypes" + "title": "Add tracks to the Hi-C map - MAPQ filtering" }, - "id": 0, + "id": 6, "position": [ - 614.0963016672636, - 455.7465102395287 + 3899.8, + 1046.6 ], "size": [ - 1283, - 769 + 2787, + 772 ], "type": "frame" }, { "child_steps": [ - 33, - 42 + 59, + 37, + 38, + 45, + 51, + 62, + 65, + 68, + 71, + 74, + 76, + 78, + 80 ], - "color": "red", + "color": "none", "data": { - "title": "Gaps" + "title": "Generate Pretext Maps and Tracks - Multimapping" }, - "id": 4, + "id": 7, "position": [ - 2767.1, - 944.3 + 4041, + 202.3 ], "size": [ - 542, - 213 + 2729, + 780 ], "type": "frame" }, { "child_steps": [ - 32, - 40, - 41, - 47, - 48, - 53, - 54, - 57, - 58 + 30, + 35, + 49 ], - "color": "lime", + "color": "turquoise", "data": { - "title": "Telomeres" + "title": "Egapx Annotations" }, - "id": 3, + "id": 2, "position": [ - 2351.5, - 1205.8 + 2146.7, + 186.9 ], "size": [ - 1479, - 607 + 1878, + 674 ], "type": "frame" }, { "child_steps": [ - 30, - 35, - 49 + 22, + 25, + 26, + 28, + 29 ], - "color": "turquoise", + "color": "blue", "data": { - "title": "Egapx Annotations" + "title": "Merge Haplotypes" }, - "id": 2, + "id": 0, "position": [ - 2146.7, - 186.9 + 614.0963016672636, + 455.7465102395287 ], "size": [ - 1878, - 674 + 1283, + 769 ], "type": "frame" } @@ -219,7 +220,7 @@ "license": "MIT", "release": "2.5", "name": "PretextMap Generation from 1 or 2 haplotypes", - "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Haplotype 2** [fasta] - Secondary haplotype assembly (leave unset for single-haplotype mode)\n3. **Hi-C reads** [list:paired collection, fastq] - Paired collection containing Hi-C data\n4. **PacBio reads** [list collection, fastq.gz] - Collection of PacBio HiFi reads\n5. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10 Gb\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n4. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Gene Annotation Outputs\n\n5. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n6. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n7. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n8. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n9. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n\n### PacBio Processing Outputs\n\n10. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n11. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n12. **BigWig Coverage** [bigwig] - PacBio read coverage track\n13. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n14. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n15. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n16. **terminal telomeres** [bedgraph] - All detected telomeric regions\n17. **P telomeres bed** [BED] - P-arm (5') telomeres only\n18. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n19. **Gaps Bed** [BED] - Assembly gap coordinates\n20. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n21. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n22. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n23. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n24. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", + "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Haplotype 2** [fasta] - Secondary haplotype assembly (leave unset for single-haplotype mode)\n3. **Hi-C reads** [list:paired collection, fastq] - Paired collection containing Hi-C data\n4. **PacBio reads** [list collection, fastq.gz] - Collection of PacBio HiFi reads\n5. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10 Gb\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate ultra resolution Hi-C maps** [boolean] - Generate ultra resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n4. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Gene Annotation Outputs\n\n5. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n6. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n7. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n8. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n9. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n\n### PacBio Processing Outputs\n\n10. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n11. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n12. **BigWig Coverage** [bigwig] - PacBio read coverage track\n13. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n14. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n15. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n16. **terminal telomeres** [bedgraph] - All detected telomeric regions\n17. **P telomeres bed** [BED] - P-arm (5') telomeres only\n18. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n19. **Gaps Bed** [BED] - Assembly gap coordinates\n20. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n21. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n22. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n23. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n24. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", "report": { "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nSamtools markdup deduplication stats (if applicable)\n\n\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats\")\n```\n\n\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n## Telomere report\n\n```galaxy\nhistory_dataset_embedded(output=\"Telomere Report\")\n```\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n" }, @@ -611,15 +612,15 @@ "inputs": [ { "description": "", - "name": "Generate high resolution Hi-C maps" + "name": "Generate ultra resolution Hi-C maps" } ], - "label": "Generate high resolution Hi-C maps", + "label": "Generate ultra resolution Hi-C maps", "name": "Input parameter", "outputs": [], "position": { - "left": 569.3159671711569, - "top": 1508.492779661561 + "left": 585.7047460989254, + "top": 1503.6323192701916 }, "tool_id": null, "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -875,8 +876,8 @@ } ], "position": { - "left": 591.5039592737479, - "top": 480.5093184679958 + "left": 693.15625, + "top": 573.6328125 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -1353,15 +1354,15 @@ "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", "when": "$(inputs.when)", "workflow_outputs": [ - { - "label": "HiFi reads without adapters", - "output_name": "out1", - "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" - }, { "label": "HiFi reads adapters trimming report", "output_name": "report", "uuid": "71d127d4-af3f-4fbe-a54b-e609fe2a9209" + }, + { + "label": "HiFi reads without adapters", + "output_name": "out1", + "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" } ] }, @@ -5881,8 +5882,8 @@ } ], "position": { - "left": 2387.6812133789062, - "top": 1382.1624755859375 + "left": 2172.947646086683, + "top": 1389.2230266613242 }, "post_job_actions": { "RenameDatasetActiontelo_report": { @@ -6820,14 +6821,10 @@ }, "36": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 36, "input_connections": { - "highRes": { - "id": 14, - "output_name": "output" - }, "input": { "id": 31, "output_name": "Precuration Hi-C alignments" @@ -6835,6 +6832,10 @@ "map_qual": { "id": 17, "output_name": "output" + }, + "ultraRes": { + "id": 14, + "output_name": "output" } }, "inputs": [], @@ -6847,8 +6848,8 @@ } ], "position": { - "left": 3973.4164481149905, - "top": 1136.237612582866 + "left": 3974.8278907852196, + "top": 1136.2343393879612 }, "post_job_actions": { "HideDatasetActionpretext_map_out": { @@ -6864,16 +6865,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", "when": null, @@ -6881,17 +6882,17 @@ }, "37": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 37, "input_connections": { - "highRes": { - "id": 14, - "output_name": "output" - }, "input": { "id": 31, "output_name": "Precuration Hi-C alignments" + }, + "ultraRes": { + "id": 14, + "output_name": "output" } }, "inputs": [], @@ -6921,16 +6922,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", "when": null, @@ -6938,7 +6939,7 @@ }, "38": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 38, "input_connections": { @@ -6967,16 +6968,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", "when": null, @@ -6984,7 +6985,7 @@ }, "39": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 39, "input_connections": { @@ -7017,16 +7018,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", "when": null, @@ -7053,8 +7054,8 @@ } ], "position": { - "left": 2626.2625122070312, - "top": 1262.8624877929688 + "left": 2411.528944914808, + "top": 1269.9230388683554 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -7100,8 +7101,8 @@ } ], "position": { - "left": 2665.8374633789062, - "top": 1619.3125 + "left": 2451.103896086683, + "top": 1626.3730510753867 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -7401,8 +7402,8 @@ } ], "position": { - "left": 2896.8187866210938, - "top": 1319.72509765625 + "left": 2682.0852193288706, + "top": 1326.7856487316367 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { @@ -7463,8 +7464,8 @@ } ], "position": { - "left": 2899.6375122070312, - "top": 1543.53125 + "left": 2684.903944914808, + "top": 1550.5918010753867 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { @@ -7750,8 +7751,8 @@ } ], "position": { - "left": 3158.901898076252, - "top": 1266.582592170533 + "left": 2944.168330784029, + "top": 1273.6431432459196 }, "post_job_actions": { "HideDatasetActiontext_param": { @@ -7790,8 +7791,8 @@ } ], "position": { - "left": 3174.0897711185717, - "top": 1637.7439948451865 + "left": 2959.3562038263485, + "top": 1644.8045459205732 }, "post_job_actions": { "HideDatasetActiontext_param": { @@ -7941,8 +7942,8 @@ } ], "position": { - "left": 3459.9078024663245, - "top": 1351.4977300677754 + "left": 3245.1742351741013, + "top": 1358.558281143162 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -7987,8 +7988,8 @@ } ], "position": { - "left": 3464.3675577025474, - "top": 1561.2479958064835 + "left": 3249.6339904103243, + "top": 1568.3085468818701 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -9222,6 +9223,6 @@ } }, "tags": [], - "uuid": "9186ddc6-a5c8-48db-863f-d2c6d44010fa", - "version": 13 + "uuid": "543e3bcd-5d1a-4893-bfb1-9b28a665a638", + "version": 4 }