diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md index e2d6e83a23..1d8c5427a6 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md @@ -1,5 +1,27 @@ # Changelog +## [2.5] - 2026-05-14 + +### Added +- BWA-MEM is now used for large genomes (>10 Gb) instead of BWA-MEM2 used for smaller genomes. +- New input `Estimated Genome Size` (single-value file with the estimated genome size in bp) drives the BWA-MEM vs BWA-MEM2 aligner selection. + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1` (high-resolution PretextMap steps; the low-resolution variants remain on `0.2.4+galaxy0`) + +### Changed +- Input `Generate high resolution Hi-C maps` renamed to `Generate ultra resolution Hi-C maps`. + +### Removed +- Input `Will you use a second haplotype?` — the workflow now infers single- vs two-haplotype mode from whether `Haplotype 2` is provided. +- Output `Both Haplotypes merged` (no longer surfaced; merge happens internally). +- Outputs `Hi-C duplication stats on Scaffolds: MultiQc` and `Hi-C duplication stats on Scaffolds: Raw` (MultiQC step removed; the plain `Hi-C duplication stats on Scaffolds` output is retained). +- Outputs `Pairtools Multiqc Stats on Scaffolds` and `Pairtools MultiQc on Scaffolds: Plots`. + +### Note +- RefSeq-based related-species detection and JBrowse2 visualization have been moved to a separate workflow. + + ## [2.4] - 2026-04-29 ### Automatic update diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md index befcc1061e..51f69ba1a1 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/README.md @@ -13,10 +13,10 @@ The Pretext files can be opened in PretextView for manual curation of genome ass ### Required Inputs 1. **Haplotype 1** [fasta] - Primary haplotype assembly -2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies -3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes) -4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data -5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads +2. **Haplotype 2** [fasta] - Secondary haplotype assembly (leave unset for single-haplotype mode) +3. **Hi-C reads** [list:paired collection, fastq] - Paired collection containing Hi-C data +4. **PacBio reads** [list collection, fastq.gz] - Collection of PacBio HiFi reads +5. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10 Gb ### Assembly Annotation Parameters @@ -49,7 +49,7 @@ The Pretext files can be opened in PretextView for manual curation of genome ass ### Hi-C Map Resolution -20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources) +20. **Generate ultra resolution Hi-C maps** [boolean] - Generate ultra resolution Pretext maps (slower, requires more resources) ### Visualization Options @@ -61,50 +61,42 @@ The Pretext files can be opened in PretextView for manual curation of genome ass 1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix 2. **Assembly Info** [tabular] - Summary statistics from gfastats -3. **Both Haplotypes merged** [fasta] - Concatenated assembly file +3. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied +4. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied ### Gene Annotation Outputs -4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled) +5. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled) ### Hi-C Alignment Outputs -5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments -6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering -7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled) -8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled) -9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled) -10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled) -11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics -12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots +6. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments +7. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering +8. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled) +9. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled) ### PacBio Processing Outputs -13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled) -14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled) +10. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled) +11. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled) ### PacBio Coverage Outputs -15. **BigWig Coverage** [bigwig] - PacBio read coverage track -16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage -17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments +12. **BigWig Coverage** [bigwig] - PacBio read coverage track +13. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage +14. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments ### Telomere Outputs -18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope -19. **terminal telomeres** [bedgraph] - All detected telomeric regions -20. **P telomeres bed** [BED] - P-arm (5') telomeres only -21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only +15. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope +16. **terminal telomeres** [bedgraph] - All detected telomeric regions +17. **P telomeres bed** [BED] - P-arm (5') telomeres only +18. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only ### Gap Outputs -22. **Gaps Bed** [BED] - Assembly gap coordinates -23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext - -### Assembly Haplotype Outputs - -24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied -25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied +19. **Gaps Bed** [BED] - Assembly gap coordinates +20. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext ### Pretext Map Outputs @@ -112,10 +104,10 @@ All Pretext outputs are generated in two versions: - **With MAPQ filtering** (default MAPQ ≥ 10): Cleaner maps with high-confidence contacts - **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments -26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered) -27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered) -28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered) -29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered) +21. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered) +22. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered) +23. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered) +24. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered) ## Usage Notes diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml index ee3273d6c2..d6564f3495 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation-tests.yml @@ -1,8 +1,8 @@ # Planemo test configuration for Hi-C contact map workflow -# Test 1: Single read set per technology (no collections) -# Test 2: Multiple read sets with collections +# Test 1: Diploid (two haplotypes), single read set per technology +# Test 2: Single haplotype, multiple read sets with collections -- doc: Test 1 - Single read set per technology +- doc: Test 1 - Diploid, single read set per technology job: Haplotype 1: class: File @@ -49,7 +49,6 @@ - hash_function: SHA-1 hash_value: 84fe8fad10155f9edd1365ba13bb5f30f0d1d881 Do you want to add suffixes to the scaffold names?: true - Will you use a second haplotype?: true First Haplotype suffix: H1 Second Haplotype suffix: H2 Do you want to trim the Hi-C data?: false @@ -62,9 +61,13 @@ Species Name: Test_species Assembly Name: toLid Lineage for Compleasm: vertebrata_odb10 - Database for Compleasm: v5 - Generate gene annotations: false - Generate high resolution Hi-C maps: false + Database for Compleasm: v5 + Generate gene annotations: true + Generate ultra resolution Hi-C maps: false + Estimated Genome Size: + class: File + location: https://zenodo.org/records/19925237/files/real_size.txt + filetype: txt outputs: Assembly for curation: asserts: @@ -103,10 +106,6 @@ has_size: value: 800000 delta: 400000 - "Hi-C duplication stats on Scaffolds: Raw": - asserts: - has_text: - text: "total_dups\t3941" Precuration Hi-C alignments: asserts: has_size: @@ -114,11 +113,13 @@ delta: 50000 Hi-C duplication stats on Scaffolds: asserts: - - has_text: - text: "EXCLUDED: 1042" - - has_text_matching: - expression: "READ: (\\d+)\\nWRITTEN: (?!\\1\\b)\\d+" -- doc: Test 2 - Multiple read sets with collections + has_text: + text: "EXCLUDED: 1042" + Compleasm Genes track: + asserts: + has_text: + text: "scaffold_1.H2\t106669\t106765" +- doc: Test 2 - Single haplotype, multiple read sets with collections job: Haplotype 1: class: File @@ -127,13 +128,6 @@ hashes: - hash_function: SHA-1 hash_value: a0ee25fd9f7cf223ca40ff530e1201589fade212 - Haplotype 2: - class: File - location: https://zenodo.org/records/18664706/files/Haplotype_2.fasta - filetype: fasta - hashes: - - hash_function: SHA-1 - hash_value: 166cb118625113e39593bedb10aaea028c20f77d Hi-C reads: class: Collection collection_type: list:paired @@ -187,7 +181,6 @@ - hash_function: SHA-1 hash_value: f0408118bf8d116d0d560d2899fc4861c930c067 Do you want to add suffixes to the scaffold names?: true - Will you use a second haplotype?: true First Haplotype suffix: H1 Second Haplotype suffix: H2 Do you want to trim the Hi-C data?: false @@ -201,8 +194,12 @@ Assembly Name: toLid Lineage for Compleasm: vertebrata_odb10 Database for Compleasm: v5 - Generate gene annotations: true - Generate high resolution Hi-C maps: false + Generate gene annotations: false + Generate ultra resolution Hi-C maps: false + Estimated Genome Size: + class: File + location: https://zenodo.org/records/19925237/files/large_size.txt + filetype: txt outputs: Assembly for curation: asserts: @@ -223,40 +220,24 @@ BigWig Coverage: asserts: has_size: - value: 20000 - delta: 10000 - P telomeres bed: - asserts: - - has_text: - text: "scaffold_10.H2" - - has_text: - text: "scaffold_1.H1\t488600\t500600\t12000" - Merged Hi-C Alignments on Scaffolds: + value: 7000 + delta: 2000 + Precuration Hi-C alignments: asserts: has_size: - value: 15000000 - delta: 6000000 + value: 12805288 + delta: 2000000 Pretext All tracks: asserts: has_size: - value: 2000000 - delta: 1000000 + value: 940000 + delta: 200000 Pretext All tracks - Multimapping: asserts: has_size: - value: 2000000 - delta: 1000000 - Compleasm Genes track: - asserts: - has_text: - text: "scaffold_1.H2\t106669\t106765" - "Hi-C duplication stats on Scaffolds: Raw": + value: 940000 + delta: 200000 + P telomeres bed: asserts: has_text: - text: "total_dups\t3941\t2623" - Hi-C duplication stats on Scaffolds: - asserts: - - has_text: - text: "EXCLUDED: 1725" - - has_text_matching: - expression: "READ: (\\d+)\\nWRITTEN: \\1\\b" + text: "scaffold_1.H1\t488600\t500600\t12000" diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga index e198200916..c86e80d4dd 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga @@ -16,30 +16,8 @@ 1286.1 ], "size": [ - 910, - 990 - ], - "type": "frame" - }, - { - "child_steps": [ - 27, - 30, - 35, - 49 - ], - "color": "turquoise", - "data": { - "title": "Egapx Annotations" - }, - "id": 2, - "position": [ - 2146.7, - 186.9 - ], - "size": [ - 1878, - 674 + 596, + 971 ], "type": "frame" }, @@ -61,8 +39,8 @@ }, "id": 3, "position": [ - 2351.5, - 1205.8 + 2136.8, + 1212.9 ], "size": [ 1479, @@ -92,17 +70,17 @@ }, { "child_steps": [ - 44, 34, 43, + 44, 50, 55, - 67, - 73, 56, 61, 64, - 70 + 67, + 70, + 73 ], "color": "green", "data": { @@ -123,9 +101,9 @@ "child_steps": [ 36, 39, + 60, 46, 52, - 60, 63, 66, 69, @@ -152,11 +130,11 @@ }, { "child_steps": [ + 59, 37, 38, 45, 51, - 59, 62, 65, 68, @@ -181,11 +159,33 @@ ], "type": "frame" }, + { + "child_steps": [ + 30, + 35, + 49 + ], + "color": "turquoise", + "data": { + "title": "Egapx Annotations" + }, + "id": 2, + "position": [ + 2146.7, + 186.9 + ], + "size": [ + 1878, + 674 + ], + "type": "frame" + }, { "child_steps": [ 22, - 23, + 25, 26, + 28, 29 ], "color": "blue", @@ -218,9 +218,9 @@ ], "format-version": "0.1", "license": "MIT", - "release": "2.4", + "release": "2.5", "name": "PretextMap Generation from 1 or 2 haplotypes", - "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies\n3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes)\n4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data\n5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Both Haplotypes merged** [fasta] - Concatenated assembly file\n\n### Gene Annotation Outputs\n\n4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled)\n10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled)\n11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics\n12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots\n\n### PacBio Processing Outputs\n\n13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n15. **BigWig Coverage** [bigwig] - PacBio read coverage track\n16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n19. **terminal telomeres** [bedgraph] - All detected telomeric regions\n20. **P telomeres bed** [BED] - P-arm (5') telomeres only\n21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n22. **Gaps Bed** [BED] - Assembly gap coordinates\n23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Assembly Haplotype Outputs\n\n24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", + "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Haplotype 2** [fasta] - Secondary haplotype assembly (leave unset for single-haplotype mode)\n3. **Hi-C reads** [list:paired collection, fastq] - Paired collection containing Hi-C data\n4. **PacBio reads** [list collection, fastq.gz] - Collection of PacBio HiFi reads\n5. **Estimated Genome Size** [file] - Single-value file with the estimated genome size in bp; used to switch from BWA-MEM2 to BWA-MEM for genomes larger than 10 Gb\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate ultra resolution Hi-C maps** [boolean] - Generate ultra resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n4. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Gene Annotation Outputs\n\n5. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n6. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n7. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n8. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n9. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n\n### PacBio Processing Outputs\n\n10. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n11. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n12. **BigWig Coverage** [bigwig] - PacBio read coverage track\n13. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n14. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n15. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n16. **terminal telomeres** [bedgraph] - All detected telomeric regions\n17. **P telomeres bed** [BED] - P-arm (5') telomeres only\n18. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n19. **Gaps Bed** [BED] - Assembly gap coordinates\n20. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n21. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n22. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n23. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n24. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", "report": { "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nSamtools markdup deduplication stats (if applicable)\n\n\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats\")\n```\n\n\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n## Telomere report\n\n```galaxy\nhistory_dataset_embedded(output=\"Telomere Report\")\n```\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n" }, @@ -388,41 +388,14 @@ "workflow_outputs": [] }, "6": { - "annotation": "", + "annotation": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", "content_id": null, "errors": null, "id": 6, "input_connections": {}, "inputs": [ { - "description": "", - "name": "Will you use a second haplotype?" - } - ], - "label": "Will you use a second haplotype?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 178.90180376230734, - "top": 555.9866279499374 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "697b66dc-1c0f-40d7-9d03-51318db580f1", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "content_id": null, - "errors": null, - "id": 7, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", + "description": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", "name": "Haplotype 2" } ], @@ -430,26 +403,26 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 211.05802737880668, - "top": 645.1671481947981 + "left": 179.61743677279702, + "top": 607.2173235305654 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_state": "{\"optional\": true, \"format\": [\"fasta\"], \"tag\": null}", "tool_version": null, "type": "data_input", "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", "when": null, "workflow_outputs": [] }, - "8": { - "annotation": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names. ", + "7": { + "annotation": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names.", "content_id": null, "errors": null, - "id": 8, + "id": 7, "input_connections": {}, "inputs": [ { - "description": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names. ", + "description": "Add haplotype suffix to the scaffold names (e.g. Scaffold_1_hap1). Necessary if the assemblies don't already have a marker of haplotype in the scaffold names.", "name": "Do you want to add suffixes to the scaffold names?" } ], @@ -468,11 +441,11 @@ "when": null, "workflow_outputs": [] }, - "9": { + "8": { "annotation": "Suffix added to scaffolds belonging to haplotype 1.", "content_id": null, "errors": null, - "id": 9, + "id": 8, "input_connections": {}, "inputs": [ { @@ -495,11 +468,11 @@ "when": null, "workflow_outputs": [] }, - "10": { + "9": { "annotation": "Suffix added to contigs belonging to haplotype 2.", "content_id": null, "errors": null, - "id": 10, + "id": 9, "input_connections": {}, "inputs": [ { @@ -522,15 +495,42 @@ "when": null, "workflow_outputs": [] }, + "10": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 10, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome Size" + } + ], + "label": "Estimated Genome Size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 394.18328295615464, + "top": 1082.7822582650979 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "70cbd8a7-d28f-4541-a3e4-4c8e1a376c6e", + "when": null, + "workflow_outputs": [] + }, "11": { - "annotation": "Paired Collection containing the Hi-C reads. ", + "annotation": "Paired Collection containing the Hi-C reads.", "content_id": null, "errors": null, "id": 11, "input_connections": {}, "inputs": [ { - "description": "Paired Collection containing the Hi-C reads. ", + "description": "Paired Collection containing the Hi-C reads.", "name": "Hi-C reads" } ], @@ -538,8 +538,8 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 401.3999819565248, - "top": 1069.2213293639197 + "left": 420.90321793990574, + "top": 1218.4211647121583 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", @@ -565,8 +565,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 440.690496895607, - "top": 1148.0491373675718 + "left": 471.00706862554944, + "top": 1292.513626474257 }, "tool_id": null, "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -592,8 +592,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 496.7584331925734, - "top": 1275.7745521826732 + "left": 515.1475335665177, + "top": 1399.7517611349795 }, "tool_id": null, "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", @@ -612,87 +612,87 @@ "inputs": [ { "description": "", - "name": "PacBio reads" + "name": "Generate ultra resolution Hi-C maps" } ], - "label": "PacBio reads", - "name": "Input dataset collection", + "label": "Generate ultra resolution Hi-C maps", + "name": "Input parameter", "outputs": [], "position": { - "left": 536.9964789986047, - "top": 1376.279758415852 + "left": 585.7047460989254, + "top": 1503.6323192701916 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, - "type": "data_collection_input", - "uuid": "8bc4fc4e-1a1a-43e8-b4bc-5115fefb541d", + "type": "parameter_input", + "uuid": "d915227b-8f4a-40e1-aeab-d1f71adce6f6", "when": null, "workflow_outputs": [] }, "15": { - "annotation": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", + "annotation": "", "content_id": null, "errors": null, "id": 15, "input_connections": {}, "inputs": [ { - "description": "Select no if you are using the HiFi reads trimmed in the contigging workflow. ", - "name": "Remove adapters from HiFi reads?" + "description": "", + "name": "PacBio reads" } ], - "label": "Remove adapters from HiFi reads?", - "name": "Input parameter", + "label": "PacBio reads", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 596.6993631163789, - "top": 1481.9030970403944 + "left": 645.7789702864719, + "top": 1626.4606184667707 }, "tool_id": null, - "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "parameter_input", - "uuid": "1cfd4d32-2a28-4f0a-9310-6cd2b6736825", + "type": "data_collection_input", + "uuid": "8bc4fc4e-1a1a-43e8-b4bc-5115fefb541d", "when": null, "workflow_outputs": [] }, "16": { - "annotation": "", + "annotation": "Select no if you are using the HiFi reads trimmed in the contigging workflow.", "content_id": null, "errors": null, "id": 16, "input_connections": {}, "inputs": [ { - "description": "", - "name": "Generate high resolution Hi-C maps" + "description": "Select no if you are using the HiFi reads trimmed in the contigging workflow.", + "name": "Remove adapters from HiFi reads?" } ], - "label": "Generate high resolution Hi-C maps", + "label": "Remove adapters from HiFi reads?", "name": "Input parameter", "outputs": [], "position": { - "left": 652.4490044390274, - "top": 1633.3557879406821 + "left": 730.7283945923052, + "top": 1732.6631706036512 }, "tool_id": null, - "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "d915227b-8f4a-40e1-aeab-d1f71adce6f6", + "uuid": "1cfd4d32-2a28-4f0a-9310-6cd2b6736825", "when": null, "workflow_outputs": [] }, "17": { - "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", + "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10", "content_id": null, "errors": null, "id": 17, "input_connections": {}, "inputs": [ { - "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", + "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10", "name": "Minimum Mapping Quality" } ], @@ -700,8 +700,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 705.2873976664991, - "top": 1752.2175588776036 + "left": 805.7082339380294, + "top": 1849.862987150992 }, "tool_id": null, "tool_state": "{\"default\": 10, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", @@ -727,8 +727,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 783.2708198518889, - "top": 1871.9944433534572 + "left": 878.5328327241879, + "top": 1973.0183944928635 }, "tool_id": null, "tool_state": "{\"default\": \"TTAGGG\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -754,8 +754,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 823.1174420179392, - "top": 1966.912481874346 + "left": 931.936764907464, + "top": 2086.681078353303 }, "tool_id": null, "tool_state": "{\"default\": \"TTAGGG,CCCTAA\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -781,8 +781,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 864.3150368613834, - "top": 2077.5884781827904 + "left": 1033.872166938985, + "top": 2218.2288951963906 }, "tool_id": null, "tool_state": "{\"default\": 100, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", @@ -867,7 +867,7 @@ } }, "inputs": [], - "label": "Hap2 not provided", + "label": "Hap provided", "name": "Map parameter value", "outputs": [ { @@ -876,8 +876,8 @@ } ], "position": { - "left": 785.0946591345934, - "top": 1045.2696554701588 + "left": 693.15625, + "top": 573.6328125 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -893,11 +893,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"true\"}, {\"__index__\": 1, \"from\": true, \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"data\", \"__current_case__\": 4, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": []}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "08114aa3-2cc8-40ec-ae19-d9a596a4c0ed", + "uuid": "3e39d120-ea6c-4184-a29c-92e829d9ff4b", "when": null, "workflow_outputs": [] }, @@ -905,50 +905,26 @@ "annotation": "", "id": 23, "input_connections": { - "Do you want to add suffixes to the scaffold names?": { - "id": 8, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "Hap1": { - "id": 5, + "0:Input dataset collection": { + "id": 15, "input_subworkflow_step_id": 0, "output_name": "output" - }, - "Hap1 suffix": { - "id": 9, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "Hap2": { - "id": 7, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Hap2 suffix": { - "id": 10, - "input_subworkflow_step_id": 4, - "output_name": "output" - }, - "when": { - "id": 6, - "output_name": "output" } }, "inputs": [], "label": null, - "name": "Add suffix to 2 haplotypes", + "name": "Test if collection has only one item or is empty", "outputs": [], "position": { - "left": 1078.1321411132812, - "top": 498.4587402343751 + "left": 2036.3281238676334, + "top": 2091.8124494257754 }, "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", "comments": [], "format-version": "0.1", - "name": "Add suffix to 2 haplotypes", + "name": "Test if collection has only one item or is empty", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, @@ -959,565 +935,485 @@ "errors": null, "id": 0, "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1" - } - ], - "label": "Hap1", - "name": "Input dataset", + "inputs": [], + "label": null, + "name": "Input dataset collection", "outputs": [], "position": { "left": 0, - "top": 0 + "top": 122.83984375 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "data_input", - "uuid": "9a207b86-2fda-4783-93ca-a6ec3664017a", + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", "when": null, "workflow_outputs": [] }, "1": { "annotation": "", - "content_id": null, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", "errors": null, "id": 1, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ { - "description": "", - "name": "Hap2" + "name": "output", + "type": "txt" } ], - "label": "Hap2", - "name": "Input dataset", - "outputs": [], "position": { - "left": 33.55078125, - "top": 122.01953125 + "left": 300, + "top": 0 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "62da2b90-e4d7-440f-a285-b3c32f655a00", + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", "when": null, "workflow_outputs": [] }, "2": { "annotation": "", - "content_id": null, + "content_id": "wc_gnu", "errors": null, "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Do you want to add suffixes to the scaffold names?" + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" } - ], - "label": "Do you want to add suffixes to the scaffold names?", - "name": "Input parameter", - "outputs": [], + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], "position": { - "left": 106.40234375, - "top": 238.078125 + "left": 586.63671875, + "top": 103.203125 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "8b13ed89-3e9c-4542-b381-5297e0db982b", + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": null, + "content_id": "Cut1", "errors": null, "id": 3, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ { - "description": "", - "name": "Hap1 suffix" + "name": "out_file1", + "type": "tabular" } ], - "label": "Hap1 suffix", - "name": "Input parameter", - "outputs": [], "position": { - "left": 215.90450646112865, - "top": 413.8826660328491 + "left": 880, + "top": 70 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", - "tool_version": null, - "type": "parameter_input", - "uuid": "22ea2bf8-e1a7-44ee-b9de-db7674742bdd", + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", "when": null, "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": null, + "content_id": "param_value_from_file", "errors": null, "id": 4, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ { - "description": "", - "name": "Hap2 suffix" + "name": "text_param", + "type": "expression.json" } ], - "label": "Hap2 suffix", - "name": "Input parameter", - "outputs": [], "position": { - "left": 274.272015645431, - "top": 551.9168666758391 + "left": 1130, + "top": 180 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", - "tool_version": null, - "type": "parameter_input", - "uuid": "07975a8d-532f-4dbc-9b9c-eaa0a819def0", + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", "when": null, "workflow_outputs": [] }, "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, "id": 5, "input_connections": { - "components_1|param_type|component_value": { - "id": 3, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" } }, "inputs": [], - "label": "Expression for hap1 suffixing", - "name": "Compose text parameter value", + "label": null, + "name": "Map parameter value", "outputs": [ { - "name": "out1", + "name": "output_param_boolean", "type": "expression.json" } ], "position": { - "left": 715.759396154146, - "top": 105.88705185789851 + "left": 1410, + "top": 200 }, "post_job_actions": { - "HideDatasetActionout1": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out1" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "e188c9826e0f", - "name": "compose_text_param", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "aa72ce5a-74c8-4298-a4c1-71c5f8c50124", - "when": "$(inputs.when)", - "workflow_outputs": [] + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] }, "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, "id": 6, "input_connections": { - "components_1|param_type|component_value": { + "input_param_type|input_param": { "id": 4, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" + "output_name": "text_param" } }, "inputs": [], - "label": "Expression for hap2 suffixing", - "name": "Compose text parameter value", + "label": null, + "name": "Map parameter value", "outputs": [ { - "name": "out1", + "name": "output_param_boolean", "type": "expression.json" } ], "position": { - "left": 719.1663154242431, - "top": 464.07762394765837 + "left": 1410, + "top": 440 }, "post_job_actions": { - "HideDatasetActionout1": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out1" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "e188c9826e0f", - "name": "compose_text_param", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "df8ef7a4-280f-4551-ae6b-45dcc1b51d0d", - "when": "$(inputs.when)", - "workflow_outputs": [] + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] }, "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, "id": 7, "input_connections": { - "infile": { - "id": 0, - "output_name": "output" - }, - "replacements_0|replace_pattern": { - "id": 5, - "output_name": "out1" - }, - "when": { - "id": 2, - "output_name": "output" + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" } }, "inputs": [], - "label": "add hap1 suffix", - "name": "Replace Text", + "label": null, + "name": "Map parameter value", "outputs": [ { - "name": "outfile", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 1153.1568123752954, - "top": 65.28236324842067 + "left": 1410, + "top": 680 }, "post_job_actions": { - "HideDatasetActionoutfile": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "outfile" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "9.5+galaxy3", + "tool_version": "0.2.0", "type": "tool", - "uuid": "0d494264-b35e-4084-b8b8-f4bacd1bc3d0", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "8": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", - "errors": null, - "id": 8, - "input_connections": { - "infile": { - "id": 1, - "output_name": "output" - }, - "replacements_0|replace_pattern": { - "id": 6, - "output_name": "out1" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": "add hap2 suffix", - "name": "Replace Text", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 1157.53513037215, - "top": 294.29634625957476 - }, - "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "5d369c5c-05fc-4477-897a-42b948900499", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 9, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 7, - "output_name": "outfile" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1563.750750466131, - "top": 23.243878725375495 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap1 with Suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "2a99e9f1-c4c1-466e-b2f8-d520213c6b34", - "when": null, - "workflow_outputs": [ - { - "label": "Processed Hap1", - "output_name": "data_param", - "uuid": "8fff3233-16ad-4388-8544-bd3954fbfe71" - } - ] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 10, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 8, - "output_name": "outfile" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1562.8912962386594, - "top": 473.2480811314234 - }, - "post_job_actions": { - "HideDatasetActiondata_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "data_param" - }, - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap2 with suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "3a64f0a3-bd8b-4ca5-a118-877ee37d239a", - "when": null, - "workflow_outputs": [ - { - "label": "Processed Hap2", - "output_name": "data_param", - "uuid": "99e3e643-db15-4942-b9f1-8925526ff367" - } - ] - }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "errors": null, - "id": 11, - "input_connections": { - "inputs": { - "id": 9, - "output_name": "data_param" - }, - "queries_0|inputs2": { - "id": 10, - "output_name": "data_param" - } - }, - "inputs": [], - "label": null, - "name": "Concatenate datasets", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "left": 1914.872391014437, - "top": 246.32152277721676 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", - "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "9.5+galaxy3", - "type": "tool", - "uuid": "b2f8c163-76e4-4e8e-bcf6-56c69b322e6f", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", "when": null, "workflow_outputs": [ { - "label": "Merged Haplotypes", - "output_name": "out_file1", - "uuid": "4f149f33-9aee-4c14-84ed-7b7cddea91ec" + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" } ] } }, "tags": [], - "uuid": "981c39a4-4f6b-47d1-ac30-08ce1d6a9394" + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" }, "tool_id": null, "type": "subworkflow", - "uuid": "e3fb5fbc-543e-405a-aa5d-0c4f512abd61", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "Both Haplotypes merged", - "output_name": "Merged Haplotypes", - "uuid": "6af5a08f-74aa-4a03-bf0c-22d443a02b18" - } - ] + "uuid": "c96d9580-43de-4a1a-a59a-3d46b80511c3", + "when": null, + "workflow_outputs": [] }, "24": { "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "errors": null, "id": 24, "input_connections": { - "0:Input dataset collection": { - "id": 14, - "input_subworkflow_step_id": 0, + "library|input_1": { + "id": 15, + "output_name": "output" + }, + "when": { + "id": 16, "output_name": "output" } }, "inputs": [], "label": null, - "name": "Test if collection has only one item or is empty", + "name": "Cutadapt", + "outputs": [ + { + "name": "out1", + "type": "fastqsanger" + }, + { + "name": "report", + "type": "txt" + }, + { + "name": "json_stats", + "type": "json" + } + ], + "position": { + "left": 876.0514401153265, + "top": 1266.2266772927594 + }, + "post_job_actions": { + "HideDatasetActionjson_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "json_stats" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "HiFi reads without adapters" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionreport": { + "action_arguments": { + "newname": "HiFi reads adapters trimming report" + }, + "action_type": "RenameDatasetAction", + "output_name": "report" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\", \"json_stats\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "HiFi reads adapters trimming report", + "output_name": "report", + "uuid": "71d127d4-af3f-4fbe-a54b-e609fe2a9209" + }, + { + "label": "HiFi reads without adapters", + "output_name": "out1", + "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" + } + ] + }, + "25": { + "annotation": "", + "id": 25, + "input_connections": { + "Do you want to add suffixes to the scaffold names?": { + "id": 7, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Hap1": { + "id": 5, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Hap1 suffix": { + "id": 8, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Hap2": { + "id": 6, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Hap2 suffix": { + "id": 9, + "input_subworkflow_step_id": 4, + "output_name": "output" + }, + "when": { + "id": 22, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Add suffix to 2 haplotypes", "outputs": [], "position": { - "left": 1781.4570772941813, - "top": 2335.1273518859034 + "left": 1078.1321411132812, + "top": 498.4587402343751 }, "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", "comments": [], "format-version": "0.1", - "name": "Test if collection has only one item or is empty", + "name": "Add suffix to 2 haplotypes", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, @@ -1528,807 +1424,641 @@ "errors": null, "id": 0, "input_connections": {}, - "inputs": [], - "label": null, - "name": "Input dataset collection", + "inputs": [ + { + "description": "", + "name": "Hap1" + } + ], + "label": "Hap1", + "name": "Input dataset", "outputs": [], "position": { "left": 0, - "top": 122.83984375 + "top": 0 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_state": "{\"optional\": false, \"tag\": null}", "tool_version": null, - "type": "data_collection_input", - "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "type": "data_input", + "uuid": "9a207b86-2fda-4783-93ca-a6ec3664017a", "when": null, "workflow_outputs": [] }, "1": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", + "content_id": null, "errors": null, "id": 1, - "input_connections": { - "input_collection": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Extract element identifiers", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "output", - "type": "txt" + "description": "", + "name": "Hap2" } ], + "label": "Hap2", + "name": "Input dataset", + "outputs": [], "position": { - "left": 300, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "tool_shed_repository": { - "changeset_revision": "3e27acfa4830", - "name": "collection_element_identifiers", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 33.55078125, + "top": 122.01953125 }, - "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.3", - "type": "tool", - "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "62da2b90-e4d7-440f-a285-b3c32f655a00", "when": null, "workflow_outputs": [] }, "2": { "annotation": "", - "content_id": "wc_gnu", + "content_id": null, "errors": null, "id": 2, - "input_connections": { - "input1": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Line/Word/Character count", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "out_file1", - "type": "tabular" + "description": "", + "name": "Do you want to add suffixes to the scaffold names?" } ], + "label": "Do you want to add suffixes to the scaffold names?", + "name": "Input parameter", + "outputs": [], "position": { - "left": 586.63671875, - "top": 103.203125 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } + "left": 106.40234375, + "top": 238.078125 }, - "tool_id": "wc_gnu", - "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.0", - "type": "tool", - "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "8b13ed89-3e9c-4542-b381-5297e0db982b", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": "Cut1", + "content_id": null, "errors": null, "id": 3, - "input_connections": { - "input": { - "id": 2, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Cut", - "outputs": [ + "input_connections": {}, + "inputs": [ { - "name": "out_file1", - "type": "tabular" + "description": "", + "name": "Hap1 suffix" } ], + "label": "Hap1 suffix", + "name": "Input parameter", + "outputs": [], "position": { - "left": 880, - "top": 70 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } + "left": 215.90450646112865, + "top": 413.8826660328491 }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", - "when": null, - "workflow_outputs": [] - }, - "4": { + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "22ea2bf8-e1a7-44ee-b9de-db7674742bdd", + "when": null, + "workflow_outputs": [] + }, + "4": { "annotation": "", - "content_id": "param_value_from_file", + "content_id": null, "errors": null, "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hap2 suffix" + } + ], + "label": "Hap2 suffix", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 274.272015645431, + "top": 551.9168666758391 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "07975a8d-532f-4dbc-9b9c-eaa0a819def0", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 5, "input_connections": { - "input1": { - "id": 3, - "output_name": "out_file1" + "style_cond|type_cond|pick_from_0|value": { + "id": 1, + "output_name": "output" } }, "inputs": [], "label": null, - "name": "Parse parameter value", + "name": "Pick parameter value", "outputs": [ { - "name": "text_param", - "type": "expression.json" + "name": "data_param", + "type": "input" } ], "position": { - "left": 1130, - "top": 180 + "left": 659.6124341306107, + "top": 325.1248717867535 }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first_or_error\", \"__current_case__\": 2, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.0", + "tool_version": "0.2.0", "type": "tool", - "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "uuid": "d8569d1d-471a-4ee4-8d01-cfbb66bd09bb", "when": null, "workflow_outputs": [] }, - "5": { + "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, - "id": 5, + "id": 6, "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" + "components_1|param_type|component_value": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Map parameter value", + "label": "Expression for hap1 suffixing", + "name": "Compose text parameter value", "outputs": [ { - "name": "output_param_boolean", + "name": "out1", "type": "expression.json" } ], "position": { - "left": 1410, - "top": 200 + "left": 715.759396154146, + "top": 105.88705185789851 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActionout1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.1.1", "type": "tool", - "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", - "when": null, - "workflow_outputs": [ - { - "label": "Is empty", - "output_name": "output_param_boolean", - "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" - } - ] + "uuid": "aa72ce5a-74c8-4298-a4c1-71c5f8c50124", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "6": { + "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, - "id": 6, + "id": 7, "input_connections": { - "input_param_type|input_param": { + "components_1|param_type|component_value": { "id": 4, - "output_name": "text_param" + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Map parameter value", + "label": "Expression for hap2 suffixing", + "name": "Compose text parameter value", "outputs": [ { - "name": "output_param_boolean", + "name": "out1", "type": "expression.json" } ], "position": { - "left": 1410, - "top": 440 + "left": 719.1663154242431, + "top": 464.07762394765837 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActionout1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.1.1", "type": "tool", - "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", - "when": null, - "workflow_outputs": [ - { - "label": "Has a single sample", - "output_name": "output_param_boolean", - "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" - } - ] + "uuid": "df8ef7a4-280f-4551-ae6b-45dcc1b51d0d", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "7": { + "8": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "errors": null, - "id": 7, + "id": 8, "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" + "infile": { + "id": 0, + "output_name": "output" + }, + "replacements_0|replace_pattern": { + "id": 6, + "output_name": "out1" + }, + "when": { + "id": 2, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Map parameter value", + "label": "add hap1 suffix", + "name": "Replace Text", "outputs": [ { - "name": "output_param_boolean", - "type": "expression.json" + "name": "outfile", + "type": "input" } ], "position": { - "left": 1410, - "top": 680 + "left": 1153.1568123752954, + "top": 65.28236324842067 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "outfile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", - "when": null, - "workflow_outputs": [ + "uuid": "0d494264-b35e-4084-b8b8-f4bacd1bc3d0", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "errors": null, + "id": 9, + "input_connections": { + "infile": { + "id": 5, + "output_name": "data_param" + }, + "replacements_0|replace_pattern": { + "id": 7, + "output_name": "out1" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "add hap2 suffix", + "name": "Replace Text", + "outputs": [ { - "label": "Has multiple samples", - "output_name": "output_param_boolean", - "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" - } - ] - } - }, - "tags": [], - "uuid": "dddd606b-1301-4fa4-bde5-0281131c064d" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "c96d9580-43de-4a1a-a59a-3d46b80511c3", - "when": null, - "workflow_outputs": [] - }, - "25": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "errors": null, - "id": 25, - "input_connections": { - "library|input_1": { - "id": 14, - "output_name": "output" - }, - "when": { - "id": 15, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Cutadapt", - "outputs": [ - { - "name": "out1", - "type": "fastqsanger" - }, - { - "name": "report", - "type": "txt" - }, - { - "name": "json_stats", - "type": "json" - } - ], - "position": { - "left": 876.0514401153265, - "top": 1266.2266772927594 - }, - "post_job_actions": { - "HideDatasetActionjson_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "json_stats" - }, - "RenameDatasetActionout1": { - "action_arguments": { - "newname": "HiFi reads without adapters" - }, - "action_type": "RenameDatasetAction", - "output_name": "out1" - }, - "RenameDatasetActionreport": { - "action_arguments": { - "newname": "HiFi reads adapters trimming report" - }, - "action_type": "RenameDatasetAction", - "output_name": "report" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "f6168dd17f82", - "name": "cutadapt", - "owner": "lparsons", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\", \"json_stats\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "5.2+galaxy2", - "type": "tool", - "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "HiFi reads adapters trimming report", - "output_name": "report", - "uuid": "71d127d4-af3f-4fbe-a54b-e609fe2a9209" - }, - { - "label": "HiFi reads without adapters", - "output_name": "out1", - "uuid": "affdce69-14ee-4260-90c7-889ac630ba10" - } - ] - }, - "26": { - "annotation": "", - "id": 26, - "input_connections": { - "Do you want to add suffixes to the scaffold names?": { - "id": 8, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Hap1": { - "id": 5, - "input_subworkflow_step_id": 0, - "output_name": "output" - }, - "Hap1 suffix": { - "id": 9, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "when": { - "id": 22, - "output_name": "output_param_boolean" - } - }, - "inputs": [], - "label": null, - "name": "Add Suffix 1 haplotype", - "outputs": [], - "position": { - "left": 1079.9147328570098, - "top": 902.8465562420048 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Add Suffix 1 haplotype", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1" + "name": "outfile", + "type": "input" } ], - "label": "Hap1", - "name": "Input dataset", - "outputs": [], "position": { - "left": 0, - "top": 0 + "left": 1157.53513037215, + "top": 294.29634625957476 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", - "tool_version": null, - "type": "data_input", - "uuid": "33bd9c56-0929-4b8e-85ab-48ebf584e4ab", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Do you want to add suffixes to the scaffold names?" + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" } - ], - "label": "Do you want to add suffixes to the scaffold names?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 74.46610679000048, - "top": 103.59444232917119 }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "675084df-0ed2-4fa2-b507-6271ee93aad0", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hap1 suffix" - } - ], - "label": "Hap1 suffix", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 168.86746754459963, - "top": 269.5369890878619 + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", - "tool_version": null, - "type": "parameter_input", - "uuid": "1c5ef3b8-0f1f-45ae-96d6-2d02e032c1ee", - "when": null, + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "5d369c5c-05fc-4477-897a-42b948900499", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "3": { + "10": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 3, + "id": 10, "input_connections": { - "components_1|param_type|component_value": { - "id": 2, - "output_name": "output" + "style_cond|type_cond|pick_from_0|value": { + "id": 8, + "output_name": "outfile" }, - "when": { - "id": 1, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, "output_name": "output" } }, "inputs": [], - "label": "Expression for hap1 suffixing", - "name": "Compose text parameter value", + "label": null, + "name": "Pick parameter value", "outputs": [ { - "name": "out1", - "type": "expression.json" + "name": "data_param", + "type": "input" } ], "position": { - "left": 680.6779970312689, - "top": 154.92723110280613 + "left": 1563.750750466131, + "top": 23.243878725375495 }, "post_job_actions": { - "HideDatasetActionout1": { + "HideDatasetActiondata_param": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out1" - } + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Decontaminated Hap1 with Suffix" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "e188c9826e0f", - "name": "compose_text_param", + "changeset_revision": "b19e21af9c52", + "name": "pick_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.1.1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "0dba8558-24cb-494f-bec3-a6be089df05e", - "when": "$(inputs.when)", - "workflow_outputs": [] + "uuid": "2a99e9f1-c4c1-466e-b2f8-d520213c6b34", + "when": null, + "workflow_outputs": [ + { + "label": "Processed Hap1", + "output_name": "data_param", + "uuid": "8fff3233-16ad-4388-8544-bd3954fbfe71" + } + ] }, - "4": { + "11": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 4, + "id": 11, "input_connections": { - "infile": { - "id": 0, - "output_name": "output" - }, - "replacements_0|replace_pattern": { - "id": 3, - "output_name": "out1" + "style_cond|type_cond|pick_from_0|value": { + "id": 9, + "output_name": "outfile" }, - "when": { - "id": 1, - "output_name": "output" + "style_cond|type_cond|pick_from_1|value": { + "id": 5, + "output_name": "data_param" } }, "inputs": [], - "label": "add hap1 suffix", - "name": "Replace Text", + "label": null, + "name": "Pick parameter value", "outputs": [ { - "name": "outfile", + "name": "data_param", "type": "input" } ], "position": { - "left": 1042.6204171244863, - "top": 117.72698978106516 + "left": 1562.8912962386594, + "top": 473.2480811314234 }, "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Decontaminated Hap2 with suffix" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "decont_hap2_suffix" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "ab83aa685821", - "name": "text_processing", - "owner": "bgruening", + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "9.5+galaxy3", + "tool_version": "0.2.0", "type": "tool", - "uuid": "035ade88-6466-4cfd-bff6-fe954f352772", - "when": "$(inputs.when)", - "workflow_outputs": [] + "uuid": "3a64f0a3-bd8b-4ca5-a118-877ee37d239a", + "when": null, + "workflow_outputs": [ + { + "label": "Decontaminated Hap2 with Suffix", + "output_name": "data_param", + "uuid": "e4e07746-f66d-4106-87f9-3ddb93f852e2" + } + ] }, - "5": { + "12": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", "errors": null, - "id": 5, + "id": 12, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 4, - "output_name": "outfile" + "inputs": { + "id": 10, + "output_name": "data_param" }, - "style_cond|type_cond|pick_from_1|value": { - "id": 0, - "output_name": "output" + "queries_0|inputs2": { + "id": 11, + "output_name": "data_param" } }, "inputs": [], "label": null, - "name": "Pick parameter value", + "name": "Concatenate datasets", "outputs": [ { - "name": "data_param", + "name": "out_file1", "type": "input" } ], "position": { - "left": 1459.6101679904903, - "top": 267.5340308459985 + "left": 1914.872391014437, + "top": 246.32152277721676 }, "post_job_actions": { - "HideDatasetActiondata_param": { + "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "data_param" + "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "79b86d06-475a-43b1-9a32-d9788cf0e977", + "uuid": "b2f8c163-76e4-4e8e-bcf6-56c69b322e6f", "when": null, "workflow_outputs": [ { - "label": "Processed Hap1", - "output_name": "data_param", - "uuid": "67cbd3bf-e5bf-4149-a1ee-e1884a2177c9" + "label": "Merged Haplotypes", + "output_name": "out_file1", + "uuid": "4f149f33-9aee-4c14-84ed-7b7cddea91ec" } ] } }, "tags": [], - "uuid": "3b32e78f-36dd-4dc9-94c6-2b62613fb166" + "uuid": "63454d41-dd2d-4667-a916-fb3eb931673e" }, "tool_id": null, "type": "subworkflow", - "uuid": "963aaf4e-14cf-449b-99b5-f3693b8b19b6", + "uuid": "e3fb5fbc-543e-405a-aa5d-0c4f512abd61", "when": "$(inputs.when)", - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Decontaminated Hap2 with Suffix", + "output_name": "Decontaminated Hap2 with Suffix", + "uuid": "d0f7d9ba-6ba3-4507-be06-844f727feab2" + } + ] }, - "27": { + "26": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 27, + "id": 26, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 23, - "output_name": "Processed Hap2" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 7, - "output_name": "output" + "input_param_type|input_param": { + "id": 22, + "output_name": "output_param_boolean" } }, "inputs": [], - "label": null, - "name": "Pick parameter value", + "label": "Hap2 not provided", + "name": "Map parameter value", "outputs": [ { - "name": "data_param", - "type": "input" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 2208.3701753216055, - "top": 505.8000045132802 + "left": 785.0946591345934, + "top": 1045.2696554701588 }, "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap2 with Suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "decont_hap2_suffix" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"true\"}, {\"__index__\": 1, \"from\": true, \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "60006e6d-f56d-431c-992d-acc49cc4638b", + "uuid": "08114aa3-2cc8-40ec-ae19-d9a596a4c0ed", "when": null, - "workflow_outputs": [ - { - "label": "Decontaminated Hap2 with Suffix", - "output_name": "data_param", - "uuid": "c34f2961-3386-4be9-bcb5-77ca2f0fffe5" - } - ] + "workflow_outputs": [] }, - "28": { + "27": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 28, + "id": 27, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 25, + "id": 24, "output_name": "out1" }, "style_cond|type_cond|pick_from_1|value": { - "id": 14, + "id": 15, "output_name": "output" } }, @@ -2367,216 +2097,72 @@ "when": null, "workflow_outputs": [] }, - "29": { + "28": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 29, + "id": 28, "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 23, - "output_name": "Merged Haplotypes" + "Do you want to add suffixes to the scaffold names?": { + "id": 7, + "input_subworkflow_step_id": 1, + "output_name": "output" }, - "style_cond|type_cond|pick_from_1|value": { + "Hap1": { + "id": 5, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Hap1 suffix": { + "id": 8, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "when": { "id": 26, - "output_name": "Processed Hap1" - } - }, - "inputs": [], - "label": "Pick Assembly", - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1438.4073811566127, - "top": 776.0878898442162 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Assembly for curation" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "merged_haps" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "c5cb7d6b-6d51-41cf-9914-c3df478246a9", - "when": null, - "workflow_outputs": [ - { - "label": "Assembly for curation", - "output_name": "data_param", - "uuid": "ef7e194c-19b7-4bc0-a6f7-f049d1a6b25d" - } - ] - }, - "30": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 30, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 23, - "output_name": "Processed Hap1" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 26, - "output_name": "Processed Hap1" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 2209.82453439378, - "top": 266.1637635391988 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Decontaminated Hap1 with Suffix" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "decont_hap1_suffix" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "126228b7-2718-4db7-8eb4-0700ea2ff709", - "when": null, - "workflow_outputs": [ - { - "label": "Decontaminated Hap1 with Suffix", - "output_name": "data_param", - "uuid": "f5841bfd-2f87-4676-88a5-6c64f139c7e0" - } - ] - }, - "31": { - "annotation": "", - "id": 31, - "input_connections": { - "Do you want to trim the Hi-C data?": { - "id": 12, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "Hi-C reads": { - "id": 11, - "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "Reference": { - "id": 29, - "input_subworkflow_step_id": 0, - "output_name": "data_param" - }, - "Remove HiC duplicates ?": { - "id": 13, - "input_subworkflow_step_id": 3, - "output_name": "output" + "output_name": "output_param_boolean" } }, "inputs": [], "label": null, - "name": "Trim, Align, deduplicate Hi-C - Precuration", + "name": "Add Suffix 1 haplotype", "outputs": [], "position": { - "left": 1657.8359375, - "top": 1379.3046875 + "left": 1075.28716709916, + "top": 939.8753534849833 }, "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", "comments": [], - "creator": [ - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6228-2785", - "name": "Patrik Smeds" - }, - { - "class": "Person", - "identifier": "https://orcid.org/0000-0001-6421-3484", - "name": "Delphine Lariviere" - } - ], "format-version": "0.1", - "license": "MIT", - "name": "Trim, Align, deduplicate Hi-C - Precuration", + "name": "Add Suffix 1 haplotype", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, "steps": { "0": { - "annotation": "Assembly for Haplotype 1.", + "annotation": "", "content_id": null, "errors": null, "id": 0, "input_connections": {}, "inputs": [ { - "description": "Assembly for Haplotype 1.", - "name": "Reference" + "description": "", + "name": "Hap1" } ], - "label": "Reference", + "label": "Hap1", "name": "Input dataset", "outputs": [], "position": { "left": 0, - "top": 472.97492244496857 + "top": 0 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null}", "tool_version": null, "type": "data_input", - "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "uuid": "33bd9c56-0929-4b8e-85ab-48ebf584e4ab", "when": null, "workflow_outputs": [] }, @@ -2589,1538 +2175,3597 @@ "inputs": [ { "description": "", - "name": "Hi-C reads" - } - ], - "label": "Hi-C reads", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 24.900863986875255, - "top": 568.7987808236342 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", - "name": "Do you want to trim the Hi-C data?" + "name": "Do you want to add suffixes to the scaffold names?" } ], - "label": "Do you want to trim the Hi-C data?", + "label": "Do you want to add suffixes to the scaffold names?", "name": "Input parameter", "outputs": [], "position": { - "left": 111.02187825492916, - "top": 669.8566290013688 + "left": 74.46610679000048, + "top": 103.59444232917119 }, "tool_id": null, "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "6d1391db-7fef-4b5c-a236-26016d6d0aab", + "uuid": "675084df-0ed2-4fa2-b507-6271ee93aad0", "when": null, "workflow_outputs": [] }, - "3": { + "2": { "annotation": "", "content_id": null, "errors": null, - "id": 3, + "id": 2, "input_connections": {}, "inputs": [ { "description": "", - "name": "Remove HiC duplicates ?" + "name": "Hap1 suffix" } ], - "label": "Remove HiC duplicates ?", + "label": "Hap1 suffix", "name": "Input parameter", "outputs": [], "position": { - "left": 168.00765258793868, - "top": 791.5589054364867 + "left": 168.86746754459963, + "top": 269.5369890878619 }, "tool_id": null, - "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_state": "{\"validators\": [], \"parameter_type\": \"text\", \"optional\": true}", "tool_version": null, "type": "parameter_input", - "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", + "uuid": "1c5ef3b8-0f1f-45ae-96d6-2d02e032c1ee", "when": null, "workflow_outputs": [] }, - "4": { + "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, - "id": 4, + "id": 3, "input_connections": { - "reference": { - "id": 0, + "components_1|param_type|component_value": { + "id": 2, + "output_name": "output" + }, + "when": { + "id": 1, "output_name": "output" } }, "inputs": [], - "label": null, - "name": "BWA-MEM2 indexer", + "label": "Expression for hap1 suffixing", + "name": "Compose text parameter value", "outputs": [ { - "name": "index", - "type": "bwa_mem2_index" + "name": "out1", + "type": "expression.json" } ], "position": { - "left": 1101.6588788030788, - "top": 356.5526534419638 + "left": 680.6779970312689, + "top": 154.92723110280613 }, "post_job_actions": { - "HideDatasetActionindex": { + "HideDatasetActionout1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "index" + "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "tool_shed_repository": { - "changeset_revision": "af91699b8d4c", - "name": "bwa_mem2", + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"&.\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.3+galaxy0", + "tool_version": "0.1.1", "type": "tool", - "uuid": "5def9e34-fa09-4977-aa55-aa7fc4f4d46e", - "when": null, + "uuid": "0dba8558-24cb-494f-bec3-a6be089df05e", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "5": { + "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "errors": null, - "id": 5, + "id": 4, "input_connections": { "infile": { "id": 0, "output_name": "output" + }, + "replacements_0|replace_pattern": { + "id": 3, + "output_name": "out1" + }, + "when": { + "id": 1, + "output_name": "output" } }, "inputs": [], - "label": null, - "name": "Search in textfiles", + "label": "add hap1 suffix", + "name": "Replace Text", "outputs": [ { - "name": "output", + "name": "outfile", "type": "input" } ], "position": { - "left": 2050.334659953477, - "top": 3.9427453625997657 + "left": 1042.6204171244863, + "top": 117.72698978106516 }, "post_job_actions": { - "HideDatasetActionoutput": { + "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output" + "output_name": "outfile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy3", "tool_shed_repository": { "changeset_revision": "ab83aa685821", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \">\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \">.+$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"sed_options\": null}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "9.5+galaxy3", "type": "tool", - "uuid": "b06586f9-7bb2-469d-87c5-a79ac25c2040", - "when": null, + "uuid": "035ade88-6466-4cfd-bff6-fe954f352772", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "6": { + "5": { "annotation": "", - "id": 6, + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 5, "input_connections": { - "0:Input dataset collection": { - "id": 1, - "input_subworkflow_step_id": 0, + "style_cond|type_cond|pick_from_0|value": { + "id": 4, + "output_name": "outfile" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, "output_name": "output" } }, "inputs": [], "label": null, - "name": "Test if collection has only one item or is empty", - "outputs": [], + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], "position": { - "left": 1413.3019710918868, - "top": 865.2761180121176 - }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "comments": [], - "format-version": "0.1", - "name": "Test if collection has only one item or is empty", - "report": { - "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" - }, - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [], - "label": null, - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 0, - "top": 122.83984375 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", - "when": null, - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "errors": null, - "id": 1, - "input_connections": { - "input_collection": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Extract element identifiers", - "outputs": [ - { - "name": "output", - "type": "txt" - } - ], - "position": { - "left": 300, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", - "tool_shed_repository": { - "changeset_revision": "3e27acfa4830", - "name": "collection_element_identifiers", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.3", - "type": "tool", - "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": "wc_gnu", - "errors": null, - "id": 2, - "input_connections": { - "input1": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Line/Word/Character count", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 586.63671875, - "top": 103.203125 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "wc_gnu", - "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.0", - "type": "tool", - "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": "Cut1", - "errors": null, - "id": 3, - "input_connections": { - "input": { - "id": 2, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Cut", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "left": 880, - "top": 70 - }, - "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "Cut1", - "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 4, - "input_connections": { - "input1": { - "id": 3, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Parse parameter value", - "outputs": [ - { - "name": "text_param", - "type": "expression.json" - } - ], - "position": { - "left": 1130, - "top": 180 - }, - "post_job_actions": { - "HideDatasetActiontext_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "text_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.1.0", - "type": "tool", - "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 5, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" - } - }, - "inputs": [], - "label": null, - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1410, - "top": 200 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", - "when": null, - "workflow_outputs": [ - { - "label": "Is empty", - "output_name": "output_param_boolean", - "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" - } - ] - }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 6, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" - } - }, - "inputs": [], - "label": null, - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1410, - "top": 440 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", - "when": null, - "workflow_outputs": [ - { - "label": "Has a single sample", - "output_name": "output_param_boolean", - "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" - } - ] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 7, - "input_connections": { - "input_param_type|input_param": { - "id": 4, - "output_name": "text_param" - } - }, - "inputs": [], - "label": null, - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 1410, - "top": 680 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", - "when": null, - "workflow_outputs": [ - { - "label": "Has multiple samples", - "output_name": "output_param_boolean", - "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" - } - ] - } - }, - "tags": [], - "uuid": "5f125eb2-c713-4df4-8a71-e49ba9852fc8" - }, - "tool_id": null, - "type": "subworkflow", - "uuid": "45a60cd2-4176-46d6-9e72-62c4597f00ca", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "errors": null, - "id": 7, - "input_connections": { - "library|input_1": { - "id": 1, - "output_name": "output" - }, - "when": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": "Trim Hi-C reads 2", - "name": "Cutadapt", - "outputs": [ - { - "name": "out_pairs", - "type": "input" - }, - { - "name": "report", - "type": "txt" - } - ], - "position": { - "left": 782.453125, - "top": 610.4124224449686 - }, - "post_job_actions": { - "HideDatasetActionout_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_pairs" - }, - "HideDatasetActionreport": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "report" - }, - "RenameDatasetActionout1": { - "action_arguments": { - "newname": "Trimmed Hi-C Forward Reads" - }, - "action_type": "RenameDatasetAction", - "output_name": "out1" - }, - "RenameDatasetActionout2": { - "action_arguments": { - "newname": "Trimmed Hi-C Reverse Reads" - }, - "action_type": "RenameDatasetAction", - "output_name": "out2" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "f6168dd17f82", - "name": "cutadapt", - "owner": "lparsons", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "5.2+galaxy2", - "type": "tool", - "uuid": "15c5cc40-ce0a-4e29-a891-87f55bf2bd6b", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "8": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", - "errors": null, - "id": 8, - "input_connections": { - "input_param_type|input_param": { - "id": 3, - "output_name": "output" - } - }, - "inputs": [], - "label": "False when removal is true", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_boolean", - "type": "expression.json" - } - ], - "position": { - "left": 2964.7900692749863, - "top": 1420.0180180585944 + "left": 1459.6101679904903, + "top": 267.5340308459985 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActiondata_param": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "data_param" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", + "changeset_revision": "b19e21af9c52", + "name": "pick_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", - "when": null, - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 9, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 7, - "output_name": "out_pairs" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 1070.6821138797554, - "top": 833.6550086108263 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Trimmed Hi-C data" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "hic_trimmed" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "325884ac-c2c1-4a5c-b74f-c1c422662b78", + "uuid": "79b86d06-475a-43b1-9a32-d9788cf0e977", "when": null, "workflow_outputs": [ { - "label": "Trimmed Hi-C data", + "label": "Processed Hap1", "output_name": "data_param", - "uuid": "73027165-8c18-45a9-9df1-76e3cc2421fb" + "uuid": "67cbd3bf-e5bf-4149-a1ee-e1884a2177c9" } ] + } + }, + "tags": [], + "uuid": "247a97c1-a0ec-4308-9280-a2ae4a42a18c" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "963aaf4e-14cf-449b-99b5-f3693b8b19b6", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 29, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 25, + "output_name": "Merged Haplotypes" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 28, + "output_name": "Processed Hap1" + } + }, + "inputs": [], + "label": "Pick Assembly", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1438.4073811566127, + "top": 776.0878898442162 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Assembly for curation" }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", - "errors": null, - "id": 10, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 9, - "output_name": "data_param" - }, - "reference_source|ref_file": { - "id": 4, - "output_name": "index" - } - }, - "inputs": [], - "label": null, - "name": "BWA-MEM2", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "left": 1437.1364350939361, - "top": 500.770155449531 - }, - "post_job_actions": { - "HideDatasetActionbam_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "bam_output" - }, - "RenameDatasetActionbam_output": { - "action_arguments": { - "newname": "Hi-C Alignments" - }, - "action_type": "RenameDatasetAction", - "output_name": "bam_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", - "tool_shed_repository": { - "changeset_revision": "af91699b8d4c", - "name": "bwa_mem2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.3+galaxy0", - "type": "tool", - "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", - "when": null, - "workflow_outputs": [] + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_haps" }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", - "errors": null, - "id": 11, - "input_connections": { - "bamfile": { - "id": 10, - "output_name": "bam_output" - } - }, - "inputs": [], - "label": null, - "name": "Samtools fixmate", - "outputs": [ - { - "name": "output", - "type": "qname_sorted.bam" - } - ], - "position": { - "left": 1896.4875232723236, - "top": 490.91412456456 - }, - "post_job_actions": { - "ChangeDatatypeActionoutput": { - "action_arguments": { - "newtype": "qname_sorted.bam" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "output" - }, - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "84819580b8a5", - "name": "samtools_fixmate", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "1db82bd3-3108-4f39-a0f0-f9e5450e1f4f", - "when": null, - "workflow_outputs": [] + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c5cb7d6b-6d51-41cf-9914-c3df478246a9", + "when": null, + "workflow_outputs": [ + { + "label": "Assembly for curation", + "output_name": "data_param", + "uuid": "ef7e194c-19b7-4bc0-a6f7-f049d1a6b25d" + } + ] + }, + "30": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 30, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 25, + "output_name": "Processed Hap1" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 28, + "output_name": "Processed Hap1" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2209.82453439378, + "top": 266.1637635391988 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Decontaminated Hap1 with Suffix" }, - "12": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", - "errors": null, - "id": 12, - "input_connections": { - "input1": { - "id": 11, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Samtools sort", - "outputs": [ - { - "name": "output1", - "type": "bam" - } - ], - "position": { - "left": 2289.4479412815194, - "top": 519.3556477175839 - }, - "post_job_actions": { - "HideDatasetActionoutput1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", - "tool_shed_repository": { - "changeset_revision": "2ce517eb9af2", - "name": "samtools_sort", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "2.0.8", - "type": "tool", - "uuid": "5033d744-4b6d-4486-b2ea-732697d51e45", - "when": null, - "workflow_outputs": [] + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "decont_hap1_suffix" }, - "13": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "126228b7-2718-4db7-8eb4-0700ea2ff709", + "when": null, + "workflow_outputs": [ + { + "label": "Decontaminated Hap1 with Suffix", + "output_name": "data_param", + "uuid": "f5841bfd-2f87-4676-88a5-6c64f139c7e0" + } + ] + }, + "31": { + "annotation": "", + "id": 31, + "input_connections": { + "Do you want to trim the Hi-C data?": { + "id": 12, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Estimated Genome Size": { + "id": 10, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Hi-C reads": { + "id": 11, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Reference": { + "id": 29, + "input_subworkflow_step_id": 0, + "output_name": "data_param" + }, + "Remove HiC duplicates ?": { + "id": 13, + "input_subworkflow_step_id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Trim, Align, deduplicate Hi-C - Precuration", + "outputs": [], + "position": { + "left": 1542.71875, + "top": 1481.2421875 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Trim, Align, deduplicate Hi-C - Precuration", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, "errors": null, - "id": 13, - "input_connections": { - "chroms_path": { - "id": 5, - "output_name": "output" - }, - "sam_path": { - "id": 11, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pairtools parse", - "outputs": [ - { - "name": "output_parsed_pairs", - "type": "4dn_pairsam" - }, + "id": 0, + "input_connections": {}, + "inputs": [ { - "name": "parsed_pairs_stats", - "type": "tabular" + "description": "Assembly for Haplotype 1.", + "name": "Reference" } ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], "position": { - "left": 2927.5259623065385, - "top": 66.3908541727944 - }, - "post_job_actions": { - "HideDatasetActionoutput_parsed_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_parsed_pairs" - }, - "HideDatasetActionparsed_pairs_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "parsed_pairs_stats" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", - "tool_shed_repository": { - "changeset_revision": "a5876cca7b05", - "name": "pairtools_parse", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 0, + "top": 195.55555646042225 }, - "tool_state": "{\"assembly_name\": \"\", \"chroms_path\": {\"__class__\": \"ConnectedValue\"}, \"compress_output\": true, \"drop_readid\": false, \"drop_sam\": true, \"drop_seq\": true, \"max_inter_algn_gap\": \"20\", \"max_molecule_size\": \"2000\", \"min_mapq\": \"1\", \"output_stats\": true, \"sam_path\": {\"__class__\": \"ConnectedValue\"}, \"select_add_columns\": {\"add_columns_selection\": \"no\", \"__current_case__\": 1}, \"sort_output\": true, \"walks_policy\": \"mask\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.3+galaxy6", - "type": "tool", - "uuid": "9205b952-9164-4ba4-9c25-4456a206e12b", + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", "when": null, "workflow_outputs": [] }, - "14": { + "1": { "annotation": "", - "content_id": "__EXTRACT_DATASET__", + "content_id": null, "errors": null, - "id": 14, - "input_connections": { - "input": { - "id": 12, - "output_name": "output1" - }, - "when": { - "id": 6, - "output_name": "Has a single sample" - } - }, - "inputs": [], - "label": null, - "name": "Extract dataset", - "outputs": [ + "id": 1, + "input_connections": {}, + "inputs": [ { - "name": "output", - "type": "data" + "description": "", + "name": "Hi-C reads" } ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], "position": { - "left": 2632.9323345231205, - "top": 483.13780589990847 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } + "left": 24.900863986875255, + "top": 291.3794148390879 }, - "tool_id": "__EXTRACT_DATASET__", - "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.0.2", - "type": "tool", - "uuid": "22bcd1ca-c4f9-4802-b545-c20f2f7798f4", - "when": "$(inputs.when)", + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, "workflow_outputs": [] }, - "15": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "2": { + "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "content_id": null, "errors": null, - "id": 15, - "input_connections": { - "bamfiles": { - "id": 12, - "output_name": "output1" - }, - "when": { - "id": 6, - "output_name": "Has multiple samples" - } - }, - "inputs": [], - "label": null, - "name": "Samtools merge", - "outputs": [ + "id": 2, + "input_connections": {}, + "inputs": [ { - "name": "output", - "type": "bam" + "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "name": "Do you want to trim the Hi-C data?" } ], + "label": "Do you want to trim the Hi-C data?", + "name": "Input parameter", + "outputs": [], "position": { - "left": 2653.2593349539566, - "top": 775.3922577847298 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "37c8eb55315d", - "name": "samtools_merge", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 87.29051288561523, + "top": 393.5028283812428 }, - "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "03cf4998-54d1-43b4-9005-828e8e1da14c", - "when": "$(inputs.when)", + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6d1391db-7fef-4b5c-a236-26016d6d0aab", + "when": null, "workflow_outputs": [] }, - "16": { + "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "content_id": null, "errors": null, - "id": 16, - "input_connections": { - "pairs_path": { - "id": 13, - "output_name": "output_parsed_pairs" - } - }, - "inputs": [], - "label": null, - "name": "Pairtools dedup", - "outputs": [ - { - "name": "output_dedup_pairs", - "type": "input" - }, + "id": 3, + "input_connections": {}, + "inputs": [ { - "name": "dedup_pairs_stats", - "type": "tabular" + "description": "", + "name": "Estimated Genome Size" } ], + "label": "Estimated Genome Size", + "name": "Input dataset", + "outputs": [], "position": { - "left": 3269.7967904728735, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActiondedup_pairs_stats": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "dedup_pairs_stats" - }, - "HideDatasetActionoutput_dedup_pairs": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_dedup_pairs" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", - "tool_shed_repository": { - "changeset_revision": "3d1d241ceff2", - "name": "pairtools_dedup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 127.04701718304551, + "top": 529.6980690081494 }, - "tool_state": "{\"compress_output\": true, \"mark_dups\": true, \"max_mismatch\": \"0\", \"output_bytile_stats\": false, \"output_dups\": false, \"output_stats\": true, \"pairs_path\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.1.3+galaxy6", - "type": "tool", - "uuid": "222ad224-925a-495f-ab74-44c2fb2af4a4", + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "75d82c6b-19cd-4ca8-86e3-2806f9c01e2b", "when": null, "workflow_outputs": [] }, - "17": { + "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": null, "errors": null, - "id": 17, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 15, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 14, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ + "id": 4, + "input_connections": {}, + "inputs": [ { - "name": "data_param", - "type": "input" + "description": "", + "name": "Remove HiC duplicates ?" } ], + "label": "Remove HiC duplicates ?", + "name": "Input parameter", + "outputs": [], "position": { - "left": 3030.7036252124967, - "top": 771.7493692529479 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Merged Hi-C Alignments on Scaffolds" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "merged_alignments_scaffolds" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "left": 152.62563696711496, + "top": 635.2235514698903 }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "e9571afc-84e8-44b7-a213-8d484124a0bc", + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", "when": null, - "workflow_outputs": [ - { - "label": "Merged Hi-C Alignments on Scaffolds", - "output_name": "data_param", - "uuid": "73c1bd3b-29d8-4b4c-b62c-eb105c50c455" - } - ] + "workflow_outputs": [] }, - "18": { + "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", - "errors": null, - "id": 18, + "id": 5, "input_connections": { - "input_tabular": { - "id": 16, - "output_name": "dedup_pairs_stats" + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" } }, "inputs": [], "label": null, - "name": "Column join", - "outputs": [ - { - "name": "tabular_output", - "type": "tabular" - } - ], - "position": { - "left": 3643.390891223076, - "top": 513.4889769208286 - }, - "post_job_actions": { - "RenameDatasetActiontabular_output": { - "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds: Raw" - }, - "action_type": "RenameDatasetAction", - "output_name": "tabular_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", - "tool_shed_repository": { - "changeset_revision": "3ddd99c7efee", - "name": "collection_column_join", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"fill_char\": \".\", \"has_header\": \"0\", \"identifier_column\": \"1\", \"include_outputs\": null, \"input_tabular\": {\"__class__\": \"ConnectedValue\"}, \"old_col_in_header\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.0.3", - "type": "tool", - "uuid": "9b13d478-eb6a-410d-9fb0-aa13a4543d0e", - "when": null, - "workflow_outputs": [ - { - "label": "Hi-C duplication stats on Scaffolds: Raw", - "output_name": "tabular_output", - "uuid": "d8a7cd1e-0599-4689-a043-9abbd78ba998" - } - ] - }, - "19": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", - "errors": null, - "id": 19, - "input_connections": { - "results_0|software_cond|input": { - "id": 16, - "output_name": "dedup_pairs_stats" - } - }, - "inputs": [], - "label": "Pairtools Multiqc", - "name": "MultiQC", - "outputs": [ - { - "name": "plots", - "type": "input" - }, - { - "name": "png_plot", - "type": "input" - }, - { - "name": "html_report", - "type": "html" - }, - { - "name": "stats", - "type": "tabular" - } - ], + "name": "Test if collection has only one item or is empty", + "outputs": [], "position": { - "left": 3989.2982637108043, - "top": 301.5986199229453 + "left": 1351.2851229338844, + "top": 1158.78766917316 }, - "post_job_actions": { - "ChangeDatatypeActionstats": { - "action_arguments": { - "newtype": "tsv" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "stats" - }, - "HideDatasetActionplots": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "plots" + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, - "RenameDatasetActionhtml_report": { - "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds: MultiQc" + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "html_report" - }, - "RenameDatasetActionpng_plot": { - "action_arguments": { - "newname": "Pairtools MultiQc on Scaffolds: Plots" + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "png_plot" - }, - "RenameDatasetActionstats": { - "action_arguments": { - "newname": "Pairtools Multiqc Stats on Scaffolds" + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] }, - "action_type": "RenameDatasetAction", - "output_name": "stats" - }, - "TagDatasetActionhtml_report": { - "action_arguments": { - "tags": "hic_dup_multiqc_scaffolds" + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "45a60cd2-4176-46d6-9e72-62c4597f00ca", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "errors": null, + "id": 6, + "input_connections": { + "library|input_1": { + "id": 1, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Trim Hi-C reads 2", + "name": "Cutadapt", + "outputs": [ + { + "name": "out_pairs", + "type": "input" + }, + { + "name": "report", + "type": "txt" + } + ], + "position": { + "left": 673.688898616038, + "top": 179.94029357204343 + }, + "post_job_actions": { + "HideDatasetActionout_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_pairs" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Trimmed Hi-C Forward Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionout2": { + "action_arguments": { + "newname": "Trimmed Hi-C Reverse Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out2" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "0911f75c-8b87-4d51-943e-40b6500e8b35", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": "False when removal is true", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 972.1510215857712, + "top": 815.2317568452488 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 8, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 6, + "output_name": "out_pairs" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 999.2019776562693, + "top": 374.61376378472 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Trimmed Hi-C data" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "hic_trimmed" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "6a4b6c8a-7de9-49eb-9088-da803e2842dc", + "when": null, + "workflow_outputs": [ + { + "label": "Trimmed Hi-C data", + "output_name": "data_param", + "uuid": "73027165-8c18-45a9-9df1-76e3cc2421fb" + } + ] + }, + "9": { + "annotation": "", + "id": 9, + "input_connections": { + "Estimated Genome size": { + "id": 3, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Hi-C reads": { + "id": 8, + "input_subworkflow_step_id": 1, + "output_name": "data_param" + }, + "Reference": { + "id": 0, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "", + "name": "Size dependent alignment" + } + ], + "label": "Size dependent alignment", + "name": "Optional alignement", + "outputs": [], + "position": { + "left": 1393.73032928119, + "top": 0 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Optional alignement", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 120.9261596776607 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 24.900863986875255, + "top": 216.7500180563263 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome size" + } + ], + "label": "Estimated Genome size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 71.39700103875718, + "top": 335.3499420786681 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d4563544-4752-4a01-8658-9f143d4a282d", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "id": 3, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 1523.5635698054007, + "top": 898.4287267590571 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "3df9e273-7596-4cfd-a083-e7329f5c9119", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "True if Genome size higher than 10Gb", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 507.38482635055703, + "top": 574.7760027766403 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{if ($1 >= 10000000000) print \\\"true\\\"; else print \\\"false\\\"} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "af759549-bbe3-4923-8e5a-a62952106de0", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 4, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 752.2943156269191, + "top": 680.0377136696699 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e4ffd666-dc5a-4ded-bcd2-67e2a7ecb203", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome smaller than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1000.911391627979, + "top": 374.36198514548585 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"false\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"true\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8d02989c-49bb-4b66-9b2a-418f1adc4d9e", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome bigger than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 996.9096769207425, + "top": 647.9665315266978 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"true\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"false\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9515d07b-297d-4261-8773-a71e4986a503", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 1416.7165099815827, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "10446b69-0dc2-4e05-84da-647b70d6bad9", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "errors": null, + "id": 9, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Map with BWA-MEM", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2067.262583043971, + "top": 613.2228557089854 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "cebb83f8-86b3-4a6e-b377-9d49f414730c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 8, + "output_name": "index" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1758.2954333536668, + "top": 274.1130105826607 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "1402a65e-66da-4598-8f65-808c75a2ba6a", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 10, + "output_name": "data_param" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2081.206563661144, + "top": 311.57812928123315 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 12, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 11, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 9, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2613.358073103046, + "top": 476.71963493441115 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0279f93e-3825-41fd-a2aa-7c346ac39b37", + "when": null, + "workflow_outputs": [ + { + "label": "Alignments", + "output_name": "data_param", + "uuid": "dbe0fa6e-d89f-4c0b-a465-20543e4886d5" + } + ] + }, + "13": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 13, + "input_connections": { + "input": { + "id": 12, + "output_name": "data_param" + }, + "when": { + "id": 3, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 3390.237666600868, + "top": 592.4139779736178 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "0e8e2d15-b317-4632-936b-a85ba4811ac8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "errors": null, + "id": 14, + "input_connections": { + "bamfiles": { + "id": 12, + "output_name": "data_param" + }, + "when": { + "id": 3, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 3390.6826706631687, + "top": 878.4197987630438 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "77fbb7c6-9430-4d88-ad5f-e7161d541142", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 15, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 14, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 13, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3764.411748680119, + "top": 806.7051169013986 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Precuration Hi-C alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds,precur_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9d3c6d02-f461-4197-86d1-a70ac35f15ba", + "when": null, + "workflow_outputs": [ + { + "label": "Precuration Hi-C alignments", + "output_name": "data_param", + "uuid": "f8476f37-1eaa-474b-981b-eb9086627373" + } + ] + } + }, + "tags": [], + "uuid": "5af42851-d8d8-4e6b-9c4e-4d146e8a34f1" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "37ccbbb0-f709-48b1-b4a0-dabbc5ce599a", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "id": 10, + "input_connections": { + "Estimated Genome size": { + "id": 3, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Hi-C reads": { + "id": 8, + "input_subworkflow_step_id": 1, + "output_name": "data_param" + }, + "Reference": { + "id": 0, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "when": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Optional alignement and deduplication", + "outputs": [], + "position": { + "left": 1387.2517179347483, + "top": 551.239946496607 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Optional alignement and deduplication", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 120.9261596776607 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 24.900863986875255, + "top": 216.7500180563263 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated Genome size" + } + ], + "label": "Estimated Genome size", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 163.31604558412107, + "top": 392.05355172952386 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d4563544-4752-4a01-8658-9f143d4a282d", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "id": 3, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 1677.9895124723516, + "top": 1209.8241932436654 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "0e5d977b-e036-4356-97de-c35b220554e1", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "True if Genome size higher than 10Gb", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 507.38482635055703, + "top": 574.7760027766403 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{if ($1 >= 10000000000) print \\\"true\\\"; else print \\\"false\\\"} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "af759549-bbe3-4923-8e5a-a62952106de0", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 4, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 752.2943156269191, + "top": 680.0377136696699 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e4ffd666-dc5a-4ded-bcd2-67e2a7ecb203", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome smaller than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1041.6498874098133, + "top": 836.4638984886009 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"false\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"true\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8d02989c-49bb-4b66-9b2a-418f1adc4d9e", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "When genome bigger than 10gb", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1046.3414281234843, + "top": 1092.9505765075123 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"true\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": \"false\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "9515d07b-297d-4261-8773-a71e4986a503", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 1416.7165099815827, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "10446b69-0dc2-4e05-84da-647b70d6bad9", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "errors": null, + "id": 9, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Map with BWA-MEM", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2076.9954336369315, + "top": 769.1250209781961 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "cebb83f8-86b3-4a6e-b377-9d49f414730c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 8, + "output_name": "index" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1758.2954333536668, + "top": 274.1130105826607 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "1402a65e-66da-4598-8f65-808c75a2ba6a", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 10, + "output_name": "data_param" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2080.2365646760154, + "top": 311.5795221876163 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"RuntimeValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"RuntimeValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 12, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 11, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 9, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2514.7437808929476, + "top": 466.4928221254056 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0279f93e-3825-41fd-a2aa-7c346ac39b37", + "when": null, + "workflow_outputs": [ + { + "label": "Alignments", + "output_name": "data_param", + "uuid": "dbe0fa6e-d89f-4c0b-a465-20543e4886d5" + } + ] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "errors": null, + "id": 13, + "input_connections": { + "bamfile": { + "id": 12, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools fixmate", + "outputs": [ + { + "name": "output", + "type": "qname_sorted.bam" + } + ], + "position": { + "left": 2927.2313274141284, + "top": 804.2692108154217 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "qname_sorted.bam" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "84819580b8a5", + "name": "samtools_fixmate", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "67d0caa5-4147-426c-becc-0f9f47dc651f", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "errors": null, + "id": 14, + "input_connections": { + "input1": { + "id": 13, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools sort", + "outputs": [ + { + "name": "output1", + "type": "bam" + } + ], + "position": { + "left": 3312.2702874436673, + "top": 772.7787001985029 + }, + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "tool_shed_repository": { + "changeset_revision": "2ce517eb9af2", + "name": "samtools_sort", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "88a21f05-dffc-46d0-9bd8-4bcfeecfbbe4", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 15, + "input_connections": { + "input": { + "id": 14, + "output_name": "output1" + }, + "when": { + "id": 3, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 3729.1928352266104, + "top": 784.5012459161436 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "3c1bad0f-bffc-4235-86ca-8304fe7d486d", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "html_report" - }, - "TagDatasetActionstats": { - "action_arguments": { - "tags": "hic_dup_raw_scaffolds" + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "errors": null, + "id": 16, + "input_connections": { + "bamfiles": { + "id": 14, + "output_name": "output1" + }, + "when": { + "id": 3, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 3729.637839288911, + "top": 1070.5070667055697 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "37c8eb55315d", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "4e480630-9a94-4ac7-b35d-1f50aee89e45", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "action_type": "TagDatasetAction", - "output_name": "stats" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", - "tool_shed_repository": { - "changeset_revision": "862943c10425", - "name": "multiqc", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 40, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.33+galaxy3", - "type": "tool", - "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", - "when": null, - "workflow_outputs": [ - { - "label": "Pairtools MultiQc on Scaffolds: Plots", - "output_name": "png_plot", - "uuid": "7992a75f-dca5-41fe-84e0-ae612a7c5ac6" - }, - { - "label": "Pairtools Multiqc Stats on Scaffolds", - "output_name": "stats", - "uuid": "4a116025-b7d6-48b1-adb9-f0023cd84582" - }, - { - "label": "Hi-C duplication stats on Scaffolds: MultiQc", - "output_name": "html_report", - "uuid": "97ad859e-9e00-493b-bc24-c953af6ba495" - } - ] - }, - "20": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "errors": null, - "id": 20, - "input_connections": { - "bamfile": { - "id": 17, - "output_name": "data_param" - }, - "when": { - "id": 3, - "output_name": "output" - } - }, - "inputs": [], - "label": "Remove duplicates", - "name": "Samtools markdup", - "outputs": [ - { - "name": "output", - "type": "bam" - }, - { - "name": "stats_output", - "type": "txt" - } - ], - "position": { - "left": 3513.4500625546125, - "top": 904.7579298870468 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - }, - "HideDatasetActionstats_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "stats_output" - }, - "TagDatasetActionoutput": { - "action_arguments": { - "tags": "name:no_duplicates" + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 17, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 16, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 15, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 4103.3669173058615, + "top": 998.7923848439243 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged Hi-C Alignments on Scaffolds" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "63a811d6-654a-4e22-ad6f-79d81ab263b1", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "data_param", + "uuid": "73c1bd3b-29d8-4b4c-b62c-eb105c50c455" + } + ] }, - "action_type": "TagDatasetAction", - "output_name": "output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "ef678e1f70a2", - "name": "samtools_markdup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "294a749f-e96a-45d7-9e2b-fd71d0afe5b2", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "21": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "errors": null, - "id": 21, - "input_connections": { - "bamfile": { - "id": 17, - "output_name": "data_param" - }, - "when": { - "id": 8, - "output_name": "output_param_boolean" - } - }, - "inputs": [], - "label": "Keep duplicated", - "name": "Samtools markdup", - "outputs": [ - { - "name": "output", - "type": "bam" - }, - { - "name": "stats_output", - "type": "txt" - } - ], - "position": { - "left": 3505.1000217766386, - "top": 1184.7675817632073 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 18, + "input_connections": { + "bamfile": { + "id": 17, + "output_name": "data_param" + } + }, + "inputs": [], + "label": "Remove duplicates", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 4488.289807413368, + "top": 1146.8101992730617 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Precuration Hi-C alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "RenameDatasetActionstats_output": { + "action_arguments": { + "newname": "Hi-C duplication stats on Scaffolds" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats_output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "name:no_duplicates,precur_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + }, + "TagDatasetActionstats_output": { + "action_arguments": { + "tags": "hic_dup_stats_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "stats_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "bd0b9bd6-860f-430b-998f-15e38b1d4a90", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "stats_output", + "uuid": "261a8d4d-07a5-45bd-a322-7ef49932394c" + }, + { + "label": "Precuration Hi-C alignments", + "output_name": "output", + "uuid": "13a0c271-b0e0-4d7b-8fbc-e0b8a2d45d52" + } + ] + } }, - "HideDatasetActionstats_output": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "stats_output" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", - "tool_shed_repository": { - "changeset_revision": "ef678e1f70a2", - "name": "samtools_markdup", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" + "tags": [], + "uuid": "5b3d0317-dcf5-41de-a587-f9b0895af5ce" }, - "tool_state": "{\"bamfile\": {\"__class__\": \"RuntimeValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": false, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "1.22+galaxy2", - "type": "tool", - "uuid": "9172e934-6ce0-4bc6-a526-e3d3fe539e58", + "tool_id": null, + "type": "subworkflow", + "uuid": "7f47849a-ac9b-4d96-90dd-7a1c0848b8f8", "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "22": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "errors": null, - "id": 22, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 20, - "output_name": "output" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 21, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "input" - } - ], - "position": { - "left": 3895.0499323909808, - "top": 959.7107727965537 - }, - "post_job_actions": { - "RenameDatasetActiondata_param": { - "action_arguments": { - "newname": "Precuration Hi-C alignments" - }, - "action_type": "RenameDatasetAction", - "output_name": "data_param" - }, - "TagDatasetActiondata_param": { - "action_arguments": { - "tags": "precur_hic_alignments" - }, - "action_type": "TagDatasetAction", - "output_name": "data_param" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", - "tool_shed_repository": { - "changeset_revision": "b19e21af9c52", - "name": "pick_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.2.0", - "type": "tool", - "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", - "when": null, "workflow_outputs": [ { - "label": "Precuration Hi-C alignments", - "output_name": "data_param", - "uuid": "7a45c47e-138b-4a85-8df7-82fc71fd587a" + "label": "Hi-C duplication stats on Scaffolds", + "output_name": "Hi-C duplication stats on Scaffolds", + "uuid": "002a523e-5c31-454f-9ff1-5524800a4ea3" + }, + { + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "Merged Hi-C Alignments on Scaffolds", + "uuid": "0c3c6d81-86da-4515-ac56-7f04282b5cc8" } ] }, - "23": { + "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 23, + "id": 11, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 20, - "output_name": "stats_output" + "id": 9, + "output_name": "Precuration Hi-C alignments" }, "style_cond|type_cond|pick_from_1|value": { - "id": 21, - "output_name": "stats_output" + "id": 10, + "output_name": "Precuration Hi-C alignments" } }, "inputs": [], @@ -4133,20 +5778,20 @@ } ], "position": { - "left": 3894.1790786103747, - "top": 1189.1824762726665 + "left": 1807.797710925467, + "top": 363.5238351392891 }, "post_job_actions": { "RenameDatasetActiondata_param": { "action_arguments": { - "newname": "Hi-C duplication stats on Scaffolds" + "newname": "Precuration Hi-C alignments" }, "action_type": "RenameDatasetAction", "output_name": "data_param" }, "TagDatasetActiondata_param": { "action_arguments": { - "tags": "hic_dup_stats_scaffolds" + "tags": "precur_hic_alignments" }, "action_type": "TagDatasetAction", "output_name": "data_param" @@ -4163,19 +5808,19 @@ "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "e1be9200-6f90-4b6f-a920-416e730a4721", + "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", "when": null, "workflow_outputs": [ { - "label": "Hi-C duplication stats on Scaffolds", + "label": "Precuration Hi-C alignments", "output_name": "data_param", - "uuid": "474d51ef-99fd-4718-a403-497eab1db380" + "uuid": "7a45c47e-138b-4a85-8df7-82fc71fd587a" } ] } }, "tags": [], - "uuid": "ffd72082-7eba-4b9b-a8c6-c85c94891a79" + "uuid": "d1381e4b-2f66-48c2-a7df-514689bb328f" }, "tool_id": null, "type": "subworkflow", @@ -4183,24 +5828,9 @@ "when": null, "workflow_outputs": [ { - "label": "Pairtools Multiqc Stats on Scaffolds", - "output_name": "Pairtools Multiqc Stats on Scaffolds", - "uuid": "f6e65a23-e1e9-4d7a-9002-7cb6290f3c17" - }, - { - "label": "Hi-C duplication stats on Scaffolds: MultiQc", - "output_name": "Hi-C duplication stats on Scaffolds: MultiQc", - "uuid": "08d9dbc2-45e9-4f9b-ac5d-bfa3ae3e6212" - }, - { - "label": "Pairtools MultiQc on Scaffolds: Plots", - "output_name": "Pairtools MultiQc on Scaffolds: Plots", - "uuid": "1eeda1e7-9e92-4391-bc75-68f454a5e45f" - }, - { - "label": "Hi-C duplication stats on Scaffolds: Raw", - "output_name": "Hi-C duplication stats on Scaffolds: Raw", - "uuid": "9029ce2c-a017-40d8-a2fa-fb5a1f5e633b" + "label": "Merged Hi-C Alignments on Scaffolds", + "output_name": "Merged Hi-C Alignments on Scaffolds", + "uuid": "eec2f684-5bb0-4df1-a855-fe7ec129bd30" }, { "label": "Trimmed Hi-C data", @@ -4208,19 +5838,14 @@ "uuid": "dcfda183-0f3d-4230-8df5-c5cdf57ce8ed" }, { - "label": "Merged Hi-C Alignments on Scaffolds", - "output_name": "Merged Hi-C Alignments on Scaffolds", - "uuid": "5e57b67b-0d56-4bde-8fd2-3d974e378137" + "label": "Precuration Hi-C alignments", + "output_name": "Precuration Hi-C alignments", + "uuid": "6b3631b2-9f33-4697-8294-cc0091a26988" }, { "label": "Hi-C duplication stats on Scaffolds", "output_name": "Hi-C duplication stats on Scaffolds", "uuid": "04e4799b-2eaf-4ea1-875b-33a4b8948a35" - }, - { - "label": "Precuration Hi-C alignments", - "output_name": "Precuration Hi-C alignments", - "uuid": "6b3631b2-9f33-4697-8294-cc0091a26988" } ] }, @@ -4257,8 +5882,8 @@ } ], "position": { - "left": 2387.6812133789062, - "top": 1382.1624755859375 + "left": 2172.947646086683, + "top": 1389.2230266613242 }, "post_job_actions": { "RenameDatasetActiontelo_report": { @@ -4391,7 +6016,7 @@ "id": 34, "input_connections": { "fastq_input|fastq_input1": { - "id": 28, + "id": 27, "output_name": "data_param" }, "reference_source|ref_file": { @@ -4449,20 +6074,15 @@ "output_name": "data_param" }, "Haplotype 2": { - "id": 27, - "input_subworkflow_step_id": 4, - "output_name": "data_param" + "id": 25, + "input_subworkflow_step_id": 3, + "output_name": "Decontaminated Hap2 with Suffix" }, "Lineage for Compleasm": { "id": 3, "input_subworkflow_step_id": 0, "output_name": "output" }, - "Will you use a second haplotype?": { - "id": 6, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, "when": { "id": 2, "output_name": "output" @@ -4473,8 +6093,8 @@ "name": "Gene Tracks for PretextMap", "outputs": [], "position": { - "left": 2859.614458148943, - "top": 240.65437722692624 + "left": 2820.521790957233, + "top": 230.4970932602946 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -4482,14 +6102,15 @@ "comments": [ { "child_steps": [ - 5, - 6, + 4, 7, 8, 9, 10, 11, - 12 + 12, + 5, + 6 ], "color": "turquoise", "data": { @@ -4501,8 +6122,8 @@ 0 ], "size": [ - 1878, - 674 + 1907, + 932 ], "type": "frame" } @@ -4608,41 +6229,14 @@ "workflow_outputs": [] }, "3": { - "annotation": "", + "annotation": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", "content_id": null, "errors": null, "id": 3, "input_connections": {}, "inputs": [ { - "description": "", - "name": "Will you use a second haplotype?" - } - ], - "label": "Will you use a second haplotype?", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 99.30947543769571, - "top": 372.6782510205104 - }, - "tool_id": null, - "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "697b66dc-1c0f-40d7-9d03-51318db580f1", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", - "content_id": null, - "errors": null, - "id": 4, - "input_connections": {}, - "inputs": [ - { - "description": "Assembly for Haplotype 2. If \"Will you use a second haplotype?\" is set to \"no\", use haplotype 1 here. ", + "description": "Assembly for Haplotype 2. Leave unset for single-haplotype mode.", "name": "Haplotype 2" } ], @@ -4650,22 +6244,22 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 146.6219754376957, - "top": 485.6470010205102 + "left": 148.96736152646798, + "top": 550.4783156591526 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_state": "{\"optional\": true, \"format\": [\"fasta\"], \"tag\": null}", "tool_version": null, "type": "data_input", "uuid": "b6516e91-ade5-457d-9b65-d54448413a13", "when": null, "workflow_outputs": [] }, - "5": { + "4": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", "errors": null, - "id": 5, + "id": 4, "input_connections": { "busco_database": { "id": 1, @@ -4694,8 +6288,8 @@ } ], "position": { - "left": 905.7228651529651, - "top": 37.836439137037075 + "left": 1183.2582928520926, + "top": 125.52405367841573 }, "post_job_actions": { "HideDatasetActionfull_table_busco": { @@ -4732,39 +6326,123 @@ "uuid": "e4ca5b86-c0b2-464a-b382-a4f4e97c40a0", "when": null, "workflow_outputs": [ + { + "label": "Compleasm hap1 - Busco", + "output_name": "full_table_busco", + "uuid": "9433e53e-de87-4279-8401-84d955a35da0" + }, { "label": "Compleasm hap1 - Miniprot", "output_name": "miniprot", "uuid": "336d5918-9421-4d36-b2e0-e89209c0d6bb" + } + ] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 3, + "output_name": "output" }, + "style_cond|type_cond|pick_from_1|value": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ { - "label": "Compleasm hap1 - Busco", - "output_name": "full_table_busco", - "uuid": "9433e53e-de87-4279-8401-84d955a35da0" + "name": "data_param", + "type": "input" } - ] + ], + "position": { + "left": 746.9256373665904, + "top": 430.7771701722245 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"RuntimeValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "698ddeb1-6e84-45cc-90ea-085480ecb65d", + "when": null, + "workflow_outputs": [] }, "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 750.8966317506477, + "top": 641.3761348336536 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"data\", \"__current_case__\": 4, \"input_param\": {\"__class__\": \"RuntimeValue\"}, \"mappings\": []}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "307bee50-826f-4d00-949a-12b49dc02f69", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "errors": null, + "id": 7, "input_connections": { "busco_database": { "id": 1, "output_name": "output" }, "input": { - "id": 4, - "output_name": "output" + "id": 5, + "output_name": "data_param" }, "lineage_dataset": { "id": 0, "output_name": "output" }, "when": { - "id": 3, - "output_name": "output" + "id": 6, + "output_name": "output_param_boolean" } }, "inputs": [], @@ -4781,8 +6459,8 @@ } ], "position": { - "left": 904.6898830986931, - "top": 334.1815908697498 + "left": 1185.8452970971932, + "top": 508.18761488562814 }, "post_job_actions": { "HideDatasetActionfull_table_busco": { @@ -4831,19 +6509,19 @@ } ] }, - "7": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy3", "errors": null, - "id": 7, + "id": 8, "input_connections": { "inputs": [ { - "id": 5, + "id": 4, "output_name": "miniprot" }, { - "id": 6, + "id": 7, "output_name": "miniprot" } ] @@ -4858,8 +6536,8 @@ } ], "position": { - "left": 1153.9599688264059, - "top": 242.00007324218757 + "left": 1523.98198855252, + "top": 284.23731575830993 }, "post_job_actions": { "RenameDatasetActionout_file1": { @@ -4891,14 +6569,14 @@ } ] }, - "8": { + "9": { "annotation": "", "content_id": "gff2bed1", "errors": null, - "id": 8, + "id": 9, "input_connections": { "input": { - "id": 7, + "id": 8, "output_name": "out_file1" } }, @@ -4912,8 +6590,8 @@ } ], "position": { - "left": 1332.1163408967184, - "top": 460.55012207031257 + "left": 1654.9581382906902, + "top": 509.1752168828822 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -4931,14 +6609,14 @@ "when": null, "workflow_outputs": [] }, - "9": { + "10": { "annotation": "", "content_id": "Filter1", "errors": null, - "id": 9, + "id": 10, "input_connections": { "input": { - "id": 8, + "id": 9, "output_name": "out_file1" } }, @@ -4952,8 +6630,8 @@ } ], "position": { - "left": 1443.2725908967184, - "top": 119.82502441406257 + "left": 1794.0132403968241, + "top": 137.49084080981893 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -4971,14 +6649,14 @@ "when": null, "workflow_outputs": [] }, - "10": { + "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_uniq_tool/9.5+galaxy3", "errors": null, - "id": 10, + "id": 11, "input_connections": { "infile": { - "id": 9, + "id": 10, "output_name": "out_file1" } }, @@ -4992,8 +6670,8 @@ } ], "position": { - "left": 1675.5415117951559, - "top": 273.86872558593757 + "left": 1970.3524821920116, + "top": 348.8763838955442 }, "post_job_actions": { "HideDatasetActionoutfile": { @@ -5017,14 +6695,14 @@ "when": null, "workflow_outputs": [] }, - "11": { + "12": { "annotation": "", "content_id": "Cut1", "errors": null, - "id": 11, + "id": 12, "input_connections": { "input": { - "id": 10, + "id": 11, "output_name": "outfile" } }, @@ -5038,8 +6716,8 @@ } ], "position": { - "left": 1873.7536699982809, - "top": 436.83759765625007 + "left": 2189.450255861953, + "top": 568.0292815975416 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -5057,14 +6735,14 @@ "when": null, "workflow_outputs": [] }, - "12": { + "13": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", "errors": null, - "id": 12, + "id": 13, "input_connections": { "input": { - "id": 11, + "id": 12, "output_name": "out_file1" } }, @@ -5078,8 +6756,8 @@ } ], "position": { - "left": 2105.841072342031, - "top": 490.40009765625007 + "left": 2399.7988913424965, + "top": 714.6015058165053 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { @@ -5127,7 +6805,7 @@ } }, "tags": [], - "uuid": "18b64162-46a2-4251-bfa5-961b9be0e794" + "uuid": "6386e89f-541f-4110-bb72-aef511b4df2d" }, "tool_id": null, "type": "subworkflow", @@ -5143,14 +6821,10 @@ }, "36": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 36, "input_connections": { - "highRes": { - "id": 16, - "output_name": "output" - }, "input": { "id": 31, "output_name": "Precuration Hi-C alignments" @@ -5158,6 +6832,10 @@ "map_qual": { "id": 17, "output_name": "output" + }, + "ultraRes": { + "id": 14, + "output_name": "output" } }, "inputs": [], @@ -5170,8 +6848,8 @@ } ], "position": { - "left": 3973.4164481149905, - "top": 1136.237612582866 + "left": 3974.8278907852196, + "top": 1136.2343393879612 }, "post_job_actions": { "HideDatasetActionpretext_map_out": { @@ -5187,16 +6865,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", "when": null, @@ -5204,17 +6882,17 @@ }, "37": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 37, "input_connections": { - "highRes": { - "id": 16, - "output_name": "output" - }, "input": { "id": 31, "output_name": "Precuration Hi-C alignments" + }, + "ultraRes": { + "id": 14, + "output_name": "output" } }, "inputs": [], @@ -5244,16 +6922,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", "when": null, @@ -5261,7 +6939,7 @@ }, "38": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 38, "input_connections": { @@ -5290,16 +6968,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", "when": null, @@ -5307,7 +6985,7 @@ }, "39": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "errors": null, "id": 39, "input_connections": { @@ -5340,16 +7018,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy1", "tool_shed_repository": { - "changeset_revision": "bd07b0d0f568", + "changeset_revision": "7087d9a23185", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"ultraRes\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.4+galaxy0", + "tool_version": "0.2.4+galaxy1", "type": "tool", "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", "when": null, @@ -5376,8 +7054,8 @@ } ], "position": { - "left": 2626.2625122070312, - "top": 1262.8624877929688 + "left": 2411.528944914808, + "top": 1269.9230388683554 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -5423,8 +7101,8 @@ } ], "position": { - "left": 2665.8374633789062, - "top": 1619.3125 + "left": 2451.103896086683, + "top": 1626.3730510753867 }, "post_job_actions": { "HideDatasetActionout_file1": { @@ -5528,7 +7206,7 @@ "output_name": "alignment_output" }, "when": { - "id": 24, + "id": 23, "output_name": "Has multiple samples" } }, @@ -5578,7 +7256,7 @@ "output_name": "alignment_output" }, "when": { - "id": 24, + "id": 23, "output_name": "Has a single sample" } }, @@ -5724,8 +7402,8 @@ } ], "position": { - "left": 2896.8187866210938, - "top": 1319.72509765625 + "left": 2682.0852193288706, + "top": 1326.7856487316367 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { @@ -5777,7 +7455,7 @@ } }, "inputs": [], - "label": "P telomere bed ", + "label": "P telomere bed", "name": "Cut", "outputs": [ { @@ -5786,8 +7464,8 @@ } ], "position": { - "left": 2899.6375122070312, - "top": 1543.53125 + "left": 2684.903944914808, + "top": 1550.5918010753867 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { @@ -5852,10 +7530,16 @@ } ], "position": { - "left": 3663.9331595238805, - "top": 440.8730581971614 + "left": 3638.4556330865757, + "top": 323.205798530103 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } }, - "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "tool_shed_repository": { "changeset_revision": "b19e21af9c52", @@ -6067,8 +7751,8 @@ } ], "position": { - "left": 3158.901898076252, - "top": 1266.582592170533 + "left": 2944.168330784029, + "top": 1273.6431432459196 }, "post_job_actions": { "HideDatasetActiontext_param": { @@ -6107,8 +7791,8 @@ } ], "position": { - "left": 3174.0897711185717, - "top": 1637.7439948451865 + "left": 2959.3562038263485, + "top": 1644.8045459205732 }, "post_job_actions": { "HideDatasetActiontext_param": { @@ -6215,7 +7899,13 @@ "left": 3270.6159423253503, "top": 2206.55560224621 }, - "post_job_actions": {}, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", "tool_shed_repository": { "changeset_revision": "fb6d5ffc365f", @@ -6252,8 +7942,8 @@ } ], "position": { - "left": 3459.9078024663245, - "top": 1351.4977300677754 + "left": 3245.1742351741013, + "top": 1358.558281143162 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -6298,8 +7988,8 @@ } ], "position": { - "left": 3464.3675577025474, - "top": 1561.2479958064835 + "left": 3249.6339904103243, + "top": 1568.3085468818701 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -6444,10 +8134,16 @@ } ], "position": { - "left": 3507.5000610351562, - "top": 2187.0499267578125 + "left": 3501.703996641955, + "top": 2151.1234876899525 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } }, - "post_job_actions": {}, "tool_id": "Filter1", "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond\": \"c3==0\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, @@ -6589,7 +8285,13 @@ "left": 3690, "top": 1950 }, - "post_job_actions": {}, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "tool_shed_repository": { "changeset_revision": "61f9ddbc63ca", @@ -6736,6 +8438,11 @@ }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" } }, "tool_id": "Cut1", @@ -6879,7 +8586,13 @@ "left": 4000, "top": 1930 }, - "post_job_actions": {}, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", "tool_shed_repository": { "changeset_revision": "2892111d91f8", @@ -6920,8 +8633,8 @@ } ], "position": { - "left": 5209.343908674279, - "top": 454.22902989287815 + "left": 5173.922126970842, + "top": 540.3943162334747 }, "post_job_actions": { "HideDatasetActiondata_param": { @@ -7510,6 +9223,6 @@ } }, "tags": [], - "uuid": "df881079-652c-4da2-ad8f-c3b098f5ce91", + "uuid": "543e3bcd-5d1a-4893-bfb1-9b28a665a638", "version": 4 }