diff --git a/torchbase/cli.py b/torchbase/cli.py index 57b656e..34daa85 100755 --- a/torchbase/cli.py +++ b/torchbase/cli.py @@ -204,9 +204,14 @@ def _strategy_callback(ctx, param, value): @ReadsParam("-pe2", "--paired2", "--pe2") @ReadsParam("-i", "--interlaced") @ReadsParam("-l", "--longreads") +@click.option("--quality-json", type=click.Path(exists=True), default=None, help="Quality JSON file for suspect data filtering") +@click.option("--include-suspect-alleles", "allele_filter", flag_value="include", default=True, help="Include suspect alleles (default)") +@click.option("--exclude-suspect-alleles", "allele_filter", flag_value="exclude", help="Exclude suspect alleles") +@click.option("--exclude-suspect-loci", is_flag=True, default=False, help="Exclude suspect loci") +@click.option("--exclude-suspect-profiles", is_flag=True, default=False, help="Exclude suspect profiles") @click.argument('torch_args', nargs=-1, type=click.UNPROCESSED) @click.pass_context -def _run(clx, torch, cromwell_options="", method="main", workflow=None, output=None, strategy='balanced', contigs=None, reads=None, paired1=None, paired2=None, interlaced=None, longreads=None, torch_args=[]): +def _run(clx, torch, cromwell_options="", method="main", workflow=None, output=None, strategy='balanced', contigs=None, reads=None, paired1=None, paired2=None, interlaced=None, longreads=None, quality_json=None, allele_filter="include", exclude_suspect_loci=False, exclude_suspect_profiles=False, torch_args=[]): "Run the selected torch." from torchbase.torchfs import Torch from torchbase.registry import RegistryManager @@ -307,6 +312,16 @@ def _run(clx, torch, cromwell_options="", method="main", workflow=None, output=N if longreads: miniwdl_cmd.extend(['longreads=' + str(longreads)]) + # Add quality.json and suspect data flags + if quality_json: + miniwdl_cmd.extend(['quality_json=' + str(quality_json)]) + if allele_filter == "exclude": + miniwdl_cmd.append('exclude_suspect_alleles=true') + if exclude_suspect_loci: + miniwdl_cmd.append('exclude_suspect_loci=true') + if exclude_suspect_profiles: + miniwdl_cmd.append('exclude_suspect_profiles=true') + # Execute workflow result = run(miniwdl_cmd) diff --git a/torchbase/tests/test_suspect_data_workflow_flags.py b/torchbase/tests/test_suspect_data_workflow_flags.py new file mode 100644 index 0000000..75997e5 --- /dev/null +++ b/torchbase/tests/test_suspect_data_workflow_flags.py @@ -0,0 +1,889 @@ +"""Acceptance tests for suspect data workflow flags (Issue #22). + +These are RED-phase tests - they MUST fail because the feature is not yet implemented. + +Acceptance criteria: +- Workflow reads quality.json if present +- CLI flags: --include-suspect-alleles (default), --exclude-suspect-alleles +- Additional flags: --exclude-suspect-loci, --exclude-suspect-profiles +- Workflow filters allele database based on flags before MinHash/alignment +- Results note which alleles/loci were excluded (if any) +- Works when quality.json absent (no filtering) +- Tests verify filtering behavior at all three levels +- Documentation: flag semantics and defaults +""" + +import pytest +import json +import tempfile +from pathlib import Path +import subprocess + + +# Get the torchbase root directory +TORCHBASE_ROOT = Path(__file__).parent.parent + + +@pytest.fixture +def quality_json_with_suspect_data(): + """Create a quality.json file with suspect alleles, loci, and profiles.""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + quality_path = tmpdir_path / "quality.json" + + quality_data = { + "loci": { + "salmonella_adk": { + "similarities": { + "adk_1-adk_2": 45.5, + "adk_1-adk_3": 98.5 + }, + "threshold": 90.0, + "statistics": { + "mean": 72.0, + "std_dev": 31.2, + "min": 45.5, + "max": 98.5, + "percentile_99": 97.0, + "threshold_type": "percentile" + } + }, + "salmonella_fumC": { + "similarities": { + "fumC_1-fumC_2": 42.3 + }, + "threshold": 70.0, + "statistics": { + "mean": 42.3, + "std_dev": 0.0, + "min": 42.3, + "max": 42.3, + "percentile_99": 42.3, + "threshold_type": "none" + } + }, + "salmonella_gyrB": { + "similarities": { + "gyrB_1-gyrB_2": 96.5 + }, + "threshold": 90.0, + "statistics": { + "mean": 96.5, + "std_dev": 0.0, + "min": 96.5, + "max": 96.5, + "percentile_99": 96.5, + "threshold_type": "percentile" + } + } + }, + "suspect_pairs": { + "salmonella_adk": [ + { + "allele1": "adk_1", + "allele2": "adk_3", + "similarity": 98.5, + "containment_1_in_2": 98.0, + "containment_2_in_1": 99.0, + "issue_type": "duplicate" + } + ], + "salmonella_gyrB": [ + { + "allele1": "gyrB_1", + "allele2": "gyrB_2", + "similarity": 96.5, + "containment_1_in_2": 96.0, + "containment_2_in_1": 97.0, + "issue_type": "overlap" + } + ] + }, + "summary": { + "total_loci": 3, + "total_suspect_allele_pairs": 2, + "suspect_loci": ["salmonella_adk", "salmonella_gyrB"], + "suspect_profiles": ["salmonella_adk", "salmonella_gyrB"] + } + } + + with open(quality_path, "w") as f: + json.dump(quality_data, f, indent=2) + + yield quality_path + + +@pytest.fixture +def allele_database_with_suspects(): + """Create an allele database FASTA that matches quality.json.""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + db_path = tmpdir_path / "alleles.fasta" + + fasta_content = """>salmonella_adk_1 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCAA +>salmonella_adk_2 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCAC +>salmonella_adk_3 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCAA +>salmonella_fumC_1 +CTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGA +>salmonella_fumC_2 +CTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGC +>salmonella_gyrB_1 +ATGACCCAACTGAAAGTGATGCCGCAACGTGTCGACCTGCAAATCCACGCAGTGCTGATGAAACCGATG +>salmonella_gyrB_2 +ATGACCCAACTGAAAGTGATGCCGCAACGTGTCGACCTGCAAATCCACGCAGTGCTGATGAAACCGATC +""" + + with open(db_path, "w") as f: + f.write(fasta_content) + + yield db_path + + +@pytest.fixture +def profile_table(): + """Create a profile table TSV.""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + profile_path = tmpdir_path / "profiles.tsv" + + profile_content = """ST\tsalmonella_adk\tsalmonella_fumC\tsalmonella_gyrB +1\t1\t1\t1 +2\t2\t2\t1 +3\t1\t2\t2 +""" + + with open(profile_path, "w") as f: + f.write(profile_content) + + yield profile_path + + +@pytest.fixture +def query_contigs(): + """Create query contigs matching ST=1.""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + contigs_path = tmpdir_path / "query.fasta" + + fasta_content = """>contig1_adk_1 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCAA +>contig2_fumC_1 +CTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGA +>contig3_gyrB_1 +ATGACCCAACTGAAAGTGATGCCGCAACGTGTCGACCTGCAAATCCACGCAGTGCTGATGAAACCGATG +""" + + with open(contigs_path, "w") as f: + f.write(fasta_content) + + yield contigs_path + + +@pytest.fixture +def mlst_workflow_path(): + """Path to the main MLST workflow WDL file. + + Using balanced_typing.wdl as the baseline workflow that should + support quality.json and suspect data filtering. + """ + return TORCHBASE_ROOT / "workflows" / "builtin" / "balanced_typing.wdl" + + +class TestWorkflowReadsQualityJson: + """Test workflow reads quality.json if present.""" + + def test_workflow_accepts_quality_json_parameter(self, mlst_workflow_path): + """WDL workflow accepts quality_json as optional input parameter""" + with open(mlst_workflow_path) as f: + content = f.read() + + assert "File? quality_json" in content or "quality" in content.lower(), \ + "Workflow does not accept quality_json input parameter" + + def test_workflow_loads_quality_json_content(self, mlst_workflow_path): + """WDL workflow loads and parses quality.json content""" + with open(mlst_workflow_path) as f: + content = f.read() + + # Should have logic to read quality.json + assert "quality" in content.lower(), \ + "Workflow does not load quality.json" + + def test_workflow_extracts_suspect_data_from_quality_json(self, mlst_workflow_path): + """WDL workflow extracts suspect alleles, loci, profiles from quality.json""" + with open(mlst_workflow_path) as f: + content = f.read() + + assert "suspect" in content.lower(), \ + "Workflow does not extract suspect data from quality.json" + + +class TestCLIFlagsForSuspectAlleles: + """Test CLI flags: --include-suspect-alleles (default), --exclude-suspect-alleles.""" + + def test_cli_has_include_suspect_alleles_flag(self): + """CLI has --include-suspect-alleles flag""" + # Check if flag exists in CLI help + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + assert "--include-suspect-alleles" in result.stdout or \ + "--exclude-suspect-alleles" in result.stdout, \ + "CLI does not have suspect alleles flags" + + def test_cli_has_exclude_suspect_alleles_flag(self): + """CLI has --exclude-suspect-alleles flag""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + assert "--exclude-suspect-alleles" in result.stdout, \ + "CLI does not have --exclude-suspect-alleles flag" + + def test_cli_include_suspect_alleles_is_default(self): + """CLI --include-suspect-alleles is the default behavior""" + # This would be tested by checking default parameter value + # For now, verify that the help text indicates the default + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + # Default should be include (no filtering) + assert "default" in result.stdout.lower() or \ + "include" in result.stdout.lower(), \ + "Default suspect allele behavior not documented" + + def test_cli_flags_are_mutually_exclusive(self): + """CLI --include-suspect-alleles and --exclude-suspect-alleles are mutually exclusive""" + # Try to use both flags at once - should fail + result = subprocess.run( + ["torchbase", "run", "--include-suspect-alleles", + "--exclude-suspect-alleles", "dummy_torch"], + capture_output=True, + text=True + ) + + # Should error + assert result.returncode != 0, \ + "CLI allows both --include and --exclude suspect alleles flags" + + +class TestCLIFlagsForSuspectLoci: + """Test CLI flag: --exclude-suspect-loci.""" + + def test_cli_has_exclude_suspect_loci_flag(self): + """CLI has --exclude-suspect-loci flag""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + assert "--exclude-suspect-loci" in result.stdout, \ + "CLI does not have --exclude-suspect-loci flag" + + def test_exclude_suspect_loci_implies_exclude_suspect_alleles(self): + """Excluding suspect loci implicitly excludes all their alleles""" + # This is a logical constraint that should be enforced + # Tested via integration test + pass + + +class TestCLIFlagsForSuspectProfiles: + """Test CLI flag: --exclude-suspect-profiles.""" + + def test_cli_has_exclude_suspect_profiles_flag(self): + """CLI has --exclude-suspect-profiles flag""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + assert "--exclude-suspect-profiles" in result.stdout, \ + "CLI does not have --exclude-suspect-profiles flag" + + def test_exclude_suspect_profiles_implies_exclude_suspect_loci(self): + """Excluding suspect profiles implicitly excludes suspect loci and alleles""" + # This is a logical constraint that should be enforced + # Tested via integration test + pass + + +class TestWorkflowFiltersAlleleDatabase: + """Test workflow filters allele database based on flags before MinHash/alignment.""" + + def test_workflow_has_filter_alleles_task(self, mlst_workflow_path): + """WDL workflow has task to filter alleles based on quality.json""" + with open(mlst_workflow_path) as f: + content = f.read() + + assert "filter" in content.lower() and "allele" in content.lower(), \ + "Workflow does not have allele filtering task" + + def test_workflow_filters_before_minhash(self, mlst_workflow_path): + """WDL workflow filters alleles before MinHash step""" + with open(mlst_workflow_path) as f: + content = f.read() + + # Filter should occur before sketch_sequences task + filter_pos = content.lower().find("filter") + sketch_pos = content.lower().find("sketch_sequences") + + assert filter_pos > 0 and sketch_pos > 0 and filter_pos < sketch_pos, \ + "Workflow does not filter alleles before MinHash" + + def test_workflow_filters_before_alignment(self, mlst_workflow_path): + """WDL workflow filters alleles before alignment step""" + with open(mlst_workflow_path) as f: + content = f.read() + + # Filter should apply to alignment as well + assert "filter" in content.lower() and "align" in content.lower(), \ + "Workflow does not filter alleles before alignment" + + def test_workflow_conditional_filtering_based_on_flags(self, mlst_workflow_path): + """WDL workflow conditionally filters based on input flags""" + with open(mlst_workflow_path) as f: + content = f.read() + + # Should have conditional logic (if/select_first) for filtering + assert ("if" in content or "select_first" in content) and "filter" in content.lower(), \ + "Workflow does not conditionally apply filtering" + + +@pytest.mark.miniwdl +class TestWorkflowExcludeSuspectAllelesIntegration: + """Integration test: workflow excludes suspect alleles when flag is set.""" + + def test_workflow_excludes_suspect_alleles( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table, quality_json_with_suspect_data + ): + """Workflow execution with --exclude-suspect-alleles filters suspect alleles""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(allele_database_with_suspects), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_json_with_suspect_data), + "mlst_typing.exclude_suspect_alleles": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + assert result.returncode == 0, f"Workflow execution failed: {result.stderr}" + + # Find output + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + assert len(output_dirs) > 0, "No outputs.json found" + + with open(output_dirs[0]) as f: + outputs = json.load(f) + + result_path = Path(outputs["mlst_typing.typing_result"]) + with open(result_path) as f: + result_data = json.load(f) + + # Result should indicate that suspect alleles were excluded + assert "excluded_alleles" in result_data or "filtering" in result_data, \ + "Result does not indicate allele filtering" + + def test_workflow_includes_suspect_alleles_by_default( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table, quality_json_with_suspect_data + ): + """Workflow execution without flags includes suspect alleles (default)""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # No exclude flags - default is include + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(allele_database_with_suspects), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_json_with_suspect_data) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + assert result.returncode == 0, f"Workflow execution failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + result_path = Path(outputs["mlst_typing.typing_result"]) + with open(result_path) as f: + result_data = json.load(f) + + # Result should not indicate filtering (default includes all) + # Or should explicitly state no filtering applied + if "excluded_alleles" in result_data: + assert len(result_data["excluded_alleles"]) == 0, \ + "Default behavior excluded alleles" + + +@pytest.mark.miniwdl +class TestWorkflowExcludeSuspectLociIntegration: + """Integration test: workflow excludes suspect loci when flag is set.""" + + def test_workflow_excludes_suspect_loci( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table, quality_json_with_suspect_data + ): + """Workflow execution with --exclude-suspect-loci filters suspect loci""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(allele_database_with_suspects), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_json_with_suspect_data), + "mlst_typing.exclude_suspect_loci": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + assert result.returncode == 0, f"Workflow execution failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + result_path = Path(outputs["mlst_typing.typing_result"]) + with open(result_path) as f: + result_data = json.load(f) + + # Result should indicate that suspect loci were excluded + assert "excluded_loci" in result_data, \ + "Result does not indicate loci filtering" + + # salmonella_adk and salmonella_gyrB should be excluded + excluded_loci = result_data.get("excluded_loci", []) + assert "salmonella_adk" in excluded_loci or \ + "salmonella_gyrB" in excluded_loci, \ + "Suspect loci not excluded" + + +@pytest.mark.miniwdl +class TestWorkflowExcludeSuspectProfilesIntegration: + """Integration test: workflow excludes suspect profiles when flag is set.""" + + def test_workflow_excludes_suspect_profiles( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table, quality_json_with_suspect_data + ): + """Workflow execution with --exclude-suspect-profiles filters suspect profiles""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(allele_database_with_suspects), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_json_with_suspect_data), + "mlst_typing.exclude_suspect_profiles": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + assert result.returncode == 0, f"Workflow execution failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + result_path = Path(outputs["mlst_typing.typing_result"]) + with open(result_path) as f: + result_data = json.load(f) + + # Result should indicate that suspect profiles were excluded + assert "excluded_profiles" in result_data, \ + "Result does not indicate profile filtering" + + +class TestWorkflowResultsNoteExclusions: + """Test results note which alleles/loci were excluded (if any).""" + + def test_result_json_has_exclusion_fields(self, mlst_workflow_path): + """Result JSON structure includes fields for exclusion information""" + # Verify workflow output structure (would be in assemble_final_result task) + with open(mlst_workflow_path) as f: + content = f.read() + + # Should have logic to include exclusion info in result + assert "excluded" in content.lower() or "filtering" in content.lower(), \ + "Workflow does not include exclusion information in results" + + def test_result_includes_count_of_excluded_alleles(self): + """Result includes count of excluded alleles""" + # Tested via integration test - result should have excluded_alleles count + pass + + def test_result_includes_list_of_excluded_alleles(self): + """Result includes list of excluded allele IDs""" + # Tested via integration test - result should list excluded allele IDs + pass + + def test_result_includes_count_of_excluded_loci(self): + """Result includes count of excluded loci""" + # Tested via integration test - result should have excluded_loci count + pass + + def test_result_includes_list_of_excluded_loci(self): + """Result includes list of excluded loci names""" + # Tested via integration test - result should list excluded loci names + pass + + +class TestWorkflowWorksWithoutQualityJson: + """Test workflow works when quality.json absent (no filtering).""" + + @pytest.mark.miniwdl + def test_workflow_runs_without_quality_json( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table + ): + """Workflow runs successfully without quality.json file""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # No quality.json provided + input_json = { + "balanced_typing.query_sequences": str(query_contigs), + "balanced_typing.allele_fasta": str(allele_database_with_suspects), + "balanced_typing.profiles_table": str(profile_table) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + assert result.returncode == 0, \ + f"Workflow should run without quality.json: {result.stderr}" + + def test_workflow_without_quality_json_includes_all_alleles( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table + ): + """Workflow without quality.json includes all alleles (no filtering)""" + # Should behave same as default (include all) + # Tested via integration test + pass + + @pytest.mark.miniwdl + def test_exclude_flags_without_quality_json_are_ignored( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table + ): + """Exclude flags without quality.json are silently ignored""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Exclude flags but no quality.json - should ignore and not error + input_json = { + "balanced_typing.query_sequences": str(query_contigs), + "balanced_typing.allele_fasta": str(allele_database_with_suspects), + "balanced_typing.profiles_table": str(profile_table), + "balanced_typing.exclude_suspect_alleles": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + # Should succeed (silently ignore the flag) + assert result.returncode == 0, \ + f"Workflow should ignore exclude flags without quality.json: {result.stderr}" + + +class TestFilteringBehaviorAtAllThreeLevels: + """Test filtering behavior at allele, loci, and profile levels.""" + + def test_allele_level_filtering_excludes_specific_alleles(self): + """Allele-level filtering excludes only flagged alleles""" + # In quality.json: adk_1 and adk_3 are suspect + # Filter should exclude adk_1 and adk_3 but keep adk_2 + pass + + def test_loci_level_filtering_excludes_all_locus_alleles(self): + """Loci-level filtering excludes all alleles of flagged loci""" + # In quality.json: salmonella_adk and salmonella_gyrB are suspect loci + # Filter should exclude all adk and gyrB alleles + pass + + def test_profile_level_filtering_excludes_profile_loci(self): + """Profile-level filtering excludes loci involved in suspect profiles""" + # In quality.json: suspect_profiles include salmonella_adk, salmonella_gyrB + # Filter should exclude all alleles from those loci + pass + + def test_hierarchical_filtering_allele_subset_of_loci(self): + """Allele filtering is subset of loci filtering""" + # Excluding loci should implicitly exclude their alleles + pass + + def test_hierarchical_filtering_loci_subset_of_profiles(self): + """Loci filtering is subset of profile filtering""" + # Excluding profiles should implicitly exclude their loci + pass + + +class TestFlagSemanticsAndDocumentation: + """Test flag semantics and documentation.""" + + def test_flag_names_use_positive_semantics(self): + """Flags use positive semantics (--include, --exclude) not double-negatives""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + # Should not have double-negative flags like --no-exclude + assert "--no-exclude" not in result.stdout.lower() and \ + "--no-no-" not in result.stdout.lower(), \ + "Flags use double-negative semantics" + + def test_flag_help_text_explains_default_behavior(self): + """Flag help text explains default behavior (include suspect data)""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + # Help should explain default is to include + assert "default" in result.stdout.lower() or \ + "include" in result.stdout.lower(), \ + "Help text does not explain default behavior" + + def test_flag_help_text_explains_quality_json_requirement(self): + """Flag help text explains quality.json is required for filtering""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + # Help should mention quality.json + assert "quality" in result.stdout.lower(), \ + "Help text does not mention quality.json requirement" + + def test_flag_help_text_explains_hierarchical_filtering(self): + """Flag help text explains hierarchical filtering (profiles > loci > alleles)""" + result = subprocess.run( + ["torchbase", "run", "--help"], + capture_output=True, + text=True + ) + + # Help should explain hierarchy + assert "allele" in result.stdout.lower() and \ + "loci" in result.stdout.lower(), \ + "Help text does not explain filtering hierarchy" + + +@pytest.mark.miniwdl +class TestEdgeCasesForSuspectDataFiltering: + """Test edge cases for suspect data filtering.""" + + def test_empty_quality_json_no_filtering( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table + ): + """Empty quality.json (no suspects) results in no filtering""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Empty quality.json + quality_path = tmpdir_path / "quality.json" + with open(quality_path, "w") as f: + json.dump({ + "loci": {}, + "suspect_pairs": {}, + "summary": { + "total_loci": 0, + "total_suspect_allele_pairs": 0, + "suspect_loci": [], + "suspect_profiles": [] + } + }, f) + + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(allele_database_with_suspects), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_path), + "mlst_typing.exclude_suspect_alleles": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + assert result.returncode == 0, f"Workflow failed: {result.stderr}" + + def test_malformed_quality_json_handled_gracefully( + self, mlst_workflow_path, query_contigs, allele_database_with_suspects, + profile_table + ): + """Malformed quality.json is handled gracefully (error or skip)""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Malformed quality.json + quality_path = tmpdir_path / "quality.json" + with open(quality_path, "w") as f: + f.write("{ invalid json }") + + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(allele_database_with_suspects), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_path), + "mlst_typing.exclude_suspect_alleles": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + # Should either error gracefully or skip filtering + # Either way, shouldn't crash with unhandled exception + assert "unhandled" not in result.stderr.lower(), \ + "Malformed quality.json caused unhandled exception" + + def test_all_alleles_excluded_handled_gracefully( + self, mlst_workflow_path, query_contigs, profile_table + ): + """Workflow handles case where all alleles are excluded""" + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Create quality.json where all alleles are suspect + quality_path = tmpdir_path / "quality.json" + quality_data = { + "summary": { + "total_loci": 3, + "suspect_loci": ["salmonella_adk", "salmonella_fumC", "salmonella_gyrB"], + "suspect_profiles": ["salmonella_adk", "salmonella_fumC", "salmonella_gyrB"] + } + } + with open(quality_path, "w") as f: + json.dump(quality_data, f) + + # Create allele DB with only suspect alleles + db_path = tmpdir_path / "alleles.fasta" + with open(db_path, "w") as f: + f.write(">salmonella_adk_1\nATGC\n") + + input_json = { + "mlst_typing.contigs": str(query_contigs), + "mlst_typing.allele_database": str(db_path), + "mlst_typing.profiles": str(profile_table), + "mlst_typing.quality_json": str(quality_path), + "mlst_typing.exclude_suspect_loci": True + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + subprocess.run( + ["miniwdl", "run", str(mlst_workflow_path), "-i", str(input_json_path), + "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=600 + ) + + # Should handle gracefully - either warn or produce empty result + # Should not crash + pass diff --git a/torchbase/workflows/builtin/balanced_typing.wdl b/torchbase/workflows/builtin/balanced_typing.wdl index b3e7038..d39e0b2 100644 --- a/torchbase/workflows/builtin/balanced_typing.wdl +++ b/torchbase/workflows/builtin/balanced_typing.wdl @@ -3,6 +3,7 @@ version 1.0 import "tasks/minhash.wdl" as minhash import "tasks/alignment.wdl" as alignment import "tasks/profile_lookup.wdl" as profile_lookup +import "tasks/filter_alleles.wdl" as filter workflow balanced_typing { input { @@ -11,8 +12,25 @@ workflow balanced_typing { File profiles_table String input_type = "contigs" Float confidence_threshold = 0.85 + File? quality_json + Boolean exclude_suspect_alleles = false + Boolean exclude_suspect_loci = false + Boolean exclude_suspect_profiles = false } + # Step 0: Filter alleles based on quality.json if provided + call filter.filter_alleles { + input: + allele_fasta = allele_fasta, + quality_json = quality_json, + exclude_suspect_alleles = exclude_suspect_alleles, + exclude_suspect_loci = exclude_suspect_loci, + exclude_suspect_profiles = exclude_suspect_profiles + } + + # Use filtered alleles for all downstream tasks + File working_allele_fasta = filter_alleles.filtered_fasta + # Step 1: MinHash sketching and comparison call minhash.sketch_sequences as sketch_queries { input: @@ -23,7 +41,7 @@ workflow balanced_typing { call minhash.sketch_sequences as sketch_alleles { input: - sequences = allele_fasta, + sequences = working_allele_fasta, ksize = 31, scaled = 1000 } @@ -32,7 +50,7 @@ workflow balanced_typing { input: query_sketch = sketch_queries.sketch, allele_sketch = sketch_alleles.sketch, - allele_fasta = allele_fasta + allele_fasta = working_allele_fasta } # Step 2: Call alleles using MinHash @@ -40,7 +58,7 @@ workflow balanced_typing { input: similarity_matrix = compare_sketches.similarity_csv, query_sequences = query_sequences, - allele_fasta = allele_fasta, + allele_fasta = working_allele_fasta, confidence_threshold = confidence_threshold } @@ -57,7 +75,7 @@ workflow balanced_typing { call alignment.align_and_call as alignment_fallback { input: query_sequences = query_sequences, - allele_fasta = allele_fasta, + allele_fasta = working_allele_fasta, input_type = input_type, identity_threshold = 0.90 } @@ -81,9 +99,16 @@ workflow balanced_typing { alignment_used = check_confidence_for_alignment.use_alignment } + # Step 7: Merge exclusion metadata into result + call add_exclusion_metadata { + input: + typing_result = lookup_profile.result, + exclusions = filter_alleles.exclusions + } + output { - # Output result JSON with standardized format including method metadata - File result = lookup_profile.result + # Output result JSON with standardized format including method metadata and exclusions + File result = add_exclusion_metadata.final_result } } @@ -194,3 +219,50 @@ PYTHON_SCRIPT memory: "1 GB" } } + +task add_exclusion_metadata { + input { + File typing_result + File exclusions + } + + command <<< + python3 <<'PYTHON_SCRIPT' +import json + +# Load typing result +with open("~{typing_result}") as f: + result = json.load(f) + +# Load exclusions +with open("~{exclusions}") as f: + exclusions = json.load(f) + +# Add exclusion metadata to result +if 'notes' not in result: + result['notes'] = {} + +result['notes']['exclusions'] = { + 'excluded_alleles': exclusions['excluded_alleles'], + 'excluded_loci': exclusions['excluded_loci'], + 'num_excluded_alleles': exclusions['num_excluded_alleles'], + 'num_excluded_loci': exclusions['num_excluded_loci'] +} + +# Write final result +with open('final_result.json', 'w') as f: + json.dump(result, f, indent=2) + +PYTHON_SCRIPT + >>> + + output { + File final_result = "final_result.json" + } + + runtime { + docker: "python:3.12-slim" + cpu: 1 + memory: "1 GB" + } +} diff --git a/torchbase/workflows/builtin/fast_typing.wdl b/torchbase/workflows/builtin/fast_typing.wdl index 4d79853..fbd4076 100644 --- a/torchbase/workflows/builtin/fast_typing.wdl +++ b/torchbase/workflows/builtin/fast_typing.wdl @@ -2,6 +2,7 @@ version 1.0 import "tasks/minhash.wdl" as minhash_tasks import "tasks/profile_lookup.wdl" as profile_tasks +import "tasks/filter_alleles.wdl" as filter workflow fast_typing { input { @@ -10,8 +11,24 @@ workflow fast_typing { File profiles_table Int ksize = 31 Int sketch_size = 1000 + File? quality_json + Boolean exclude_suspect_alleles = false + Boolean exclude_suspect_loci = false + Boolean exclude_suspect_profiles = false } + # Filter alleles if quality.json provided + call filter.filter_alleles { + input: + allele_fasta = allele_database, + quality_json = quality_json, + exclude_suspect_alleles = exclude_suspect_alleles, + exclude_suspect_loci = exclude_suspect_loci, + exclude_suspect_profiles = exclude_suspect_profiles + } + + File working_allele_fasta = filter_alleles.filtered_fasta + call minhash_tasks.sketch_sequences as sketch_queries { input: sequences = query_sequences, @@ -21,7 +38,7 @@ workflow fast_typing { call minhash_tasks.sketch_sequences as sketch_alleles { input: - sequences = allele_database, + sequences = working_allele_fasta, ksize = ksize, scaled = sketch_size } @@ -30,14 +47,14 @@ workflow fast_typing { input: query_sketch = sketch_queries.sketch, allele_sketch = sketch_alleles.sketch, - allele_fasta = allele_database + allele_fasta = working_allele_fasta } call minhash_tasks.call_alleles { input: similarity_matrix = compare_sketches.similarity_csv, query_sequences = query_sequences, - allele_fasta = allele_database + allele_fasta = working_allele_fasta } call profile_tasks.lookup_profile { @@ -48,7 +65,57 @@ workflow fast_typing { alignment_used = false } + call add_exclusion_metadata { + input: + typing_result = lookup_profile.result, + exclusions = filter_alleles.exclusions + } + output { - File typing_result = lookup_profile.result + File typing_result = add_exclusion_metadata.final_result } } + +task add_exclusion_metadata { + input { + File typing_result + File exclusions + } + + command <<< + python3 <<'PYTHON_SCRIPT' +import json + +with open("~{typing_result}") as f: + result = json.load(f) + +with open("~{exclusions}") as f: + exclusions = json.load(f) + +if 'notes' not in result: + result['notes'] = {} + +result['notes']['exclusions'] = { + 'excluded_alleles': exclusions['excluded_alleles'], + 'excluded_loci': exclusions['excluded_loci'], + 'num_excluded_alleles': exclusions['num_excluded_alleles'], + 'num_excluded_loci': exclusions['num_excluded_loci'] +} + +with open('final_result.json', 'w') as f: + json.dump(result, f, indent=2) + +PYTHON_SCRIPT + >>> + + output { + File final_result = "final_result.json" + } + + runtime { + docker: "python:3.12-slim" + cpu: 1 + memory: "1 GB" + } +} +} diff --git a/torchbase/workflows/builtin/sensitive_typing.wdl b/torchbase/workflows/builtin/sensitive_typing.wdl index 8e450b4..eeeb67c 100644 --- a/torchbase/workflows/builtin/sensitive_typing.wdl +++ b/torchbase/workflows/builtin/sensitive_typing.wdl @@ -3,6 +3,7 @@ version 1.0 import "tasks/minhash.wdl" as minhash import "tasks/alignment.wdl" as alignment import "tasks/profile_lookup.wdl" as profile_lookup +import "tasks/filter_alleles.wdl" as filter workflow sensitive_typing { input { @@ -11,8 +12,24 @@ workflow sensitive_typing { File profiles String preset = "asm5" Float confidence_threshold = 0.95 + File? quality_json + Boolean exclude_suspect_alleles = false + Boolean exclude_suspect_loci = false + Boolean exclude_suspect_profiles = false } + # Step 0: Filter alleles if quality.json provided + call filter.filter_alleles { + input: + allele_fasta = allele_database, + quality_json = quality_json, + exclude_suspect_alleles = exclude_suspect_alleles, + exclude_suspect_loci = exclude_suspect_loci, + exclude_suspect_profiles = exclude_suspect_profiles + } + + File working_allele_fasta = filter_alleles.filtered_fasta + # Step 1: Sketch query sequences with MinHash (for guidance only) call minhash.sketch_sequences as sketch_queries { input: @@ -24,7 +41,7 @@ workflow sensitive_typing { # Step 2: Sketch allele database with MinHash (for guidance only) call minhash.sketch_sequences as sketch_alleles { input: - sequences = allele_database, + sequences = working_allele_fasta, ksize = 31, scaled = 1000 } @@ -34,7 +51,7 @@ workflow sensitive_typing { input: query_sketch = sketch_queries.sketch, allele_sketch = sketch_alleles.sketch, - allele_fasta = allele_database + allele_fasta = working_allele_fasta } # Step 4: ALWAYS run full alignment with strict parameters using minimap2 @@ -43,7 +60,7 @@ workflow sensitive_typing { call alignment.align_and_call as alignment_call { input: query_sequences = query_sequences, - allele_fasta = allele_database, + allele_fasta = working_allele_fasta, input_type = "contigs", identity_threshold = confidence_threshold } @@ -57,7 +74,58 @@ workflow sensitive_typing { alignment_used = true } + # Step 6: Add exclusion metadata + call add_exclusion_metadata { + input: + typing_result = profile_call.result, + exclusions = filter_alleles.exclusions + } + output { - File typing_result = profile_call.result + File typing_result = add_exclusion_metadata.final_result } } + +task add_exclusion_metadata { + input { + File typing_result + File exclusions + } + + command <<< + python3 <<'PYTHON_SCRIPT' +import json + +with open("~{typing_result}") as f: + result = json.load(f) + +with open("~{exclusions}") as f: + exclusions = json.load(f) + +if 'notes' not in result: + result['notes'] = {} + +result['notes']['exclusions'] = { + 'excluded_alleles': exclusions['excluded_alleles'], + 'excluded_loci': exclusions['excluded_loci'], + 'num_excluded_alleles': exclusions['num_excluded_alleles'], + 'num_excluded_loci': exclusions['num_excluded_loci'] +} + +with open('final_result.json', 'w') as f: + json.dump(result, f, indent=2) + +PYTHON_SCRIPT + >>> + + output { + File final_result = "final_result.json" + } + + runtime { + docker: "python:3.12-slim" + cpu: 1 + memory: "1 GB" + } +} +} diff --git a/torchbase/workflows/builtin/tasks/filter_alleles.wdl b/torchbase/workflows/builtin/tasks/filter_alleles.wdl new file mode 100644 index 0000000..0cf2749 --- /dev/null +++ b/torchbase/workflows/builtin/tasks/filter_alleles.wdl @@ -0,0 +1,194 @@ +version 1.0 + +task filter_alleles { + input { + File allele_fasta + File? quality_json + Boolean exclude_suspect_alleles = false + Boolean exclude_suspect_loci = false + Boolean exclude_suspect_profiles = false + } + + command <<< + set -e + python3 <<'PYTHON_SCRIPT' +import json +from pathlib import Path + +def parse_fasta(fasta_path): + """Parse FASTA file into list of (header, sequence) tuples.""" + entries = [] + with open(fasta_path) as f: + current_header = None + current_seq = [] + for line in f: + line = line.strip() + if line.startswith('>'): + if current_header is not None: + entries.append((current_header, ''.join(current_seq))) + current_header = line[1:] + current_seq = [] + else: + current_seq.append(line) + if current_header is not None: + entries.append((current_header, ''.join(current_seq))) + return entries + +def extract_locus_and_allele(header): + """Extract locus name and allele ID from FASTA header. + + Expects format like: locus_name_allele_id + """ + parts = header.split('_') + if len(parts) >= 2: + allele_id = parts[-1] + locus = '_'.join(parts[:-1]) + return locus, allele_id + return header, "unknown" + +def load_quality_json(quality_path): + """Load quality.json and extract suspect data.""" + if not quality_path or not Path(quality_path).exists(): + return { + 'suspect_alleles': set(), + 'suspect_loci': set(), + 'suspect_profiles': set() + } + + with open(quality_path) as f: + quality_data = f.read().strip() + if not quality_data: + return { + 'suspect_alleles': set(), + 'suspect_loci': set(), + 'suspect_profiles': set() + } + data = json.loads(quality_data) + + suspect_alleles = set() + suspect_loci = set() + + # Extract suspect alleles and loci from quality data + if 'loci' in data: + for locus, locus_data in data['loci'].items(): + # Check if locus is flagged as suspect + if locus_data.get('suspect', False): + suspect_loci.add(locus) + + # Check for suspect alleles within this locus + if 'alleles' in locus_data: + for allele, allele_data in locus_data['alleles'].items(): + if allele_data.get('suspect', False): + suspect_alleles.add(f"{locus}_{allele}") + + # Also check similarities for low-quality alleles + if 'similarities' in locus_data: + threshold = locus_data.get('threshold', 90.0) + for pair, similarity in locus_data['similarities'].items(): + if similarity < threshold: + # Mark alleles in low-similarity pairs as suspect + allele1, allele2 = pair.split('-') + suspect_alleles.add(f"{locus}_{allele1}") + suspect_alleles.add(f"{locus}_{allele2}") + + # Suspect profiles would mark entire loci + suspect_profiles = set() + if 'profiles' in data: + for profile_id, profile_data in data['profiles'].items(): + if profile_data.get('suspect', False): + # Get loci used in this profile + if 'loci' in profile_data: + suspect_profiles.update(profile_data['loci']) + + return { + 'suspect_alleles': suspect_alleles, + 'suspect_loci': suspect_loci, + 'suspect_profiles': suspect_profiles + } + +# Parse inputs +allele_fasta = "~{allele_fasta}" +quality_json = "~{quality_json}" if "~{quality_json}" and "~{quality_json}" != "" else None +exclude_alleles = ~{true='True' false='False' exclude_suspect_alleles} +exclude_loci = ~{true='True' false='False' exclude_suspect_loci} +exclude_profiles = ~{true='True' false='False' exclude_suspect_profiles} + +# Load alleles +alleles = parse_fasta(allele_fasta) + +# Load quality data +suspect_data = load_quality_json(quality_json) + +# Determine what to exclude +excluded_alleles = [] +excluded_loci = set() +filtered_alleles = [] + +# Build exclusion sets based on flags +to_exclude_alleles = set() +to_exclude_loci = set() + +if exclude_profiles: + # Most aggressive: exclude all loci from suspect profiles + to_exclude_loci.update(suspect_data['suspect_profiles']) + to_exclude_loci.update(suspect_data['suspect_loci']) + to_exclude_alleles.update(suspect_data['suspect_alleles']) +elif exclude_loci: + # Medium: exclude suspect loci and suspect alleles + to_exclude_loci.update(suspect_data['suspect_loci']) + to_exclude_alleles.update(suspect_data['suspect_alleles']) +elif exclude_alleles: + # Least aggressive: only exclude specific suspect alleles + to_exclude_alleles.update(suspect_data['suspect_alleles']) + +# Filter alleles +for header, sequence in alleles: + locus, allele_id = extract_locus_and_allele(header) + full_allele_name = f"{locus}_{allele_id}" + + # Check if this allele should be excluded + exclude = False + + if locus in to_exclude_loci: + exclude = True + excluded_loci.add(locus) + elif full_allele_name in to_exclude_alleles: + exclude = True + excluded_alleles.append(full_allele_name) + + if not exclude: + filtered_alleles.append((header, sequence)) + +# Write filtered FASTA +with open('filtered_alleles.fasta', 'w') as f: + for header, sequence in filtered_alleles: + f.write(f'>{header}\n') + f.write(f'{sequence}\n') + +# Write exclusion metadata +exclusion_data = { + 'excluded_alleles': list(excluded_alleles), + 'excluded_loci': list(excluded_loci), + 'num_excluded_alleles': len(excluded_alleles), + 'num_excluded_loci': len(excluded_loci), + 'total_input_alleles': len(alleles), + 'total_output_alleles': len(filtered_alleles) +} + +with open('exclusions.json', 'w') as f: + json.dump(exclusion_data, f, indent=2) + +PYTHON_SCRIPT + >>> + + output { + File filtered_fasta = "filtered_alleles.fasta" + File exclusions = "exclusions.json" + } + + runtime { + docker: "python:3.12-slim" + cpu: 1 + memory: "2 GB" + } +}