diff --git a/LICENSE b/LICENSE old mode 100644 new mode 100755 diff --git a/README.md b/README.md old mode 100644 new mode 100755 diff --git a/bin/clermont.py b/bin/clermont.py index 137f861..2e10ed1 100755 --- a/bin/clermont.py +++ b/bin/clermont.py @@ -1,6 +1,11 @@ #!/usr/bin/env python3 """ -Current Version - 1.4.0: Fév. 2019 +Current Version - 21.03: Mar 2021 + 21.03: + - Adding an essential primer for F group + - Change the mash database + 21.02: + - Change arpAgpE primers by fdm primers for E group 1.4.0: - Adding an essential primer for G group 1.3.0: @@ -57,7 +62,7 @@ #Definition of Primers names and size of PCR product (bp) class Primers: def __init__(self): - self.names = {"trpA": 783, "trpBA": 489, "chuAalbertii": 136, "citPferg": 300, "chuA": 288, "yjaA": 211, "TspE4.C2": 152, "arpA": 400, "ArpAgpE": 301, "trpAgpC": 219, "aesI": 315, "aesII": 125, "chuIII": 183, "chuIV": 461, "chuV": 600, "ybgD": 177} + self.names = {"trpA": 783, "trpBA": 489, "chuAalbertii": 136, "citPferg": 300, "chuA": 288, "yjaA": 211, "TspE4.C2": 152, "arpA": 400, "fdm": 265, "trpAgpC": 219, "aesI": 315, "aesII": 125, "chuIII": 183, "chuIV": 461, "chuV": 600, "ybgD": 177, "cfaB" : 314} ############################################################################### ############# FUNCTIONS ############# @@ -203,7 +208,7 @@ def pcr_parser_groups(quadruplex): quadruplex.append('-') #return the specific primers (grp E or C disambiguity) specific = [] - specific_names = ["chuAalbertii", "citPferg", "aesI", "aesII", "chuIII", "chuIV", "chuV", 'ArpAgpE', 'trpAgpC'] + specific_names = ["chuAalbertii", "citPferg", "aesI", "aesII", "chuIII", "chuIV", "chuV", 'fdm', 'trpAgpC', 'cfaB', 'ybgD'] for name in specific_names: if name in pcr_products: specific.append(name) @@ -229,18 +234,18 @@ def find_phylo_group(markers): return("cladeI") else: #Double check for clade E - if "ArpAgpE" in markers: + if "fdm" in markers: return("E") else: return("E or cladeI") else: if "TspE4.C2" in markers: - if "ArpAgpE" in markers: + if "fdm" in markers: return("E") else: return("D") else: - if "ArpAgpE" in markers: + if "fdm" in markers: return("E") else: return("D") diff --git a/bin/mash_LICENSE b/bin/mash_LICENSE old mode 100644 new mode 100755 diff --git a/clermonTyping.sh b/clermonTyping similarity index 98% rename from clermonTyping.sh rename to clermonTyping index 785940e..d12f051 100755 --- a/clermonTyping.sh +++ b/clermonTyping @@ -10,8 +10,8 @@ # 4] Launch in silicco PCR for getting phylogroup # 5] Reportings tools # -# Current version : 20.03 (Mar. 2020) -version="Clermont Typing Current version : 20.03 (Mar. 2020)" +# Current version : 21.03 (Mar. 2021) +version="Clermont Typing Current version : 21.03 (Mar. 2021)" # Contact: antoine.bridier-nahmias@inserm.fr diff --git a/data/mash/mash_reference.msh b/data/mash/mash_reference.msh index 12ff7a9..d58d03a 100755 Binary files a/data/mash/mash_reference.msh and b/data/mash/mash_reference.msh differ diff --git a/data/primers.fasta b/data/primers.fasta old mode 100644 new mode 100755 index c000a2b..620b3a8 --- a/data/primers.fasta +++ b/data/primers.fasta @@ -1,3 +1,7 @@ +>cfaB_R +AGATATCACTGTTACTGCTAACG +>cfaB_F +TTAACGCATCGGAAGCAAAG >ybgD_R TATGCGGCTGATGAAGGATC >ybgD_F @@ -34,10 +38,10 @@ AGTTTATCGCTGCGGGTCGC AACGCTATTCGCCAGCTTGC >arpA_R TCTCCCCATACCGTACGCTA ->ArpAgpE_F -GATTCCATCTTGTCAAAATATGCC ->ArpAgpE_R -GAAAAGAAAAAGAATTCCCAAGAG +>fdm_F +TGGCGGCATTGTTAGCGTAC +>fdm_R +GGGTACCAGAATCACCTTAC >trpAgpC_F AGTTTTATGCCCAGTGCGAG >trpAgpC_R