diff --git a/torchbase/tests/test_alignment_fallback.py b/torchbase/tests/test_alignment_fallback.py new file mode 100644 index 0000000..455ac6c --- /dev/null +++ b/torchbase/tests/test_alignment_fallback.py @@ -0,0 +1,915 @@ +"""Acceptance tests for Alignment Fallback WDL task (Issue #16). + +These are RED-phase tests - they MUST fail because the feature is not yet complete. + +Acceptance criteria: +- WDL task signature: query + allele FASTA + MinHash results → refined calls JSON +- Detects ambiguity triggers from MinHash output +- Runs minimap2 alignment for flagged loci +- Refines allele calls with higher precision +- Reports novel alleles if alignment below confidence threshold (e.g., <90%) +- Output JSON: {locus: {allele_id, identity, status: "confirmed"/"novel_allele"}} +- Containerized (Docker/Singularity with minimap2) +- miniwdl check validates syntax +- Test with ambiguous synthetic cases +""" + +import pytest +import json +import tempfile +from pathlib import Path +import subprocess + + +# Get the torchbase root directory +TORCHBASE_ROOT = Path(__file__).parent.parent + + +@pytest.fixture +def allele_database_fasta(): + """Create temporary allele database (FASTA format). + + Creates MLST-style allele database with multiple loci and alleles: + - adk: 3 alleles with subtle variations + - fumC: 3 alleles with subtle variations + - gyrB: 2 alleles + """ + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + db_path = tmpdir_path / "allele_db.fasta" + + # Create realistic MLST allele sequences with subtle differences + fasta_content = """>adk_1 +ATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCCGCACGTGGCAATGCCGCTGCAACTGACTGCACTGGCGCACCTGCCGCTGCTGATGAACGTCATCGGTACGGTCTCGTCCACCGGCTCTACGACCTGGTGTACGACTGTACGTCCGAAATCCTTACTGGCGGCGGTCACACGTCTGCTGGACATCCGCCACCACATTTGCTGCATCACGGCGGCGGTGACGGTGGTTATGGTGGTGACGACCACGCCGTACATCGACGACGTGCTGATCGAACTGATCGAAGACGACGACGACGAAGTGATCGAACTGATCGAAGTGCTGGATGAAGTCGAAAATGTCTAA +>adk_2 +ATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCCGCACGTGGCAATGCCGCTGCAACTGACTGCACTGGCGCACCTGCCGCTGCTGATGAACGTCATCGGTACGGTCTCGTCCACCGGCTCTACGACCTGGTGTACGACTGTACGTCCGAAATCCTTACTGGCGGCGGTCACACGTCTGCTGGACATCCGCCACCACATTTGCTGCATCACGGCGGCGGTGACGGTGGTTATGGTGGTGACGACCACGCCGTACATCGACGACGTGCTGATCGAACTGATCGAAGACGACGACGACGAAGTGATCGAACTGATCGAAGTGCTGGATGAAGTCGAAAATGTCTAG +>adk_3 +ATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCCGCACGTGGCAATGCCGCTGCAACTGACTGCACTGGCGCACCTGCCGCTGCTGATGAACGTCATCGGTACGGTCTCGTCCACCGGATCTACGACCTGGTGTACGACTGTACGTCCGAAATCCTTACTGGCGGCGGTCACACGTCTGCTGGACATCCGCCACCACATTTGCTGCATCACGGCGGCGGTGACGGTGGTTATGGTGGTGACGACCACGCCGTACATCGACGACGTGCTGATCGAACTGATCGAAGACGACGACGACGAAGTGATCGAACTGATCGAAGTGCTGGATGAAGTCGAAAATGTCTAA +>fumC_1 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCTTCTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGAAATCGATCTGGACGAACTGTTCGAACTGATGGAAGAACACGAAGTGCTGATGGTCGACATCCTGATGATGCACGACCACGACGATGACCGTGATAGCACCACTGTACGACATTGACGACGACGACGACGATACAGAACACAATGACGATGGAAGAAAACGACGACGAAGTGATCCACGTGATGGTGTAA +>fumC_2 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCAACTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGAAATCGATCTGGACGAACTGTTCGAACTGATGGAAGAACACGAAGTGCTGATGGTCGACATCCTGATGATGCACGACCACGACGATGACCGTGATAGCACCACTGTACGACATTGACGACGACGACGACGATACAGAACACAATGACGATGGAAGAAAACGACGACGAAGTGATCCACGTGATGGTGTAG +>fumC_3 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCAACTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGAAATCGATCTGGACGAACTGTTCGAACTGATGGAAGAACACGAAGTGCTGATGGTCGACATCCTGATGATGCACGACCACGACGATGACCGTGATAGCACCACTGTACGACATTGACGACGACGACGACGATACAGAACACAATGACGATGGAAGAAAACGACGACGAAGTGATCCACGTGATGGTGTAT +>gyrB_1 +ATGACCCAACTGAAAGTGATGCCGCAACGTGTCGACCTGCAAATCCACGCAGTGCTGATGAAACCGATGAAACTGCTGATGACGAAACTGCTGATGATCGTGGTGATCTGACGGACGAACTGACGAAATACGACGAAAACAAACACGATGTCATCGACGATGTGACGACCGACATGATCACGGACGACGTACTGATGAAACTGGTGATCCACGTGCACGATGAAACGGACGACTACGACGACATGCCGATCGACGATGATGATGATGACCACGACGACAACGACGAAACGATGATCCTGACGATGACGACGATCTGACGGATGACTAA +>gyrB_2 +ATGACCCAACTGAAAGTGATGCCGCAACGTGTCGACCTGCAAATCCACGCAGTGCTGATGAAACCGATGAAACTGCTGATGACGAAACTGCTGATGATCGTGGTGATCTGACGGACGAACTGACGAAATACGACGAAAACAAACACGATGTCATCGACGATGTGACGACCGACATGATCACGGACGACGTACTGATGAAACTGGTGATCCACGTGCACGATGAAACGGACGACTACGACGACATGCCGATCGACGATGATGATGATGACCACGACGACAACGACGAAACGATGATCCTGACGATGACGACGATCTGACGGATGACTAA +""" + + with open(db_path, "w") as f: + f.write(fasta_content) + + yield db_path + + +@pytest.fixture +def query_ambiguous_fasta(): + """Create query sequences with ambiguous matches. + + Creates sequences that match multiple alleles with similar scores, + requiring alignment fallback for disambiguation. + """ + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + query_path = tmpdir_path / "query_ambiguous.fasta" + + # Create sequences with mutations that make MinHash ambiguous + fasta_content = """>query_adk_almost_1_or_2 +ATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCCGCACGTGGCAATGCCGCTGCAACTGACTGCACTGGCGCACCTGCCGCTGCTGATGAACGTCATCGGTACGGTCTCGTCCACCGGCTCTACGACCTGGTGTACGACTGTACGTCCGAAATCCTTACTGGCGGCGGTCACACGTCTGCTGGACATCCGCCACCACATTTGCTGCATCACGGCGGCGGTGACGGTGGTTATGGTGGTGACGACCACGCCGTACATCGACGACGTGCTGATCGAACTGATCGAAGACGACGACGACGAAGTGATCGAACTGATCGAAGTGCTGGATGAAGTCGAAAATGTCTAA +>query_fumC_between_1_and_2 +ATGAATATTAACAACGCACTGGGCGACGTGCTGAAAACCCACGGCCAGATGACGAAAGAAGTGATGCTTCTGACCCAAGGTGCAACCCACGCCTTTGTGACCGCCGTGGGCGACTCGCCCGAAGAAACGCACCACGGAAATCGATCTGGACGAACTGTTCGAACTGATGGAAGAACACGAAGTGCTGATGGTCGACATCCTGATGATGCACGACCACGACGATGACCGTGATAGCACCACTGTACGACATTGACGACGACGACGACGATACAGAACACAATGACGATGGAAGAAAACGACGACGAAGTGATCCACGTGATGGTGTAG +>query_gyrB_novel_allele +ATGACCCAACTGAAAGTGATGCCGCAACGTGTCGACCTGCAAATCCACGCAGTGCTGATGAAACCGATGAAACTGCTGATGACGAAACTGCTGATGATCGTGGTGATCTGACGGACGAACTGACGAAATACGACGAAAACAAACACGATGTCATCGACGATGTGACGACCGACATGATCACGGACGACGTACTGATGAAACTGGTGATCCACGTGCACGATGAAACGGACGACTACGACGACATGCCGATCGACGATGATGATGATGACCACGACGACAACGACGAAACGATGATCCTGACGATGACGACGATCTGACGGATGACTAG +""" + + with open(query_path, "w") as f: + f.write(fasta_content) + + yield query_path + + +@pytest.fixture +def minhash_results_ambiguous(): + """Create MinHash results JSON with ambiguous calls. + + Simulates low-confidence MinHash output that should trigger alignment fallback: + - Top 2 alleles within 3% + - Best match < 92% + - Coverage < 80% + """ + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + results_path = tmpdir_path / "minhash_results.json" + + # Create ambiguous results triggering alignment fallback + results = { + "adk": { + "allele_id": "1", + "similarity": 0.91, # Below 92% threshold + "confidence": False, + "second_best": { + "allele_id": "2", + "similarity": 0.89 # Within 3% of best + } + }, + "fumC": { + "allele_id": "1", + "similarity": 0.88, # Low confidence + "confidence": False, + "second_best": { + "allele_id": "2", + "similarity": 0.87 # Within 3% + } + }, + "gyrB": { + "allele_id": "1", + "similarity": 0.85, # Very low, potential novel allele + "confidence": False + } + } + + with open(results_path, "w") as f: + json.dump(results, f, indent=2) + + yield results_path + + +@pytest.fixture +def minhash_results_confident(): + """Create MinHash results JSON with confident calls. + + Simulates high-confidence MinHash output that should NOT trigger alignment fallback. + """ + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + results_path = tmpdir_path / "minhash_confident.json" + + results = { + "adk": { + "allele_id": "1", + "similarity": 0.98, + "confidence": True + }, + "fumC": { + "allele_id": "2", + "similarity": 0.99, + "confidence": True + }, + "gyrB": { + "allele_id": "1", + "similarity": 0.97, + "confidence": True + } + } + + with open(results_path, "w") as f: + json.dump(results, f, indent=2) + + yield results_path + + +class TestAlignmentFallbackWDLFileExists: + """Test alignment fallback WDL file exists at expected location.""" + + def test_wdl_file_exists(self): + """Alignment fallback WDL file exists""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + assert wdl_path.exists(), f"WDL file not found at {wdl_path}" + + def test_wdl_file_is_file(self): + """Alignment fallback WDL file is a regular file""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + assert wdl_path.is_file(), f"WDL path is not a file: {wdl_path}" + + +class TestAlignmentFallbackWDLTaskSignature: + """Test WDL task signature: query + allele FASTA + MinHash results → refined calls JSON.""" + + def test_wdl_has_task_definition(self): + """WDL file contains task definition""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "task" in content, "WDL file does not contain task definition" + + def test_wdl_task_name_is_alignment_fallback(self): + """WDL workflow/task is named alignment_fallback""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Accept either task or workflow with alignment_fallback name + assert ("task alignment_fallback" in content or + "workflow alignment_fallback" in content), "Task/workflow name is incorrect" + + def test_wdl_has_input_section(self): + """WDL task has input section""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "input {" in content, "Task does not have input section" + + def test_wdl_has_query_sequences_input(self): + """WDL task accepts query_sequences input""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "query_sequences" in content or "query" in content, "Task does not have query sequences input" + + def test_wdl_has_allele_fasta_input(self): + """WDL task accepts allele_fasta input""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "allele_fasta" in content or "allele_db" in content, "Task does not have allele_fasta input" + + def test_wdl_has_minhash_results_input(self): + """WDL task accepts minhash_results input""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "minhash_results" in content or "minhash" in content, "Task does not have minhash_results input" + + def test_wdl_has_output_section(self): + """WDL task has output section""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "output {" in content, "Task does not have output section" + + def test_wdl_output_is_file(self): + """WDL task output is a File type""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for File type in output section + assert "File" in content, "Task output is not File type" + + +class TestAlignmentFallbackWDLSyntaxValidation: + """Test miniwdl check validates WDL syntax.""" + + def test_miniwdl_check_passes(self): + """miniwdl check validates WDL syntax without errors""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + # Run miniwdl check + result = subprocess.run( + ["miniwdl", "check", str(wdl_path)], + capture_output=True, + text=True + ) + + assert result.returncode == 0, f"miniwdl check failed: {result.stderr}" + + +class TestAlignmentFallbackWDLContainerization: + """Test containerized (Docker/Singularity with minimap2).""" + + def test_wdl_has_runtime_section(self): + """WDL task has runtime section""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "runtime {" in content, "Task does not have runtime section" + + def test_wdl_has_docker_image(self): + """WDL task specifies docker image""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "docker:" in content, "Task does not specify docker image" + + def test_wdl_uses_minimap2_container(self): + """WDL task uses minimap2 container image""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "minimap2" in content.lower(), "Task does not use minimap2 container" + + +class TestAlignmentFallbackWDLAmbiguityDetection: + """Test detects ambiguity triggers from MinHash output.""" + + def test_wdl_command_reads_minhash_results(self): + """WDL task command reads MinHash results file""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for JSON reading logic + assert "json" in content.lower(), "Task does not read JSON input" + + def test_wdl_detects_low_similarity_threshold(self): + """WDL task detects low similarity (< 92%) as ambiguity trigger""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for similarity/confidence threshold logic + assert "similarity" in content.lower() or "confidence" in content.lower(), \ + "Task does not check similarity threshold" + + def test_wdl_detects_close_second_best(self): + """WDL task detects top 2 alleles within 3% as ambiguity trigger""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for second_best comparison logic + assert "second_best" in content or "ambiguous" in content.lower(), \ + "Task does not check for close second-best matches" + + def test_wdl_has_ambiguity_threshold_parameters(self): + """WDL task has parameters for ambiguity detection thresholds""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for threshold parameters + assert any(keyword in content.lower() for keyword in ["threshold", "min_identity", "min_similarity"]), \ + "Task does not have ambiguity threshold parameters" + + +class TestAlignmentFallbackWDLMinimap2Integration: + """Test runs minimap2 alignment for flagged loci.""" + + def test_wdl_command_uses_minimap2(self): + """WDL task command uses minimap2""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert "minimap2" in content, "Task command does not use minimap2" + + def test_wdl_command_performs_alignment(self): + """WDL task command performs sequence alignment""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for alignment keywords + assert any(keyword in content.lower() for keyword in ["align", "-a", "-x sr"]), \ + "Task command does not perform alignment" + + def test_wdl_command_processes_alignment_output(self): + """WDL task command processes minimap2 alignment output""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for SAM/PAF processing or identity calculation + assert any(keyword in content.lower() for keyword in ["sam", "paf", "identity", "cigar"]), \ + "Task does not process alignment output" + + +class TestAlignmentFallbackWDLOutputFormat: + """Test output JSON: {locus: {allele_id, identity, status: 'confirmed'/'novel_allele'}}.""" + + def test_wdl_produces_json_output(self): + """WDL task produces JSON output""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + assert ".json" in content.lower() or "json" in content.lower(), "Task does not produce JSON output" + + def test_wdl_output_has_status_field(self): + """WDL task output includes status field""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for status field in output + assert "status" in content.lower() or "confirmed" in content or "novel" in content, \ + "Task output does not include status field" + + def test_wdl_output_has_identity_field(self): + """WDL task output includes identity field""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for identity field + assert "identity" in content.lower(), "Task output does not include identity field" + + +class TestAlignmentFallbackWDLNovelAlleleDetection: + """Test reports novel alleles if alignment below confidence threshold.""" + + def test_wdl_has_novel_allele_threshold(self): + """WDL task has threshold for novel allele detection (e.g., <90%)""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for novel allele threshold parameter + assert any(keyword in content.lower() for keyword in + ["novel_threshold", "min_identity", "identity_threshold"]), \ + "Task does not have novel allele threshold" + + def test_wdl_detects_novel_alleles(self): + """WDL task detects novel alleles when identity is low""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for novel allele detection logic + assert "novel" in content.lower(), "Task does not detect novel alleles" + + def test_wdl_marks_confirmed_alleles(self): + """WDL task marks alleles as confirmed when identity is high""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + with open(wdl_path) as f: + content = f.read() + + # Check for confirmed status + assert "confirmed" in content.lower() or "exact" in content.lower(), \ + "Task does not mark confirmed alleles" + + +@pytest.mark.miniwdl +class TestAlignmentFallbackWDLExecutionWithAmbiguousCalls: + """Test with ambiguous synthetic cases.""" + + def test_wdl_execution_with_ambiguous_calls_produces_output( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_ambiguous + ): + """WDL task execution with ambiguous calls produces output JSON""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Create input JSON for miniwdl + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_ambiguous) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + # Run miniwdl + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + # Check execution succeeded + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + # Find output directory + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + assert len(output_dirs) > 0, "No outputs.json found" + + # Read outputs + with open(output_dirs[0]) as f: + outputs = json.load(f) + + # Check output file exists + assert "alignment_fallback.refined_calls" in outputs, "Output refined_calls not found" + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + assert results_path.exists(), f"Results file does not exist: {results_path}" + + # Read and validate JSON structure + with open(results_path) as f: + results = json.load(f) + + # Check expected loci are present + assert "adk" in results, "adk locus not in results" + assert "fumC" in results, "fumC locus not in results" + assert "gyrB" in results, "gyrB locus not in results" + + def test_wdl_output_has_allele_id_field( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_ambiguous + ): + """WDL output JSON contains allele_id field for each locus""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_ambiguous) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # Check allele_id field + for locus in results: + assert "allele_id" in results[locus], f"allele_id not in {locus} results" + + def test_wdl_output_has_identity_field( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_ambiguous + ): + """WDL output JSON contains identity field for each locus""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_ambiguous) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # Check identity field + for locus in results: + assert "identity" in results[locus], f"identity not in {locus} results" + assert 0.0 <= results[locus]["identity"] <= 1.0, f"identity out of range for {locus}" + + def test_wdl_output_has_status_field( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_ambiguous + ): + """WDL output JSON contains status field for each locus""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_ambiguous) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # Check status field + for locus in results: + assert "status" in results[locus], f"status not in {locus} results" + assert results[locus]["status"] in ["confirmed", "novel_allele"], \ + f"status has invalid value for {locus}: {results[locus]['status']}" + + def test_wdl_detects_novel_allele_for_low_identity( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_ambiguous + ): + """WDL task detects novel alleles when alignment identity is low""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_ambiguous) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # gyrB query has novel allele (different stop codon) + # Should be detected if identity threshold is properly set + if results["gyrB"]["identity"] < 0.90: + assert results["gyrB"]["status"] == "novel_allele", \ + "gyrB should be marked as novel_allele for low identity" + + def test_wdl_confirms_alleles_for_high_identity( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_ambiguous + ): + """WDL task confirms alleles when alignment identity is high""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_ambiguous) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # Check that high-identity matches are confirmed + for locus in ["adk", "fumC"]: + if results[locus]["identity"] >= 0.90: + assert results[locus]["status"] == "confirmed", \ + f"{locus} should be confirmed for high identity" + + +@pytest.mark.miniwdl +class TestAlignmentFallbackWDLSkipsConfidentCalls: + """Test alignment fallback skips loci with confident MinHash calls.""" + + def test_wdl_skips_alignment_for_confident_calls( + self, allele_database_fasta, query_ambiguous_fasta, minhash_results_confident + ): + """WDL task skips alignment for confident MinHash calls""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results_confident) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + # Should succeed and pass through confident calls without alignment + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # Results should pass through unchanged or marked as confirmed + assert len(results) > 0, "Results should not be empty" + for locus in results: + # All should be marked as confirmed since input was confident + assert results[locus]["status"] == "confirmed", \ + f"{locus} should be confirmed when MinHash was confident" + + +@pytest.mark.miniwdl +class TestAlignmentFallbackWDLEdgeCases: + """Test edge cases and boundary conditions.""" + + def test_wdl_handles_empty_minhash_results( + self, allele_database_fasta, query_ambiguous_fasta + ): + """WDL task handles empty MinHash results gracefully""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Create empty MinHash results + empty_results = tmpdir_path / "empty_results.json" + with open(empty_results, "w") as f: + json.dump({}, f) + + input_json = { + "alignment_fallback.query_sequences": str(query_ambiguous_fasta), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(empty_results) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + # Should either succeed with empty results or fail gracefully + assert result.returncode in [0, 1], "Unexpected return code for empty results" + + def test_wdl_handles_single_locus(self): + """WDL task handles single locus alignment""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Create single-locus database + single_locus_db = tmpdir_path / "single_locus.fasta" + with open(single_locus_db, "w") as f: + f.write(">adk_1\nATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCC\n") + f.write(">adk_2\nATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCC\n") + + # Create matching query + query = tmpdir_path / "query.fasta" + with open(query, "w") as f: + f.write(">query\nATGGCTATGAAACAACTCACCAACGTAGCACTGTCCAAAGCC\n") + + # Create ambiguous MinHash results for single locus + minhash_results = tmpdir_path / "minhash.json" + with open(minhash_results, "w") as f: + json.dump({ + "adk": { + "allele_id": "1", + "similarity": 0.89, + "confidence": False, + "second_best": { + "allele_id": "2", + "similarity": 0.88 + } + } + }, f) + + input_json = { + "alignment_fallback.query_sequences": str(query), + "alignment_fallback.allele_fasta": str(single_locus_db), + "alignment_fallback.minhash_results": str(minhash_results) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # Should have exactly one locus + assert len(results) == 1, f"Expected 1 locus, got {len(results)}" + assert "adk" in results, "Expected adk locus in results" + + def test_wdl_handles_all_novel_alleles( + self, allele_database_fasta + ): + """WDL task handles case where all alleles are novel""" + wdl_path = TORCHBASE_ROOT / "workflows" / "alignment_fallback.wdl" + + with tempfile.TemporaryDirectory() as tmpdir: + tmpdir_path = Path(tmpdir) + + # Create query with sequences far from any known allele + novel_query = tmpdir_path / "novel_query.fasta" + with open(novel_query, "w") as f: + # Completely different sequences + f.write(">novel_adk\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\n") + f.write(">novel_fumC\nTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT\n") + f.write(">novel_gyrB\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG\n") + + # MinHash results with very low similarity + minhash_results = tmpdir_path / "minhash_novel.json" + with open(minhash_results, "w") as f: + json.dump({ + "adk": {"allele_id": "1", "similarity": 0.30, "confidence": False}, + "fumC": {"allele_id": "1", "similarity": 0.25, "confidence": False}, + "gyrB": {"allele_id": "1", "similarity": 0.28, "confidence": False} + }, f) + + input_json = { + "alignment_fallback.query_sequences": str(novel_query), + "alignment_fallback.allele_fasta": str(allele_database_fasta), + "alignment_fallback.minhash_results": str(minhash_results) + } + + input_json_path = tmpdir_path / "inputs.json" + with open(input_json_path, "w") as f: + json.dump(input_json, f) + + result = subprocess.run( + ["miniwdl", "run", str(wdl_path), "-i", str(input_json_path), "-d", str(tmpdir_path)], + capture_output=True, + text=True, + timeout=300 + ) + + assert result.returncode == 0, f"miniwdl run failed: {result.stderr}" + + output_dirs = list(tmpdir_path.glob("**/outputs.json")) + with open(output_dirs[0]) as f: + outputs = json.load(f) + + results_path = Path(outputs["alignment_fallback.refined_calls"]) + with open(results_path) as f: + results = json.load(f) + + # All loci should be marked as novel_allele + for locus in results: + assert results[locus]["status"] == "novel_allele", \ + f"{locus} should be marked as novel_allele"